Immortalized cell line as well as construction method and application thereof

Abstract

The invention discloses an immortalized cell line, the preservation information of the immortalized cell line is as follows: the classification name of the immortalized cell line Im-PROS-ADSCs Homo sapiens is PIK3CA related over-growth disease spectrum (PROS), the preservation unit is China Center for Type Culture Collection (CCTCC), the preservation number is CCTCC NO: C2023155, and the preservation date is August 16, 2023. The construction method of the immortalized cell line comprises the following steps: aiming at a clinical symptom of hyperplasia of fat in a PROS disease spectrum, taking facial invasive lipoma as an entrance, extracting adipose tissue-derived stem cells, and transferring SV40LT virus into the adipose tissue-derived stem cells for cell immortalization construction to obtain a first immortalized cell line aiming at the PROS disease. The immortalized cells aiming at PROS disease (facial invasive lipoma) adipose tissue-derived stem cells are established for the first time, the properties of the immortalized cells are researched in vivo and in vitro, the gene expression and drug targets of the immortalized cells are analyzed, an effective research tool is provided for follow-up research, and the immortalized cells have wide application prospects.

Description

[0001] This application is a divisional application of the Chinese invention patent application with the application date of September 21, 2023, application number 202311222726.5, and invention name "An immortalized cell line, construction method and application thereof". Technical Field

[0002] The invention belongs to the field of cells, and specifically relates to an immortalized cell line and a construction method and application thereof. Background Art

[0003] The PIK3CA gene-associated overgrowth disease spectrum (PROS) is a congenital overgrowth malformation caused by mutations in the PIK3CA gene in some somatic cells of the embryo. The typical manifestations of PROS include vascular malformations, excessive proliferation of bones and soft tissues, and abnormalities of the nervous system and viscera. Currently, there are 9 overgrowth diseases associated with PIK3CA mutations that are included in the PROS spectrum, namely CLOVES syndrome, megalencephaly-capillary malformation syndrome, hemi-multiple lipomas, macrodactyls / digits, hemi-megalencephaly / dysplastic megalencephaly, diffuse capillary malformations with limb hyperplasia, facial infiltrating lipomas, Klippel-Trenaunay syndrome, and seborrheic keratosis / benign lichenoid keratosis. The phenotypes of these diseases vary greatly and are often easily missed or misdiagnosed. At the same time, the lesions of this type of disease are complex in composition and can affect the structures of the body and limbs, soft tissues, blood vessels, nerves, bones, etc. from the shallow to the deep. Not only will they cause obvious appearance defects or functional disorders, but they may also cause serious complications such as bleeding, thrombosis, hydronephrosis, cerebral infarction, epilepsy, and even life-threatening.

[0004] Up to now, basic research on PROS disease has been conducted on primary cells, and no stable cell lines have been reported. Since PROS disease is a rare disease, the acquisition of primary cells is difficult, has a long cycle, and has low success rate. At the same time, the heterogeneity of patients also increases the instability of experiments, which has caused great obstacles to the progress of PROS basic research. Therefore, the establishment of PROS disease-related cell lines is of great significance for the study of PROS disease. Summary of the invention

[0005] The present invention innovatively provides an immortalized cell line for the first time, which is an immortalized cell line of adipose mesenchymal stem cells of facial infiltrating lipoma, which is one of the diseases in the PROS disease spectrum.

[0006] Specifically, the immortalized cell line of the present invention is a PIK3CA gene-associated overgrowth disease spectrum (i.e., PROS)-facial infiltrating lipoma adipose mesenchymal stem cell immortalized cell line. More specifically, in a specific embodiment, the immortalized cell line of the present invention is an immortalized-facial infiltrating lipoma ADSCs (Im-PROS-ADSCs) cell line.

[0007] In the present invention, the preservation information of the immortalized cell line is as follows: classified and named as PIK3CA-associated overgrowth disease spectrum (PROS) human adipose mesenchymal stem cell immortalized cell line Im-PROS-ADSCs Homo sapiens, the preservation unit is China Type Culture Collection CCTCC, the preservation address is Wuhan University, Wuhan, China, the preservation number is CCTCC NO: C2023155, the preservation date is August 16, 2023, the China Type Culture Collection detected survival on August 21, 2023, and the depositor is requested to be the Ninth People's Hospital Affiliated to Shanghai Jiao Tong University School of Medicine.

[0008] Preferably, the immortalized cell line includes but is not limited to 48 highly expressed genes. Preferably, the immortalized cell line includes but is not limited to genes E2F1, E2F7, E2F8, ETV4, MYBL2, etc. Preferably, the genes encoding the immortalized cell line transcription factor E2F1, ASF1B, CCNE1, CDC6, MCM5, RAD51, and TERT are concentrated and enriched, and the enrichment concentration is the highest.

