Fusion gene enrichment and detection primer and enrichment and detection method

Abstract

The invention relates to the technical field of in-vitro diagnosis, in particular to fusion gene enrichment and detection primers and an enrichment and detection method. The fusion gene enrichment and detection method, the enrichment random primer group and the fusion gene specific primer group which are correspondingly used can be used for NGS library establishment under the condition of ultramicro initial template quantity; the method has the following advantages: 1, the matching of the specific primer with the modified group and the random primer can be used for detecting known and unknown fusion gene mutation, and the requirement on the fragment size of an initial sample is not high; 2, the carried modification groups are used for enriching specific primer products, and sequencing noise interference is reduced; 3, a specific Blocker is used for blocking wild-type amplification at the breakpoint of the fusion gene, a mutant fragment of the fusion gene is enriched, and the sensitivity and the specificity are improved; and 4, no ligase is contained in the library building process, so that the influence of the connection efficiency on the library building efficiency is avoided.

Description

Technical Field

[0001] The present disclosure relates to the field of in vitro diagnostic technology, and in particular to fusion gene enrichment, detection primers and enrichment and detection methods. Background Art

[0002] There are many methods for detecting fusion genes. Currently, the gold standard for clinical detection of fusion genes is still FISH (Fluorescence in situ hybridization) and IHC (Immunohistochemistry); the method of detecting fusion genes based on NGS (Next Generation Sequencing) is also constantly being improved and gradually used in the clinical detection of fusion genes. The methods for detecting fusion genes based on NGS are mainly divided into two categories: hybridization capture method and amplicon sequencing method. Both methods can detect fusion genes at the DNA and RNA levels.

[0003] Amplicon sequencing can be further divided into two categories: traditional multiplex PCR amplification (mPCR) and anchored multiplex PCR amplification (AMP); both hybrid capture and anchored multiplex PCR amplification (AMP) can detect unknown fusion partner genes. Traditional multiplex PCR amplification (mPCR) uses upstream and downstream deterministic primers to build a library, which will miss some samples in fragmented samples that do not contain upstream and downstream primers; anchored multiplex PCR amplification (AMP) uses ligase to connect universal adapter primers to the template. Regardless of whether T-terminal sticky connection or blunt end connection is used, the connection efficiency has a huge impact on the quality of library construction; and the amount of starting template used in the hybrid capture method to build a library is huge, which is not suitable for tissue fine needle puncture samples and blood CTC samples.

[0004] Therefore, it is necessary to develop an NGS detection kit suitable for ultra-small starting template amounts such as tissue fine needle puncture samples and blood CTC samples. Summary of the invention

[0005] The purpose of the present disclosure is to provide a method for enriching and / or detecting unknown fusion mutations from a sample to be tested. The method requires a low starting amount of sample, does not require the use of a ligase, avoids the influence of ligation efficiency on the enrichment and detection effect, and can effectively improve the signal-to-noise ratio. The detection sensitivity and specificity of unknown fusion mutations are higher.

[0006] In order to achieve the above objectives, the present disclosure provides the following technical solutions:

[0007] In a first aspect, the present disclosure provides a method for enriching a fusion gene or a splicing isoform, comprising amplifying the fusion gene using random primers and specific primers targeting a first fusion gene, wherein the specific primers carry a modification group for purification, and after completion of the amplification, recovering the amplified product carrying the modification group.

[0008] The modification group is used to separate and purify the fusion gene from the amplified product, including but not limited to biotin. The distance between the target fragment of the specific primer in the first fusion gene and the fusion breakpoint is 1 to 100 nt, preferably 4 to 79 nt, more preferably 10 to 79 nt, and more preferably 10 to 78 nt. This distance can ensure sufficient sensitivity and ensure that the amplified product is mainly composed of the fusion gene containing the breakpoint.

[0009] In an optional embodiment, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1. The breakpoint of the first fusion gene is associated with the induction of common or major diseases, or has other important potential values.

[0010] In an optional embodiment, a blocker probe for blocking the amplification of the wild-type first fusion gene is further added to the amplification reaction system to further increase the content of the fusion gene containing the breakpoint in the amplification product.

[0011] In an optional embodiment, the recovery method includes adding a purification reagent for capturing the modification group to the amplification product; optionally, the purification reagent includes magnetic beads, and the magnetic beads are connected to modification group binding molecules.

