Application of Watermelon KNOX Transcription Factor ClSPR in Creating Netted Fruit Watermelon

Abstract

The application discloses application of watermelon KNOX transcription factor ClSPR in creating net-textured pericarp watermelon and belongs to the technical field of plant genetic engineering.The application discloses the application of watermelon KNOX transcription factor ClSPR in creating net-textured pericarp watermelon, adopts CRISPR / Cas9 gene editing technology, carries out site-directed editing on the watermelon KNOX transcription factor ClSPR, and obtains new germplasm of the net-textured pericarp watermelon.The net-textured pericarp watermelon germplasm created by the application has no visible phenotype change in other tissues such as female flowers, leaves, tendrils, stems and roots compared with a wild type, and only the fruit pericarp stripe phenotype is changed;the technology can realize directional genetic improvement of the excellent watermelon germplasm fruit pericarp stripe phenotype, accumulates new materials for breeding of new varieties, and has important production and application potential.

Description

Technical Field

[0001] This invention relates to the field of plant genetic engineering technology, and more specifically to the application of the watermelon KNOX transcription factor ClSPR in the creation of netted watermelons. Background Technology

[0002] Watermelon (Citrullus lanatus), belonging to the genus Citrullus of the family Cucurbitaceae, is one of the most widely cultivated and important cucurbit crops in the world, and also a fruit-type economic crop. According to statistics, in 2022, my country's watermelon planting area reached 1.3919 million hectares, with a total output of 60.5422 million tons, accounting for 47.73% and 60.57% of the world's total cultivated area and output, respectively (FAO, http: / / www.fao.org / ). Therefore, as one of the important cucurbit crops cultivated in my country, watermelon plays a vital role in agricultural restructuring and rural economic development.

[0003] The stripes on the rind are an important appearance quality of watermelons, directly influencing consumer preferences in the market. For example, Crimson-type watermelons, with their green, wide stripes and diffused stripe edges, are popular in the United States, Brazil, and Europe; while Jubille-type watermelons, with their dark green, medium-wide stripes and clearly defined stripe edges, sell better in China and South Korea. This demonstrates that rind stripes, as a typical agronomical trait of watermelons, are not only significant for improving the commercial quality of watermelons but also influence consumer purchasing choices, thereby affecting market sales. Currently, research on watermelon stripe traits mainly focuses on genetic analysis and candidate gene localization and cloning. Research on the molecular mechanisms of related regulatory genes has not yet been reported. For example, Kim et al. located the major QTL locus of watermelon rind stripes to the 2.29Mb range on chromosome 6; while HeeBum, Park et al. located the rind stripe regulatory locus S to the 3.99Mb range on chromosome 6; Maragaal et al. showed that the candidate genes for watermelon rind stripes and interstripe rind color are Cla97C09G175170 and Cla97C09G175150 on chromosome 9, respectively; Wang et al. found that the formation of discontinuous stripes on watermelon rind is regulated by ClIS (Cla019202).

[0004] Therefore, providing the application of the watermelon KNOX transcription factor ClSPR in the creation of netted watermelons is a problem that urgently needs to be solved by those skilled in the art. Summary of the Invention

[0005] In view of this, the present invention provides the application of watermelon KNOX transcription factor ClSPR in the creation of netted watermelons.

[0006] In the early stages of this invention, the ClSPR gene, which regulates watermelon rind stripes, was located using traditional gene mapping techniques, and the optimal candidate gene was preliminarily identified through sequence and expression analysis. Based on this gene, CRISPR / Cas9 technology can be used to directionally alter the watermelon rind stripe phenotype, thereby enriching the appearance traits of superior watermelon materials and providing material resources for the development of new specialty watermelon varieties.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] Application of watermelon KNOX transcription factor ClSPR in the creation of netted watermelon, wherein the CDS sequence of watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1.