[0009] The present invention also provides a method for constructing an immortalized cell line. The present invention aims at the clinical symptoms of excessive fat hyperplasia in the PROS disease spectrum, uses facial infiltrating lipoma as an entry point, extracts its adipose mesenchymal stem cells, and transfers SV40LT virus therein for cell immortalization construction, thereby constructing the first immortalized cell line for PROS. In a specific embodiment, after extracting primary cells from PROS disease patients, the immortalized cells can be obtained by the immortalized cell line construction method of the present invention.

[0010] Specifically, the construction method of the present invention is: extracting adipose tissue from patients with facial infiltrating lipoma, verifying its PIK3CA mutation through second-generation detection, extracting primary ADSCs, and transferring SV40LT virus in vitro for cell immortalization construction. Further, RT-qPCR is used to verify its expression level. Further, the cells are continuously cultured to 50 generations, and the cell characteristics are observed.

[0011] In a specific embodiment, the construction method comprises the following steps:

[0012] Preliminary preparation: Primary ADSCs (adipose-derived mesenchymal stem cells) were extracted by extracting adipose tissue from patients with facial infiltrative lipoma and verifying its PIK3CA mutation through next-generation sequencing.

[0013] ①SV40LT antigen lentiviral packaging:

[0014] On the first day, 2 million 293FT cells were inoculated in a 10 cm dish. When the cell density reached 85%, the SV40-T lentiviral vector and the packaging vector (PsPax2 and Vsvg) were transferred into the 293FT cells using the transfection reagent Lipo3000. The medium was changed after 6 hours, and the viral supernatant was collected after 48 hours to detect the viral titer and stored at 4 degrees for use.

[0015] ②Viral infection:

[0016] After the cells were subcultured in a 6-well plate for 12-16 hours, the collected virus supernatant SV40LT was mixed with fresh cell culture medium, with a ratio of 0.9 ml of fresh culture medium and 1.0 μl of polybrene (final concentration 8 μg / ml) added to 0.1 ml of virus supernatant. The premixed virus infection solution was added to the target cell culture dish, at which the cell density should not exceed 60%. After overnight culture, the culture medium was replaced with fresh culture medium. After 48 hours, green fluorescent cells were sorted out using a flow cytometer, subcultured and frozen.

[0017] ③Cell culture

[0018] On the first day, continue to passage the primary cells that need to be immortalized into T25 flasks, and the growth density is about 30%-50%;

[0019] On the second or third day, when the cell density reached 80%, cells were sorted into a 96-well plate using a flow cytometer, and 200 μl of primary cell culture medium was added to each well;

[0020] After about a week of culture, the medium was changed every 2 days to observe whether single cells in the diluted wells formed clones. After about 10 days, a single clone cell group (5-10) was picked and expanded and passaged.

[0021] ④Result verification: Morphological observation of cells, immunofluorescence verification and RT-qPCR verification of gene expression and mutation sites.

[0022] The present invention innovatively achieves for the first time the successful construction of an immortalized cell line based on PROS disease.

[0023] The present invention also provides an immortalized cell line constructed by the above method. Preferably, the preservation information of the immortalized cell line is as follows: the classification is named as PIK3CA-related overgrowth disease spectrum (PROS) human adipose mesenchymal stem cell immortalized cell line Im-PROS-ADSCs Homo sapiens, the preservation unit is China Type Culture Collection Center CCTCC, the preservation address is Wuhan University, Wuhan, China, the preservation number is CCTCC NO: C2023155, the preservation date is August 16, 2023, the depositor is requested to be the Ninth People's Hospital Affiliated to Shanghai Jiaotong University School of Medicine, and the survival is detected on August 21, 2023. Preferably, it is an immortalized-facial infiltrating lipoma ADSCs (Im-PROS-ADSCs) cell line.

[0024] The present invention also provides a kit or reagent, which comprises the immortalized cell line as described above. Further, the kit may also comprise a cell culture fluid, a cell washing fluid, a cell digestion fluid, etc.; the cell culture fluid comprises a cell culture medium containing cytokines, fetal bovine serum, etc., the cell washing fluid comprises physiological saline, and the cell digestion fluid comprises a collagenase II aqueous solution; the kit or reagent may also comprise a PBS buffer.

[0025] The present invention also provides a product, which contains the above-mentioned immortalized cell line and can be used for high-throughput drug screening; specifically, the product acts on the drug target in the immortalized cell line to inhibit the proliferation of the immortalized cell line and screen the drug.

[0026] The present invention also provides a drug therapy efficacy evaluation vector, which comprises the immortalized cell line. Further, the drug therapy efficacy evaluation vector also comprises a cell culture fluid and a detection reagent; the cell culture fluid comprises a cell culture medium containing cytokines, fetal bovine serum, etc., and the detection reagent is selected according to actual needs to evaluate the drug therapy efficacy after drug treatment.

[0027] The present invention also provides the immortalized cell line, the construction method, the kit or reagent, the use of the product in preparing drugs for treating PROS diseases and / or performing high-throughput drug screening, and the use of the drug treatment efficacy evaluation vector in PROS drug treatment efficacy evaluation.