[0012] In a second aspect, the present disclosure provides an enrichment primer for a fusion gene or splice isoform, comprising a random primer and a specific primer targeting a first fusion gene, wherein the specific primer carries a modification group for purification, and the purification modification is used to separate an enrichment product formed by a random primer and a specific primer as a primer pair, and the enrichment primer is used to implement the enrichment method described in the first aspect.

[0013] In an optional embodiment, the target fragment of the specific primer in the first fusion gene is 1 to 100 nt away from the fusion breakpoint, preferably 4 to 79 nt, further preferably 10 to 79 nt, and more preferably 10 to 78 nt; the random primer is 6 to 30 nt in length, preferably 8 to 25 nt, and more preferably 16 to 20 nt.

[0014] Preferably, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1.

[0015] In an alternative embodiment, the modifying group comprises biotin.

[0016] Furthermore, the enrichment primers also include a blocker probe for blocking the amplification of the wild-type first fusion gene.

[0017] In a third aspect, the present disclosure provides an enrichment composition for a fusion gene or a splicing isoform, comprising the enrichment primers described in the second aspect and a purification reagent for capturing a modification group; optionally, the purification reagent comprises magnetic beads connected to modification group binding molecules.

[0018] In a fourth aspect, the present disclosure provides use of the enrichment primer described in the second aspect or the enrichment composition described in the third aspect in the preparation of a reagent or kit for gene fusion enrichment.

[0019] In a fifth aspect, the present disclosure provides an enrichment reagent or kit for a fusion gene or splicing isoform, comprising the enrichment primers described in the second aspect or the enrichment composition described in the third aspect; preferably, it also includes a sampling tool and / or other consumables.

[0020] In a sixth aspect, the present disclosure provides a method for detecting a fusion gene or a splice isoform, comprising adding a detection primer pair to a sample containing a fusion gene to amplify the fusion gene, separating the fusion gene enriched product from the amplified product using a purification reagent after amplification, and then sequencing the fusion gene enriched product using a sequencing primer pair;

[0021] The detection primer pair includes a random primer and a specific primer targeting the first fusion gene, the random primer is connected to the first universal primer, the specific primer is connected to the second universal primer with a modification group for purification, and the purification modification is used to separate the enriched product of the random primer and the specific primer as the primer pair;

[0022] The sequencing primer pair includes a first sequencing primer and a second sequencing primer, wherein the first sequencing primer contains a sequence hybridizing with a first universal primer and a first sequencing primer adapter sequence, and the second sequencing primer contains a sequence hybridizing with a second universal primer and a second sequencing primer adapter sequence.

[0023] In an alternative embodiment, the modifying group comprises biotin.

[0024] In an optional embodiment, a blocker probe for blocking the amplification of the wild-type first fusion gene is also added to the fusion gene amplification reaction system.

[0025] In an optional embodiment, the purification reagent includes magnetic beads, and the magnetic beads are linked to modifying group binding molecules.

[0026] In an optional embodiment, the target fragment of the specific primer in the first fusion gene is 1 to 100 nt away from the fusion breakpoint, preferably 4 to 79 nt, further preferably 10 to 79 nt, and more preferably 10 to 78 nt; the random primer is 6 to 30 nt in length, preferably 8 to 25 nt, and more preferably 16 to 20 nt.

[0027] Preferably, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1.

[0028] In the seventh aspect, the present disclosure provides a detection primer for a fusion gene or splicing isoform, comprising a random primer and a specific primer targeting a first fusion gene, wherein the random primer is connected to a first universal primer, and the specific primer is connected to a second universal primer with a modification group for purification, and the purification modification is used to separate the enriched product of the random primer and the specific primer as a primer pair.

[0029] In an alternative embodiment, the modifying group comprises biotin.

[0030] In an optional embodiment, the detection primer further comprises a blocker probe for blocking amplification of the wild-type first fusion gene.

[0031] In an optional embodiment, the target fragment of the specific primer in the first fusion gene is 1 to 100 nt away from the fusion breakpoint, preferably 4 to 79 nt, further preferably 10 to 79 nt, and more preferably 10 to 78 nt.

[0032] Preferably, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1.

[0033] In an eighth aspect, the present disclosure provides a detection composition for a fusion gene or a splice isoform, comprising the detection primer described in the seventh aspect, a purification reagent for capturing a modification group, and a sequencing primer pair suitable for a sequencing platform;

[0034] The sequencing primer pair includes a first sequencing primer and a second sequencing primer, wherein the first sequencing primer contains a sequence hybridizing with a first universal primer and a first sequencing primer adapter sequence, and the second sequencing primer contains a sequence hybridizing with a second universal primer and a second sequencing primer adapter sequence.