[0009] Furthermore, the application of biomaterials with knockout of watermelon KNOX transcription factor ClSPR in the creation of netted rind watermelons, wherein the CDS sequence of watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1;

[0010] The biomaterial is any one of the following:

[0011] A: An expression cassette that can silence the watermelon KNOX transcription factor ClSPR;

[0012] B: A recombinant vector containing the expression cassette described in A;

[0013] C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

[0014] Furthermore, a method for creating a new germplasm of watermelon with reticulated rind involves using CRISPR / Cas9 or other gene editing technologies to perform site-specific editing or knockout of the watermelon KNOX transcription factor ClSPR or its conserved domain sequence, thereby causing the gene protein to lose function or mutate, resulting in a reticulated rind phenotype. The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1.

[0015] This invention, for the first time, utilizes the localized watermelon KNOX transcription factor ClSPR and combines it with CRISPR / Cas9 technology to create a new watermelon germplasm with netted rind. This method enables targeted genetic improvement of the striped rind phenotype in superior watermelon germplasm, accumulating new materials for the breeding of new varieties and possessing significant potential for production applications.

[0016] As can be seen from the above technical solution, compared with the prior art, this invention discloses the application of the watermelon KNOX transcription factor ClSPR in the creation of netted watermelons. For the first time, CRISPR / Cas9 or other gene editing systems are used to edit and knock out the KNOX transcription factor ClSPR or its conserved domains, resulting in the loss of gene function or mutation, thereby forming the netted rind phenotype. Compared with wild-type materials, the netted watermelon germplasm created by this invention shows no visible phenotypic changes in other tissues such as female flowers, leaves, tendrils, stems, and roots, except for the altered striped phenotype of the rind. This technology can achieve targeted genetic improvement of the striped rind phenotype in superior watermelon germplasm, accumulating new materials for the breeding of new varieties and possessing significant potential for production application. Attached Figure Description

[0017] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the provided drawings without creative effort.

[0018] Figure 1 The attached figure shows the sgRNA expression element of the recombinant plasmid of the present invention; wherein U6-26p and U6-29p are promoters, U6-26t is a terminator, gRNA-Sc is the gRNA backbone, and Target1 and Target2 are target sites;

[0019] Figure 2 The attached figures are schematic diagrams of the target structure and phenotypic diagram of the present invention;

[0020] Among them, (a) schematic diagram of ClSPR gene structure; the positions of Target1 and Target2 on the gene, two gene-edited plants, Clspr_1 and Clspr_2, were obtained, with 4bp and 1bp deletions in Target1, and 7bp and 6bp deletions in Target2, respectively (- indicates deletion); (b) stripe phenotype of unedited plant (WT) and edited plant, where WT has dark green stripes on its pericarp, while the edited plants Clspr_1 and Clspr_2 have reticulated stripes on their pericarp. Detailed Implementation

[0021] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0022] The CDS sequence of ClSPR is shown in SEQ ID NO.1.

[0023] ATGGCGGATCTTTACGGACTCCATCCCCTCGCTGATAACTCTTACCAGTCATCTTCAGCGACGACGTTGGGTAGCTTTCCTCTTCTTGCTAATTCTCCAATGGCTTCTGCAGATTATTCTCATCTACTTCCTGCTTTTGAATCGGAATATTTGCGGACGGTTTCGTCGGCCGCCTGCGACACCGTTGCGGCGGCGGCTGAGATTGAAACAGCGCGAGCTAATTCCGAGTACTCCGCCGGTGTAATTCGAGCGAAAATTGCTTCTCATCCTCTTTACCCTAAACTCGTCGATGCGTTCGTGAACTGCCAAAAGGTCGGTGTACCG CCGGAGTTCGCTGATATTC CAGACCAAAACAACCGTGGAAGTGATATCGGCGAAGAAATTTCCGGCGTTTCAAATTGCTTGGGTGTCGATCCCGAACTCGATGAGTTCATGGAAACATACTACAGGATACTAGCCAAATACGAGTTAGATCTCTCCCAGTCCTTCATGGAAGCATCTTCCTTTCTCAACAACATGGGAATGCAGTTAAACGTGCTTTGCAATAACGATGAAACTGCTCCGAAAGAGAATATAAGCGCCGGAGAAGTAGAATTACAAGACTCTCTTGTGGTTCCGGGAAATGAAGATCGCGAGCTGAAGGATCGACTTTTGCGGGAGTACGGTGGTCATATTAGTAGCTTAAAGCAGGAATTCTCAAAAACTAAAAAGAAGGCAAATCTGCCGAGAGAAGCCAAACAGATCCTGCTTCACTG GTGGAACAGCCATTCCCAG TGGCCATATCCCACTGACACAGAAAAAGTTGAGTTGGCCGAGTCGACAGGCCTAACCCGAAAACAAATAAACAACTGGTTCATAAACCAGAGGAAACGGCATTGGAAATCACCATAA;SEQ ID NO.1.