[0028] The drugs include PI3K kinase inhibitors, angiogenesis inhibitors, JAK / STAT inhibitors, NF-kB inhibitors, cytoskeleton inhibitors, metabolic inhibitors, and HSP inhibitors. Further, the drugs include STAT3 inhibitors (including but not limited to Napabucasin), HSP inhibitors (including but not limited to Ganetespib), EGFR inhibitors (including but not limited to Almonertinib), NF-kB inhibitors (including but not limited to Andrographolide), PI3K inhibitors (including but not limited to Alpelisib); and / or, the drugs include PI3K / HDAC dual inhibitors (including but not limited to fimepinostat), PI3K / mTOR dual inhibitors (including but not limited to sapanisertib);

[0029] The present invention also provides a drug screening method. The drug screening method utilizes the above-mentioned immortalized cell line, immortalized cell line construction method, reagent, kit, product, and / or drug treatment efficacy evaluation vector. The drug screening method screens drugs by acting on drug targets in the immortalized cell line to inhibit the proliferation of the immortalized cell line. Preferably, the drug targets include but are not limited to VEGFR, HADC, EGFR, FGFR, PI3K and / or topoisomerase.

[0030] The present invention also provides a sequence, wherein the sequence is one or more of SEQ ID NO.1-4:

[0031] SEQ ID NO.1: CCAACCTATGGAACTGATGA;

[0032] SEQ ID NO.2: ATGTTGAGAGTCAGCAGTAG;

[0033] SEQ ID NO.3: GGACGAGATCCCTCCAAAAT;

[0034] SEQ ID NO. 4: GGCTGTTGTCATACTTCTCATGG.

[0035] The beneficial effects of the present invention include that the present invention provides an innovative method for studying disease mechanisms for the first time: it provides the first very effective tool for PROS disease research, which can be used as an in vitro experimental model to simulate the human disease process and explore its deep pathogenesis and treatment methods. Secondly, in terms of drug screening and development, an immortalized cell line is provided as a test vector. The establishment of this cell line can provide an effective efficacy evaluation vector for PROS drug treatment, and can be used to study pharmacological principles and drug resistance mechanisms. Furthermore, a method for constructing an immortalized cell line and its promotion and application are provided. This cell line is the first established PROS disease cell line. The cells used and the corresponding diseases have not been seen yet. The immortalized cell line constructed in the present invention is verified for its properties, and relevant culture data and drug screening data are obtained. In view of the fact that PROS diseases are numerous and involve various complex tissues, this construction method can be extended to other PROS diseases and tissues. And the immortalized cell line can be stored in a biological storage bank, which is extremely important for the protection of biological resource diversity. The present invention is the first to establish immortalized cells of adipose-derived mesenchymal stem cells for PROS disease (infiltrating lipoma of the face), study their properties in vivo and in vitro, and conduct preliminary analysis of their gene expression and drug targets, providing an effective research tool for subsequent research and having broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without paying any creative work.

[0037] Figure 1 Indicates that the immortalized cell line was constructed by using SV40LT transfection from a patient with facial infiltrating lipoma. A: Patient with facial infiltrating lipoma; B: PIK3CA mutation was detected in the tissue; C: Primary ADSCs were extracted; D, E: SV40LT virus was transferred into primary ADSCs, and the expression level of the transferred virus was verified by RT-qPCR; F: Cells were continuously cultured to 5, 15, 30, and 50 generations.

[0038] Figure 2Figures showing the analysis of immortalized cell line surface markers by flow cytometry. A: Flow cytometry detection of immortalized facial infiltrating lipoma ADSCs surface markers CD90, CD105, CD73, HLA-DR, CD45 expression; B: primary facial infiltrating lipoma ADSCs surface markers CD90, CD105, CD73, HLA-DR, CD45 expression; C: normal primary ADSCs surface markers CD90, CD105, CD73, HLA-DR, CD45 expression.

[0039] Figure 3 Represents the karyotype analysis, gene mutation and signaling pathway validation of the immortalized cell line of facial infiltrating lipoma (Im-PROS-ADSCs). Among them, A: Gene mutations in Im-PROS-ADSCs were detected by Sanger sequencing. PIK3CA c.1252G>A(E418K) mutation was found in Im-PROS-ADSCs, which is the same as PROS-ADSCs. B: The expression of PI3K / AKT signaling pathway proteins in Pri-ADSCs, PROS-ADSCs and Im-PROS-ADSCs was detected by Western blotting. GAPDH was used as a loading control. C, D: Karyotype analysis results of PROS-ADSCs and Im-PROS-ADSCs.

[0040] Figure 4 The results of β-galactosidase staining and quantitative analysis of the number of senescent cells of PROS-ADSCs (A) and Im PROS-ADSCs (B) are shown. The bar graphs represent mean ± standard deviation (n = 5), and the scale bar is 100 μm.