[0035] Optionally, the purification reagent comprises magnetic beads, to which modified group binding molecules are attached.

[0036] In a ninth aspect, the present disclosure provides use of the detection primer described in the seventh aspect or the detection composition described in the eighth aspect in preparing a reagent or kit for detecting gene fusion or splicing isoforms.

[0037] In the tenth aspect, the present disclosure provides a fusion gene detection or splicing isoform detection reagent or kit, including the detection primer described in the seventh aspect or the detection composition described in the eighth aspect; preferably, it also includes a sampling tool and / or other consumables.

[0038] In the eleventh aspect, the present disclosure provides a method for diagnosing diseases related to gene fusion mutation or abnormal splicing of precursor mRNA, comprising collecting a sample to be tested, sequencing and detecting the breakpoints related to the gene fusion mutation according to the detection method described in the sixth aspect, and estimating the risk of gene fusion mutation in the sample to be tested.

[0039] The beneficial effects achieved by the present disclosure include: the fusion gene or splicing isoform enrichment and detection method provided by the present disclosure, and the corresponding enrichment primer set can be used for NGS library construction under the condition of ultra-low starting template amount, and its advantages are as follows: 1. Specific primers with modified groups are used to reduce sequencing noise interference, enrich mutant templates, and improve sensitivity and specificity; 2. No ligase is used in the library construction process, and Taq enzyme is used for PCR to connect the sequencing primers to the template, thereby improving the library construction efficiency; 3. The combination of specific primers and random primers can be used to detect known and unknown mutations, and the fragment size requirements of the initial sample are not high. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] In order to more clearly illustrate the specific embodiments of the present disclosure or the technical solutions in the prior art, the drawings required for use in the specific embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present disclosure. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0041] Figure 1 are the possible mRNA forms in different samples;

[0042] Figure 2 The reaction that may occur during the first PCR amplification process of the enrichment or detection method provided by the present disclosure;

[0043] Figure 3 The type of amplification product obtained by the first PCR of the enrichment or detection method provided by the present disclosure;

[0044] Figure 4 The reaction process of the first PCR of the enrichment or detection method provided by the present disclosure;

[0045] Figure 5 The overall technical route of the detection method provided by the present disclosure;

[0046] Figure 6 is the number of reads of the fusion gene detected under different random primer lengths in Example 4 of the present disclosure;

[0047] Figure 7 is the test result of clinical FFPE samples in Example 5 of the present disclosure;

[0048] Figure 8 This is the test result of the H2228 sample in the clinical validation in Example 5 of the present disclosure. DETAILED DESCRIPTION

[0049] In order to make the purpose, technical solutions and advantages of the embodiments of the present disclosure clearer, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below in conjunction with the drawings in the embodiments of the present disclosure. Obviously, the described embodiments are part of the embodiments of the present disclosure, rather than all of the embodiments.

[0050] (I) Definitions or terms

[0051] The following abbreviations are used for the relevant definitions or terms involved in this disclosure. Unless otherwise defined, all scientific and technological terms used herein have the meanings commonly understood by those of ordinary skill in the art. The following terms are provided below.

[0052] 1. Fusion gene

[0053] The "fusion gene" described in the present disclosure refers to a chimeric gene composed of partial or all coding regions of two or more genes connected end to end and placed under the control of the same set of regulatory sequences (including promoters, enhancers, ribosome binding sequences, terminators, etc.). When the first fusion gene is a partial coding region, the site where it is connected to other genes or gene fragments is called the breakpoint of the first fusion gene. In existing reports, fusion genes obtained by chimerizing certain genes with other genes or gene fragments at specific breakpoints are closely related to certain specific diseases. Therefore, detecting whether a specific gene has a fusion gene with certain breakpoints can be used to assess the risk of certain diseases.