[0024] Example 1: Selection of editing sites for gene ClSPR

[0025] Gene editing target sites were designed based on the CDS sequence of ClSPR (as shown in SEQ ID NO.1) and the online target site design website CRISPR-P (http: / / crispr.hzau.edu.cn / CRISPR2 / news.php, V2). Two editing sites (Target1 and Target2) were designed. Target1 and Target2 are located on the second and fourth exons of the ClSPR gene, respectively.

[0026] Target1 sequence: CCGGAGTTCGCTGATATTC; SEQ ID NO.2;

[0027] Target2 sequence: GTGGAACAGCCATTCCCAG; SEQ ID NO.3.

[0028] Example 2: Construction of CRISPR / Cas9 Editing Vector

[0029] 1) PCR amplification:

[0030] Based on the two target sequences mentioned above, adapter primers Target1F / Target2R were synthesized. Using the intermediate vector pCBC-DT1T2 diluted 100-fold as a template, PCR amplification was performed using the high-fidelity enzyme PrimeStarMax Premix (TaKaRa). The PCR amplification system consisted of: 25 μL PrimeStarMax Premix (2×), 2.5 μL template, 2.5 μL each of forward and reverse primers, and 17.5 μL ddH2O. The PCR reaction program was: 98℃ for 10 s, 58℃ for 5 s, 72℃ for 15 s, for 38 cycles; followed by 72℃ for 5 min.

[0031] The target sequence adapter primers (with the underlined part indicating the target sequence) are as follows:

[0032] Target1 sequence primer: Target1F

[0033] ATATATGGTCTCGATTG GAATATCAGCGAACTCCGG GTTTTAGAGCTAGAAATAGC;SEQ ID NO.4;

[0034] Target2 sequence primer: Target2R

[0035] ATTATTGGTCTCGAAAC CTGGGAATGGCTGTTCCAC CAATCTCTTAGTCGACTCTAC; SEQ ID NO.5.

[0036] 2) Vector enzyme digestion:

[0037] The CRISPR / Cas9 vector PBSE402 was digested using the restriction endonuclease BsaI (NEWENGLANDBioLabs). The digestion system consisted of 2 μg PBSE402, 5 μL CutSmart buffer, 1 μL BsaI, and ddH2O to a final volume of 50 μL. Digestion was carried out at 37°C for 2 h, followed by gel extraction after electrophoresis.

[0038] Ligation of PCR products with vector: The PCR amplified products were ligated with the enzyme-digested vector PBSE402 for homologous recombination. The ligation system was as follows: vector to insert molar ratio approximately 1:2; 4 μL 5× reaction buffer; 1 μL NovoRec Plus recombinase; ddH2O to a final volume of 20 μL. Ligation was carried out at 50℃ for 10 min.

[0039] See recombinant plasmid backbone Figure 1 .

[0040] 3) Transformation with recombinant plasmids:

[0041] Five μl of the ligation product was heat-shocked and transformed into competent E. coli DH5α cells. The cells were then plated on LB agar plates containing 50 mg / L kanamycin and incubated overnight at 37°C. Colonies were then detected for positivity using primers U626-IDF / U629-IDR.

[0042] The specific primer sequences are as follows:

[0043] U626-IDF: TGTCCCAGGATTAGAATGATTAGGC; SEQ ID NO.6;

[0044] U629-IDR: AGCCCTCTCTCTTTCGATCCATCAAC; SEQ ID NO.7.