[0041] Figure 5 Represents the proliferation ability and cell cycle analysis of Im-PROS-ADSCs. Among them, AC: normal primary ADSCs, primary facial infiltrating lipoma ADSCs (PROS-ADSCs) and immortalized-facial infiltrating lipoma ADSCs (Im-PROS-ADSCs) cell cycle results; D: normal primary ADSCs, primary facial infiltrating lipoma ADSCs (PROS-ADSCs) and immortalized-facial infiltrating lipoma ADSCs (Im-PROS-ADSCs) proliferation curves.

[0042] Figure 6Represents the osteogenic and adipogenic differentiation validation experiment of Im-PROS-ADSCs. A: Alizarin red staining of normal primary ADSCs, primary facial infiltrating lipoma ADSCs (PROS-ADSCs) and immortalized-facial infiltrating lipoma ADSCs (Im-PROS-ADSCs); B: Oil red staining of normal primary ADSCs, primary facial infiltrating lipoma ADSCs (PROS-ADSCs) and immortalized-facial infiltrating lipoma ADSCs (Im-PROS-ADSCs).

[0043] Figure 7 Represents the RNA transcriptome sequencing results of normal ADSCs, primary facial infiltrating lipoma ADSCs and immortalized-facial infiltrating lipoma ADSCs. A: Transcriptome sequencing heat map of primary facial infiltrating lipoma ADSCs (PROS-ADSCs) and immortalized-facial infiltrating lipoma ADSCs (Im-PROS-ADSCs) (3 PROS-ADSCs patients VS 3 Im-PROS-ADSCs: P5, P15, P50); B: Up-regulated and down-regulated genes in RNA-seq sequencing results; C: Transcription factors with significant differences; D: KEGG analysis results of RNA-Seq.

[0044] Figure 8 Represents the in vivo tumorigenicity experiment and p-AKT expression analysis of immortalized-facial infiltrating lipoma ADSCs. Among them, A: animal experiment model diagram; B: MRI detection of facial transplanted tumor growth, immortalized-facial infiltrating lipoma ADSCs on the left, and facial infiltrating lipoma ADSCs on the right; C: immortalized-facial infiltrating lipoma and facial infiltrating lipoma transplanted tumor photos (6 in each group); D: immortalized-facial infiltrating lipoma and facial infiltrating lipoma transplanted tumor weight; E: immortalized-facial infiltrating lipoma and facial infiltrating lipoma transplanted tumor volume; F: immortalized-facial infiltrating lipoma and facial infiltrating lipoma transplanted tumor H&E staining, immortalized-facial infiltrating lipoma expressed increased fat, and oil red staining also showed a larger area of ​​staining positive rate. Immunohistochemical p-AKT showed that immortalized-facial infiltrating lipoma had a higher positive rate.

[0045] Fig. 9Represents Im-PROS-ADSCs high-throughput drug screening and potential therapeutic target analysis, including: A: Schematic diagram of high-throughput drug screening of immortalized-facial infiltrating lipoma (Im-PROS-ADSCs); B: Violin plot of the inhibition rate of Im PROS-ADSCs by pathway inhibitors. C: Analysis of targets of effective drugs (inhibition rate greater than 50%); D: Analysis of pathways of effective drugs (inhibition rate greater than 50%); E: Light microscopy of cells after the action of effective single-target (STAT3, HSP, EGFR, NF-kb, PI3K) inhibitors and effective dual-target drugs (PI3K / HDAC, PI3K / mTOR) inhibitors. DETAILED DESCRIPTION

[0046] The present invention is further described in detail with reference to the following specific examples and drawings. The process, conditions, experimental methods, etc. for implementing the present invention, except for the contents specifically mentioned below, are all common knowledge and common common sense in the art and are not particularly limited by the present invention.

[0047] The immortalized-facial infiltrating lipoma ADSCs / facial infiltrating lipoma immortalized cell line (Im-PROS-ADSCs) mentioned in the present invention are all the preserved PIK3CA-related overgrowth disease spectrum (PROS) human adipose mesenchymal stem cell immortalized cell lines Im-PROS-ADSCs Homo sapiens.

[0048] The specific steps of constructing the immortalized cell system of the present invention include the following:

[0049] Preliminary preparation: extract primary ADSCs by extracting adipose tissue from patients with facial invasive lipoma and verifying its PIK3CA mutation through second-generation detection. Figure 1 .

[0050] (Next-generation sequencing: 1. Tissue DNA samples were extracted using the Qiagen DNA extraction kit (Qiagen, No. 13323). For the genomic DNA fragments required for sequencing, splicing modification is required, which is completed by the NEBNext Ultra II DNA library preparation kit for the Illumina platform. 2. After the library was established, high-throughput sequencing was performed using the IlluminaNova Seq 6000 platform. The customized NGS panel had an average sequencing depth of 10,000 times and a coverage rate of more than 98%. The disease-related mutant genes included included ACVRL1, GLMN, PIK3CA, AKT1, mTOR, PTEN, MAP2K1, TEK, MAP3K3, GNA11, GNA14, GNAQ, RASA1, EPHB4, SMAD4, STAMBP, KDR, FLT4, KRAS, and BRAF. 3. The DNA sequence of the test sample was aligned with the reference sequence hg19 (GRCh37) and analyzed to determine the corresponding mutation.)