[0054] 2. The “samples” or “samples to be tested” described in the present disclosure include “samples containing fusion genes”, which are usually derived from tumor cells or various body fluid samples, such as blood, saliva, urine, pleural effusion, peritoneal effusion, etc. Tumor cells can be obtained by surgery, biopsy or fine needle puncture, while body fluid samples can be obtained by extraction. These samples contain genetic information of tumor cells or normal cells, and researchers can find fusion genes by detecting this genetic information. For example, lung cancer patients can surgically remove tumor tissue and obtain information about fusion genes from it. Researchers can use this information to study the occurrence and development mechanism of lung cancer and explore the relationship between fusion genes and the prognosis of lung cancer. In addition, researchers can also discover fusion genes by detecting circulating tumor cells or free DNA in the blood. By obtaining these samples and detecting the genetic information therein, researchers can gain an in-depth understanding of the relationship between fusion genes and the occurrence and development of tumors, providing strong support for the diagnosis, treatment and prognosis evaluation of tumors.

[0055] 3. The "splicing isomers" described in the present disclosure are initial pre-mRNAs produced by gene transcription, which undergo a series of processing processes, such as capping, tailing, splicing, etc., to finally form mature mRNAs. During the splicing process, introns are removed and exons are connected. Due to different splicing methods, different mRNAs can be produced, thereby forming splicing isomers. According to different splicing methods, splicing isomers can be divided into three types: Type I splicing isomers refer to different mRNA molecules produced by different transcription products of the same gene through different splicing methods. These mRNA molecules can jump between exons to produce the same or different proteins. For example, some genes can produce two different splicing isomers, one containing exons A and B, and the other containing exons C and D. Type II splicing isomers refer to different mRNA molecules produced by different transcription products of the same gene through the same splicing method. These mRNA molecules can have the same exon arrangement order, but can produce different proteins through mechanisms such as selective tailing and selective splicing. For example, some genes can produce two different splicing isomers, one with a complete open reading frame and the other without. Type III splicing isomers refer to different mRNA molecules produced by the same splicing method from the transcription products of different genes. These mRNA molecules can have the same exon arrangement order, but come from different genes. For example, some genes can produce different mRNA molecules with the transcription product of another gene through the same splicing method. Among them, different mature mRNAs can be regarded as fusion genes obtained by splicing different exons. According to the enrichment and detection method of fusion genes provided in the present disclosure, the enrichment or detection of splicing isomers can be achieved.

[0056] 4. The "ALK" gene described in the present disclosure encodes a receptor tyrosine kinase that belongs to the insulin receptor superfamily. The protein includes an extracellular domain, a hydrophobic stretch corresponding to a single transmembrane region, and an intracellular kinase domain. It plays an important role in the development of the brain and affects specific neurons in the nervous system. The gene has been found to be rearranged, mutated or amplified in a range of tumors, including anaplastic large cell lymphoma, neuroblastoma and non-small cell lung cancer. Chromosomal rearrangement is the most common genetic change in this gene, leading to the generation of multiple fusion genes in tumorigenesis.

[0057] 5. The "ROS1" gene described in the present disclosure encodes a receptor tyrosine kinase, which is highly expressed in a variety of tumor cell lines and belongs to the seven-family of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein can function as a growth factor or differentiation factor receptor.

[0058] 6. The protein encoded by the "RET" gene described in the present disclosure is a transmembrane receptor that is involved in a variety of cell signal transduction pathways. These pathways control cell growth, differentiation, and death. When the RET gene mutates or is abnormally expressed, the cell growth and differentiation process may be affected, leading to the occurrence of the disease. RET gene and cancer: The RET gene plays an important role in many cancers, especially medullary thyroid cancer and renal cell carcinoma. Some studies have shown that mutations or abnormal expression of the RET gene may be related to the occurrence and development of cancer. Therefore, studying the role of the RET gene in cancer can provide new ideas for the diagnosis and treatment of cancer.

[0059] 7. The "BRAF" gene described in the present disclosure is a proto-oncogene that encodes a serine / threonine protein kinase, called BRAF protein. BRAF protein plays an important role in cell signal transduction and is mainly involved in the MAPK signaling pathway. This pathway involves a cascade reaction of multiple kinases, transmitting signals from the cell surface to the cell nucleus, affecting cell growth, differentiation and apoptosis.

[0060] 8. The "NRG1" gene described in the present disclosure is a member of the brain-derived neurotrophic factor family, which plays an important role in the development and function of the nervous system. The NRG1 gene participates in the growth, differentiation, synaptic plasticity and apoptosis of nerve cells by binding to its receptor. The NRG1 gene is expressed in both the central and peripheral nervous systems, especially in the cerebral cortex, hippocampus, amygdala and other regions. In addition, the NRG1 gene is also expressed in tissues such as the heart, kidneys, and skeletal muscle.