[0045] After successful sequencing, the recombinant plasmid was extracted and transformed into Agrobacterium competent cells EHA105. After PCR verification, it was used for watermelon genetic transformation. The Agrobacterium transformation steps are as follows:

[0046] Add 1 μl of recombinant plasmid to Agrobacterium EHA105 competent cells, place in an ice box for 5 min, then rapidly freeze in liquid nitrogen for 5 min, and incubate in a 37°C water bath for 5 min. Add 400 μl of antibiotic-free culture medium to each tube for resuscitation, then transfer to a shaker at 200 rpm and 28°C for incubation. Spread 100 μl of the resuscitated bacterial culture onto LB agar plates containing antibiotics, air dry at room temperature, and after the bacterial culture has been fully absorbed, invert the culture dish and incubate at 28°C for 2-3 days.

[0047] Example 3

[0048] 1) Watermelon genetic transformation:

[0049] Take plump watermelon 'TC' seeds, soak them in distilled water at 50-55℃ for about 30 minutes, and then peel off the seed coat. In a clean bench, wash the peeled kernels with 75% alcohol for about 30 seconds, wash them twice with sterile water, then soak them in 3% sodium hypochlorite for 15 minutes for disinfection, wash them 5-7 times with sterile water, dry them, and sow them on MS solid medium. Incubate them in the dark at 25℃ for 3 days.

[0050] After the seeds germinate, remove them, cut off both ends of the cotyledons, and divide the remaining cotyledonary parts into 8 equal pieces for easy infection. Meanwhile, single colonies of EHA105 containing the recombinant plasmid, verified by PCR, are picked and placed in LB liquid medium containing 50 mg / L kanamycin and 20 mg / L rifampin. The bacterial culture is allowed to reach an OD value after shaking. 600 When the concentration was 0.8, the bacterial culture was resuspended in MS medium (MS 5194.43 g / L, sucrose 30 g / L, 6-BA 1.5 mg / L) to achieve the final OD concentration. 600 =0.2, to obtain the bacterial suspension. Soak the cut cotyledons in the bacterial suspension for 15 min, remove and air dry, and then co-culture them in a co-culture medium (CM: MS519 4.43 g / L, sucrose 30 g / L, G3251 (PhytoTechLabs) 3 g / L, 6-BA 1.5 mg / L) lined with filter paper, and incubate in the dark at 25℃ for 3 days.

[0051] After co-culturing for 3 days, the cotyledon blocks were removed and washed with sterile water to remove excess Agrobacterium bacterial solution (washing about 5-7 times) until the sterile water was clear. After drying, they were placed on recovery medium (RM: MS5194.43g / L, sucrose 30g / L, G32513g / L, 6-BA 1.5mg / L, 200mg / L Timentin) for recovery culture at 28℃ for 7 days.

[0052] Seven days later, the regenerated cotyledons were transferred to MS medium (selection medium SM) containing 1.5 mg / L 6-BA, 200 mg / L Timentin, and 1.4 mg / L Basta for selective culture. Subculture was carried out at 28°C for 3-4 weeks, with subculture every 7 days. Explants with distinct buds were then transferred to bud elongation medium (containing 4.43 g / L MS524, 30 g / L sucrose, 3 g / L LG3251, 1 g / L inositol, 500 μL / L SH organic solution, 0.01 mg / L NAA, 0.1 mg / L 6-BA, 200 mg / L Timentin, and 1.4 mg / L Basta) under the following conditions: 28°C, 8 h / d darkness, 16 h / d light, and a light intensity of 8000 Lx. Cut off the selected buds (note that the cut should not contain callus) and transfer them to MS medium containing 0.5 mg / L IBA and 200 mg / L Timentin for rooting culture. Culture at 28°C until rooting occurs.

[0053] The SH organic solution contains 10 g / L nicotinic acid, 10 g / L VB1, and 1 g / L VB6.

[0054] When the regenerated seedlings have grown roots and 4-5 true leaves, remove them from the culture bottle, slowly rinse the culture medium off the roots with clean water, transplant them into a substrate that has been sterilized by high temperature and high pressure, water them thoroughly, and keep them warm and moist for cultivation. After 3-4 days, when water droplets are seen on the cover of the seedling tray, gradually open the cover to harden off the seedlings.