[0051] ①SV40LT antigen lentiviral packaging:

[0052] On the first day, 2 million 293FT cells were inoculated in a 10 cm dish. When the cell density reached 85%, the SV40-T lentiviral vector and the packaging vector (PsPax2 and Vsvg) were transferred into the 293FT cells using the transfection reagent Lipo3000 (Invitrogen, L3000001). The medium was changed after 6 hours, and the viral supernatant was collected after 48 hours to detect the viral titer and stored at 4 degrees for later use.

[0053] ②Viral infection:

[0054] After the cells were subcultured in a 6-well plate for 12-16 hours, the collected virus supernatant SV40LT was mixed with fresh cell culture medium, with the ratio of 0.9 ml fresh culture medium and 1.0 μl polybrene (Biyuntian, ST1380) (final concentration 8 μg / ml) added to 0.1 ml virus supernatant. The premixed virus infection solution was added to the target cell culture dish, and the cell density should not exceed 60% at this time. After overnight culture, it was replaced with fresh culture medium (Saiye, HUXMD-90011). After 48 hours, green fluorescent cells were sorted out by flow cytometry, subcultured and frozen.

[0055] ③Cell culture

[0056] On the first day, continue to passage the primary cells that need to be immortalized into T25 flasks, and the growth density is about 30%-50%;

[0057] On the second or third day, when the cell density reached 80%, cells were sorted into a 96-well plate using a flow cytometer, and 200 μl of primary cell culture medium was added to each well;

[0058] After about a week of culture, the medium was changed every 2 days to observe whether single cells in the diluted wells formed clones. After about 10 days, a single clone cell group (5-10) was picked and expanded and passaged.

[0059] ④Result verification: Morphological observation of cells, immunofluorescence verification and RT-qPCR verification of gene expression and mutation sites.

[0060] (RT-qPCR: Total RNA was extracted from Im-PROS-ADSCs using Trizol reagent (Takara, No. 9108). TM cDNA synthesis was performed according to the instructions of RT MasterMix (Takara, label number RR036A). RT-qPCR experiments were performed using TB Green Premix Ex Taq (Takara, Japan, RR820A). Relative gene expression was evaluated using the 2-ΔΔct method.

[0061] Table 1 Primers for SV40LT and GAPDH

[0062]

[0063] Example 1 Construction of Immortalized Facial Infiltrating Lipoma ADSCs (Im-PROS-ADSCs)

[0064] Extract surgically removed adipose tissue from patients with invasive lipoma, verify its PIK3CA mutation by second generation test, and extract primary ADSCs. And transfer SV40LT virus in vitro, verify its expression level by RT-qPCR, and culture cells continuously to 50 generations. This Example 1 constructs immortalized-facial invasive lipoma ADSCs (Im-PROS-ADSCs), and the preservation information of the immortalized cell line is as follows: Classification and naming PIK3CA-related overgrowth disease spectrum (PROS) human adipose mesenchymal stem cell immortalized cell line Im-PROS-ADSCs Homo sapiens, the preservation unit is China Type Culture Collection Center CCTCC, the preservation address is Wuhan University, Wuhan, China, the preservation number is CCTCC NO: C2023155, and the preservation date is August 16, 2023.

[0065] Example 2

[0066] The present invention further verifies whether the immortalized-facial infiltrating lipoma ADSCs (Im-PROS-ADSCs) cells constructed in Example 1 of the present invention express the classic markers of adipose mesenchymal stem cells. Similarly, normal primary ADSCs and primary infiltrating lipoma ADSCs (PROS-ADSCs) were used as controls, and flow cytometry was used to examine the expression of CD90 (BD, USA, 561971), CD105 (BD, USA, 566265), CD73 (BD, USA, 550257), HLA-DR (BD, USA, 562007), and CD45 (BD, USA, 560976).

[0067] The experimental results show that the immortalized cell line constructed in Example 1 of the present invention also expresses markers of adipose mesenchymal stem cells. (CD90, CD105, CD73 positive, HLA-DR, CD45 negative) Figure 2 ).

[0068] Example 3

[0069] The present invention uses first-generation sequencing and also finds that PIK3CA (E418K) mutations also exist in immortalized cells, which further proves the clinical characteristics of the cell line constructed in Example 1 of the present invention. In addition, since immortalized cells transform primary cells that were originally in mosaic mutations into cell lines with PIK3CA mutations, the mutation frequency increases. Western Blot results show that it has a stronger degree of PI3K / AKT pathway activation. Karyotype analysis showed that no chromosome mutations were detected ( Figure 3 ). (Western Blot antibody information: p-AKT (Cell Signaling Technology, #13038), AKT (Cell Signaling Technology, #4685), mTOR (Cell Signaling Technology, #2983), p-mTOR (Cell Signaling Technology, #5536), and GAPDH (Cell Signaling Technology, #5174).