[0061] 9. The "FGFR" gene described in the present disclosure is the abbreviation of fibroblast growth factor receptor gene, which is a type of transmembrane protein kinase receptor that has the function of regulating cell growth, proliferation and differentiation. The structure of the FGFR gene includes three parts: the extracellular region, the transmembrane region and the intracellular region. The extracellular region is the ligand binding region that can recognize and bind to fibroblast growth factor; the transmembrane region is the region that the cell membrane passes through and is composed of hydrophobic amino acids; the intracellular region is the kinase active region, which has the ability to phosphorylate tyrosine residues and can trigger signal transduction.

[0062] 10. The "NTRK" gene described in the present disclosure is a gene with important functions, which can encode NTRK receptors, which are proteins that play an important role in the development and function of the nervous system. NTRK receptors play a key role in cell signal transduction and can promote cell growth, differentiation and survival.

[0063] 11. The "EGFR" gene described in this disclosure is a growth factor receptor that was discovered in the mid-1980s. It was discovered by researchers at the University of Glasgow and the Mondrian Institute. EGFR is a transmembrane protein that is activated by ligands on the cell membrane and can stimulate cell growth, differentiation and proliferation. EGFR is expressed on many types of cells in the human body, but is mainly concentrated on the surface of epithelial cells in organs such as the skin, digestive tract and lungs.

[0064] 12. The "ERBB2" gene described in the present disclosure is also called the Her2 gene, which is a gene that plays an important role in cell signal transduction. It encodes a transmembrane receptor protein, called the Her2 receptor. This receptor is expressed on the cell surface and can bind to specific growth factors, thereby activating a series of signal transduction pathways and promoting cell growth and proliferation.

[0065] 13. The "MET" gene described in the present disclosure is called the hepatocyte growth factor receptor gene, which is a proto-oncogene. The protein it encodes is a tyrosine kinase transmembrane receptor that can bind to a variety of growth factors and signaling molecules and participate in processes such as cell proliferation, differentiation, migration and apoptosis.

[0066] 14. The "ESR1" gene described in the present disclosure was discovered in 1986 and is located on human chromosome 6. This gene encodes estrogen receptor alpha protein, a nuclear transcription factor that can bind to estrogen and regulate gene expression. The main function of the ESR1 gene is to encode estrogen receptor alpha protein, which plays an important role in organs and tissues such as the female reproductive system, bones, cardiovascular system and brain. Estrogen receptor alpha protein can bind to estrogen and regulate processes such as cell growth, development and metabolism.

[0067] 15. The "AML1" gene described in the present disclosure is a common gene in blood system tumors. Its full name is acute myeloid leukemia 1 gene. It is a transcription factor gene and plays an important role in the normal hematopoietic process. Abnormalities in the AML1 gene can lead to the occurrence of blood system tumors. Acute myeloid leukemia is a common blood system tumor characterized by abnormal proliferation of primitive cells in the bone marrow, which leads to the inhibition of normal hematopoietic function.

[0068] 16. The "BCR" gene described in the present disclosure is one of the genes in the BCR-ABL complex and is associated with the Philadelphia chromosome. BCR gene detection is a blood test for early detection and prediction of certain malignant diseases, used to detect aberrations in the B and C regions (suspicious chromosomal crossovers) that regulate cell proliferation and apoptosis. BCR gene detection can be used to detect chronic lymphocytic leukemia (CLL) and chronic myeloid leukemia (CML), both of which are related to aberrations in BCR.

[0069] 17. The "RARα" gene described in the present disclosure is a key gene, also known as retinoic acid receptor α, which belongs to the retinoic acid (RA) nuclear receptor family. The main function of the RARα gene is to regulate ligand transcription factors by binding to the specific response element (RARE) in the promoter site of the target gene. The RARα gene is located on the long arm of chromosome 17 and plays an important role in the development of hematopoietic cells and the regulation of gene expression. In the absence of retinoic acid (RA), the retinoic acid receptor (RAR) forms a heterodimer with the retinol X receptor, and the RARα gene connects to the nuclear corepressor receptor to form an aggregate composed of a corepressor complex, chromatin condensates and transcription inhibitors.