[0055] 2) Detection of transgenic watermelon plants:

[0056] The PBSE402 vector carries a GFP fluorescent tag. DNA was extracted from regenerated watermelon seedlings with GFP fluorescence using the CTAB method. The steps were as follows: A small amount of young leaves were rapidly ground into powder in liquid nitrogen and placed in a 1.5 ml centrifuge tube; 800 μl of preheated CTAB extraction buffer was added, and the mixture was incubated at 65°C for 30 min; an equal volume of chloroform-isoamyl alcohol was added, with a chloroform-to-isoamyl alcohol volume ratio of 24:1, and the mixture was centrifuged at 8000 rpm for 10 min; the supernatant was transferred to a new centrifuge tube, 2 / 3 volume of isopropanol was added, and the mixture was gently mixed by inverting; the mixture was centrifuged at 10000 rpm for 10 min; the supernatant was discarded, and the precipitate was washed twice with 75% ethanol. The precipitate was discarded, and the remaining liquid was aspirated. After drying for 3 min, the precipitate was dissolved in 100 μl of ddH2O (containing 0.1% RNase) and stored at 4°C for later use.

[0057] Using the extracted DNA as templates, PCR amplification was performed on the sequences of the two target sites using primers ClSPR-CRJC-F1 / R1 for target site 1 and ClSPR-CRJC-F2 / R2 for target site 2. The positive control was the recombinant plasmid, and the negative control was DNA from non-transgenic plants.

[0058] The specific primer sequences are as follows:

[0059] ClSPR-CRJC-F1:

[0060] ATTATTCTCATCTACTTCCTGCTT;SEQ ID NO.8;

[0061] ClSPR-CRJC-R1:

[0062] TTTTCTTTTTCTTTTATCTACCGT;SEQ ID NO.9;

[0063] ClSPR-CRJC-F2:

[0064] GGAGGGTTGATAGATTGGGGTTT;SEQ ID NO.10;

[0065] ClSPR-CRJC-R2:

[0066] TAGGAGTAAGTTAGCATGTTTGGT; SEQ ID NO. 11.

[0067] The amplification system consisted of: 10 μL of 2×Taq PCR StarMix with loading dye, 1 μL of template, 1 μL each of forward and reverse primers, and 7 μL of ddH2O. The PCR reaction program was: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 1 min, for 30 cycles; 72℃ for 5 min. PCR products were recovered based on band size and TA cloning was performed. After positive PCR detection in bacterial culture, selected clones were sent for confirmation of edit events. Results are shown below. Figure 2 Two gene-edited plants, Clspr_1 and Clspr_2, were obtained, with 4bp and 1bp deleted in Target1, respectively, and 7bp and 6bp deleted in the Target2 target region, respectively.

[0068] 3) Phenotypic observation of transgenic watermelon plants:

[0069] Edited plants Clspr_1 and Clspr_2 were planted in a greenhouse and managed normally. When the fruit matured (35 days after pollination), their phenotype was observed: compared to the wild-type plant (WT), the fruit was covered with dark green stripes. Figure 2The edited plant's fruit is covered with reticulate stripes, and its phenotype has changed.

[0070] In summary, this invention provides a method for creating reticulated watermelon germplasm using gene editing technology. By editing the sequence of the rind stripe regulatory gene ClSPR, reticulated watermelon lines can be rapidly obtained, providing technical support for the targeted improvement of the rind stripe phenotype of superior watermelon germplasm.

[0071] The above description of the disclosed embodiments enables those skilled in the art to make or use the invention. Various modifications to these embodiments will be readily apparent to those skilled in the art, and the general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novel features disclosed herein.

Claims

1. The application of knocking out the watermelon KNOX transcription factor ClSPR in creating netted watermelons, characterized by, The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.

1.

2. The application of biomaterials with knockout of the watermelon KNOX transcription factor ClSPR in the creation of netted rind watermelons, characterized in that, The CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1; The biomaterial is any one of the following: A: An expression cassette that can silence the watermelon KNOX transcription factor ClSPR; B: A recombinant vector containing the expression cassette described in A; C: Recombinant microorganisms containing the expression cassette described in A or the recombinant vector described in B.

3. A method for creating a new germplasm of netted watermelon, characterized in that, The watermelon KNOX transcription factor ClSPR was knocked out at a specific site using CRISPR / Cas9 gene editing technology; the CDS sequence of the watermelon KNOX transcription factor ClSPR is shown in SEQ ID NO.1.

Images