[0070] (Karyotype analysis method: When the cells reached the logarithmic growth phase (80% density), colcemid (Invitrogen & Clontech) was added to the cell culture dish at a final concentration of 0.1 μg / mL. The cells were cultured in a 5% CO2 incubator at 37°C for 1.5 hours. The cells were then trypsinized and collected. The cells were exposed to a hypotonic buffer containing 0.075 mol / L potassium chloride (KCl). After the cells were fixed, sections were prepared and chromosome analysis was performed using the trypsin and turmeric staining (GTG) method. Metaphase cells with obvious bands were selected and chromosome karyotype analysis was performed using the Zeiss automated chromosome analysis system.)

[0071] Example 4

[0072] In this example, the aging degree of primary PROS-ADSCs and immortalized PROS-ADSCs was compared by monitoring the expression of β-galactosidase (aging marker). Figure 4 , primary PROS-ADSCs showed significantly high β-galactosidase positive expression. In sharp contrast, very few Im PROS-ADSCs had positive staining, and the percentages of senescent cells in the two were 54.64% ± 6.76% and 6.18% ± 3.08%, respectively (p < 0.01). Therefore, immortalized cells are less likely to show senescence characteristics than primary cells.

[0073] (β-Galactosidase staining: PROS-ADSCs and Im PROS-ADSCs were cultured in 12-well plates using the β-Galactosidase staining kit from Beyotime Biotechnology. First, the cells were washed with PBS and then fixed with 4% formaldehyde for 15 min. After three washes with PBS, they were incubated at 37 °C for 16 h with β-Gal solution. To assess the extent of staining, five random fields were randomly photographed in each well. These data were then used to determine the percentage of cells showing positive β-Gal staining.)

[0074] Example 5

[0075] Normal primary ADSCs and facial infiltrating lipoma ADSCs (PROS-ADSCs) were used as controls to compare the proliferation ability of immortalized facial infiltrating lipoma ADSCs (Im-PROS-ADSCs) constructed in Example 1 of the present invention with that of primary ADSCs. The results showed that the immortalized ADSCs constructed in Example 1 of the present invention had a higher proliferation ability than the primary cells (but no tumor-like hyperplasia occurred). Flow cytometry showed that the percentage of Im PROS-ADSCs in the S phase was 10.12%, which was significantly higher than that of primary PROS-ADSCs (4.66%) and normal ADSCs (5.00%), while the percentage of G1 phase (57.42%) was lower than that of primary PROS-ADSCs (71.22%) and normal ADSCs (74.45%) ( Figure 5 The improvement in the proliferation ability of immortalized cell lines further suggests the effect of PIK3CA gene mutation on cell proliferation ability.

[0076] (Proliferation sequencing: Im-PROS-ADSCs, PROS-ADSCs and Pri-ADSCs were cultured at 5×10 3 The concentration of cells was 100 μL and added to 200 μL of culture medium. After 7 days of cell incubation, the cells were detected using Cell Counting Kit-8 (Dojindo Molecular Technologies, Japan). The absorbance of each well was measured at 450 nm on days 1, 3, 5, and 7.

[0077] Example 6

[0078] The present invention compares the differentiation ability of normal primary ADSCs, facial infiltrating lipoma ADSCs (PROS-ADSCs) and immortalized facial infiltrating lipoma ADSCs (Im-PROS-ADSCs) constructed in Example 1 of the present invention to determine whether they still have multidirectional differentiation ability and verify the change in their ability. Through experiments, it was found that the immortalized cell line constructed in Example 1 of the present invention has stronger adipogenic differentiation ability than normal primary ADSCs and primary facial infiltrating lipoma ADSCs (PROS-ADSCs), but the osteogenic ability is more significantly downregulated than PROS-ADSCs, but still higher than normal ADSCs ( Figure 6 ).

[0079] (Adipogenic differentiation: When the cell density reached 90-100%, adipogenic induction solution A (Synergy, USA) was added, and after 3 days, it was changed to adipogenic induction solution B for induction for 1 day. This was considered one cycle, and a total of 3 cycles were performed. After the adipogenic induction was completed, Oil Red O (Synergy, USA) staining was used for evaluation.)

[0080] (Osteogenic differentiation: Im-PROS-ADSCs, PROS-ADSCs, and Pri-ADSCs were induced in basal growth medium supplemented with 100 nM dexamethasone (Synergy, USA) and 50 μM ascorbic acid (Synergy, USA). Osteogenic differentiation was assessed using 2% Alizarin Red (Synergy, USA).

[0081] Example 7

[0082] In order to further clarify the gap between immortalized cell lines and primary cells at the gene level, the present invention performed RNA-seq of primary invasive lipoma ADSCs (3 patients) and immortalized-facial invasive lipoma ADSCs (5th, 25th, and 50th generations). The results showed that 48 genes of immortalized cells were highly expressed and 334 genes were downregulated. Further analysis showed that E2F family (E2F1, E2F7, E2F8), ETV4 and MYBL2 were more expressed in immortalized-facial invasive lipoma ADSCs. In addition, the genes encoding transcription factor E2F1 (ASF1B, CCNE1, CDC6, MCM5, RAD51 and TERT) were most enriched, indicating that transcription factor E2F1 played a key role in the immortalization of Im PROS-ADSCs. KEGG analysis also showed that there were obvious differences in the PI3K-AKT pathway, P53 pathway, DNA replication, and cell cycle of immortalized cells. At the same time, cell senescence, nucleotide metabolism, and pyrimidine metabolism also played an important role in immortalized cells. These data provide more detailed transcriptome data for further research on the pathogenesis of PROS diseases ( Figure 7 ). (RNA sequencing method: Total RNA was isolated using RNeasy mini kit (Qiagen, Germany). Paired-end libraries were constructed according to the instructions of Stranded mRNA-seq Lib Prep Kit for Illumina (ABclonal, China). Differential expression of mRNA was evaluated using the R package edgeR. Absolute log2 fold change > 1 and q value < 0.05 were set as the criteria for significantly regulated genes for further analysis. Gene Ontology (GO) evaluation and KEGG pathway analysis (Kyoto Encyclopedia of Genes and Genome) were performed using the enrich R package (version 3.4.3).

[0083] Example 8

[0084] In order to further study the in vivo effects of the immortalized cell line, the present invention subcutaneously injected primary facial infiltrating lipoma ADSCs and immortalized-facial infiltrating lipoma ADSCs constructed in Example 1 of the present invention into the cheeks of nude mice twice (the facial infiltrating lipoma lesions involved the face, and the injection location restored the clinical characteristics of the disease). MRI found that the volume and mass of the cheek mass injected with the immortalized cell line constructed in Example 1 of the present invention were higher than those of the primary cells, and the volume was about 1.7 times that of the primary cells, which further verified that its proliferation ability increased, but at the same time did not show tumor-like changes. In addition, through H&E and Oil Red staining of the specimens, it was found that the immortalized specimens constructed in Example 1 of the present invention still showed strong p-AKT content and Oil Red expression, which was consistent with the in vitro experimental results (Examples 3, 5) ( Figure 8 ).

[0085] (In vivo xenograft experiment method: PROS-ADSC (P2) and Im-PROS-ADSC (P50) were suspended in 50 μl of 1:1 PBS and Matrigel TM (BD Bioscience) and then subcutaneously injected into the right and left cheeks of 6-week-old female nude mice (n = 5 per group). Four weeks later, the volume of the xenografts was measured using a vernier caliper and the formula (length × width 2 ) / 2 were used for calculation. These grafts were collected for Oil Red O, H&E and immunohistochemistry (p-AKT (T308) (Abcam, Cat# ab38449)) staining.

[0086] Example 9

[0087] The present invention provides more options for the treatment of PROS diseases by establishing an immortalized cell line. The immortalized cell line constructed in Example 1 of the present invention was subjected to high-throughput drug screening (633 clinical drugs), and was defined as an effective drug with an inhibition rate greater than 50%. The results showed that in addition to the obvious inhibitory effect of the PI3K pathway, anti-angiogenesis, JAK / STAT, NF-kB, cytoskeleton, and metabolic inhibitors also showed excellent inhibitory effects. In addition, the present invention further analyzes the targets of the drugs. In addition to the efficient inhibitory ability shown by the PI3K pathway inhibitors, angiogenesis, JAK / STAT, NF-kB, cytoskeleton, and metabolic inhibitors also show excellent inhibitory efficiency. In addition, by further analyzing the drug targets, the inventors first innovatively discovered that VEGFR, HADC, EGFR, FGFR, PI3K, and topoisomerase are all effective targets. Based on the above analysis results, the above-mentioned pathway / target inhibitors were selected from the drug library for secondary drug screening. The results showed that STAT3 inhibitors (Napabucasin), HSP inhibitors (Ganetespib), EGFR inhibitors (Almonertinib), NF-kB inhibitors (Andrographolide) and PI3K inhibitors (Alpelisib) were all sensitive to Im PROSL-ADSCs. The corresponding half-maximal inhibitory concentrations (IC50) were 3.58, 3.65, 3.99, 2.35 and 3.35 (μM), respectively. Compared with single target inhibitors, when Im PROS-ADSCs were treated with dual inhibitors, especially the PI3K / HDAC inhibitor fimepinostat (IC50: 0.04μM), the cells showed nuclear coagulation and apoptosis. It is worth noting that the inhibitory effect of the PI3K / mTOR dual inhibitor (sapanisertib) was stronger than that of the PI3K inhibitor (IC50 increased from 3.35μM to 0.11μM). These provide basic data for further drug development and multi-target validation of PROS ( Fig. 9 ).

[0088] (Specific experimental steps for drug screening: ImPROS-ADSCs were collected using 0.25% Trypsin (Thermo Fisher Scientific) and then suspended in human adipose-derived stem cell growth medium (Saiye, HUXMD-90011) containing 10% FBS at a concentration of 15,000 cells per ml. Subsequently, 50 μl of cells were inoculated into a white 384-well tissue culture-treated CulturPlateTM 384 plate (PerkinElmer, 6007688) using a standard box of a microplate dispenser (Thermo Scientific, MultiDrop Combi, Type 836), with 800 cells per well. The Ruijin anticancer drug library consists of 633 compounds, which were selected from anticancer drugs provided by TargetMol. These compounds / DMSO were added to the plate using a 50 nanoliter 384 needle of a liquid transfer workstation (PerkinElmer, Janus, MDT). The final concentration of the compound in each well was 10 μM. CellTiter-Glo Luminescent assay (Promega, G7573) was performed on a microplate reader (PerkinElmer, Envision HTS) to evaluate cell viability after 72 hours of incubation (37°C, 5% CO2). When the viability of Im-PROS-ADSCs decreased by more than 50%, they were defined as Im-PROS-ADSCs sensitive to the compound.

[0089] After the preliminary single-dose drug screening, multiple-dose screening was performed on specific compounds that were sensitive in the first screening. The final concentrations of each compound in the wells were 10 μM, 3.333 μM, 1.111 μM, 0.370 μM, 0.123 μM, 0.411 μM, 0.014 μM and 0 μM (DMSO). The culture medium was used as a blank control. Cell viability was assessed after 72 hours of incubation (37°C, 5% CO2) on a microplate reader (PerkinElmer, Envision HTS) using CellTiter-Glo Luminescent assay (Promega, G7573). 50 μL of cells were inoculated into 384-well black PhenoplateTM 384 plates (PerkinElmer, 6057300) with optically transparent flat bottoms, 800 cells per well. After incubation for 72 hours, the cell culture medium was removed with a microplate washer (Molecular Devices, AQ4K, 384 needles). 20 μL staining fixative (KeyGen BioTech, KGIHC007) was added to the wells using a small box of a microplate dispenser (Thermo Scientific, MultiDrop Combi, Type 836). After 10 minutes, the fixative was removed. Then 30 μL PBS solution (B320KJ) was added to the wells. After 5 minutes, PBS was removed and 20 μL Hoechst 33342 solution (diluted to 0.5 μg / mL with PBS, Yeasen, 40732ES03) was added to the wells. After 10 minutes, the staining solution was removed and washed three times with 30 μL PBS. Confocal images (0 μm) were acquired using OperaPhenixTM (PerkinElmer, HH14000000). The data were processed and analyzed in software Harmony 4.9. The IC50 values ​​of the compounds were calculated using GraphPad 9.0 software)

[0090] In summary, the present invention has established immortalized cells of adipose-derived mesenchymal stem cells for PROS disease for the first time, studied their properties in vivo and in vitro, and conducted a preliminary analysis of their gene expression and drug targets, providing an effective research tool for subsequent research.

[0091] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

Claims

1. A method for screening drugs for facial infiltrating lipoma, characterized in that: The drug screening method utilizes an immortalized cell line, a reagent, a kit, a product containing the immortalized cell line, and / or a drug treatment efficacy evaluation vector containing the immortalized cell line; Among them, the immortalized cell line is an immortalized cell line of facial infiltrating lipoma adipose mesenchymal stem cells; its preservation information is as follows: classified and named PIK3CA-associated overgrowth disease spectrum (PROS) human adipose mesenchymal stem cell immortalized cell line Im-PROS-ADSCs Homo sapiens, the preservation unit is China Center for Type Culture Collection CCTCC, the preservation number is CCTCC NO: C2023155, and the preservation date is August 16, 2023.

2. The method according to claim 1, characterized in that The drug screening method acts on the drug target in the immortalized cell line to inhibit the proliferation of the immortalized cell line and screen the drug.

3. The method according to claim 2, characterized in that The drug targets include VEGFR, HADC, EGFR, FGFR, PI3K and / or topoisomerase.

4. The method according to claim 1, characterized in that The kit also contains cell culture fluid, cell washing fluid and cell digestion fluid.

5. The method according to claim 4, characterized in that The cell culture fluid comprises a cell culture medium containing cytokines and fetal bovine serum.

6. The method according to claim 4, characterized in that The cell washing solution includes physiological saline.

7. The method according to claim 4, characterized in that The cell digestion solution includes a collagenase II aqueous solution.

8. The method according to claim 1, characterized in that The kit also contains PBS buffer.

9. A method for evaluating the therapeutic efficacy of drugs for facial infiltrating lipoma, characterized in that: The method uses a drug treatment efficacy evaluation vector containing an immortalized cell line for evaluation, wherein the immortalized cell line is an immortalized cell line of adipose-derived mesenchymal stem cells of facial infiltrating lipoma; its preservation information is as follows: classified and named as PIK3CA-associated overgrowth disease spectrum (PROS) human adipose-derived mesenchymal stem cell immortalized cell line Im-PROS-ADSCs Homo sapiens, the preservation unit is the China Center for Type Culture Collection CCTCC, the preservation number is CCTCC NO: C2023155, and the preservation date is August 16, 2023.

Images