[0070] 18. The "E2A" gene described in the present disclosure is a gene related to leukemia and immune system development. In acute lymphoblastic leukemia, mutations in the E2A gene can lead to the occurrence of leukemia. The E2A gene is a matrix for the production of T cell surface antigens. In mature T cells, mutations in this gene can lead to abnormal proliferation of T cells, thus becoming the main source of leukemia cells. In addition to being associated with leukemia, mutations in the E2A gene are also associated with mental retardation. The E2A gene is essential for the normal development of the immune system and central nervous system, and its mutation may lead to a series of developmental disorders and mental illnesses.

[0071] 19. The "TAL1" gene described in the present disclosure is a gene that plays a vital role in the development of hematopoietic stem cells and the formation of various blood cells. It is located in the 1p32 region of the chromosome and is a member of the bHLH transcription factor family. The basic structure of the TAL1 gene includes a DNA binding region and two a-helices, which are connected by a ring structure. This gene needs to form a homologous or heterologous dimer to function. Abnormal expression of the TAL1 gene is related to the occurrence of acute T-lymphocytic leukemia (T-ALL). Among T-ALL patients, about 60% have abnormal expression of the TAL1 gene. Among them, 30% are due to the deletion of the DNA fragment between SIL1 and TAL1, which causes the promoter of SIL to activate the expression of TAL1. In addition, in 6% of patients, the TAL1 gene recombines with other oncogenes, resulting in overexpression of TAL1. In addition, a small number of T-ALL patients have translocation and overexpression of other members of the βHLH family such as LYL1, TAL2 and BHLHB1.

[0072] 20. The "DEK" gene described in the present disclosure is an oncogene that encodes a protein with a SAP domain. This protein can bind to cruciform and supercoiled DNA, induce positive supercoils to form closed circular DNA, and participate in splice site selection during mRNA processing. Chromosomal aberrations involving this region, increased expression of this gene, and the presence of antibodies against this protein are all associated with various diseases. Two transcript variants encoding different isoforms have been discovered.

[0073] 21. The full name of the "AML1" gene described in the present disclosure is acute myeloid leukemia gene, which is one of the most commonly mutated genes in human leukemia. The fusion protein AML-1-ETO / MTG8 produced by the AML-1 gene can cause one of the most common chromosomal translocations in acute myeloid leukemia. In addition, there are many forms of mutations in the AML1 gene, including fusion genes and point mutations. For example, TEL-AML1 is a genetic gene mutation common in childhood acute lymphoblastic leukemia, which is formed by the fusion of the TEL gene on chromosome 12 and the AML1 gene on chromosome 21. In addition, mutations in the AML-1 gene may also be associated with other gene mutations, such as mutations in genes such as Flt3 and N-Ras. Mutations in the AML1 gene are also common in blood tumors, and their mutations may cause abnormal proliferation and differentiation of cells, thereby triggering the occurrence of blood tumors such as leukemia. Therefore, detecting mutations in the AML1 gene is of great significance for the diagnosis and treatment of blood tumors such as leukemia.

[0074] 22. The "PDGFRA" gene described in the present disclosure is a tyrosine kinase type III receptor, also known as platelet-derived growth factor receptor. This gene plays an important role in the human body, mainly involving cell division and proliferation, injury healing, inflammation and vasculogenesis. After the PDGFRA gene is expressed, it binds to platelet-derived growth factor to form a receptor ligand complex and activates it. This process can activate the phosphorylation pathways of phosphatidylinositol, cyclic adenosine monophosphate and various proteins. These signal transduction pathways further induce the expression of corresponding genes, promote DNA synthesis, and cause cell division and proliferation. The PDGFRA gene plays a key role in human development and tissue repair, but in certain cases, such as tumor occurrence and development, this gene may mutate or be overexpressed.

[0075] 23. The full name of the "KMT2A" gene described in the present disclosure is "lysine-specific methyltransferase2A", which is a gene that encodes proteins in humans and is located on chromosome 11. The KMT2A gene is an epigenetic modification-related gene, and its function mainly involves the regulation of gene expression. KMT2A gene mutations can cause some diseases of the blood and bone systems, the most important of which is acute myeloid leukemia in children. In addition, KMT2A gene mutations may also cause skeletal malformations, such as malformations of the clavicle, radius and other parts, as well as problems such as motor development retardation. In terms of intellectual development, KMT2A gene mutations may also have a certain impact. Specifically, it manifests as intellectual retardation, decreased learning ability and other problems. These effects may be related to the role of the KMT2A gene in brain development.

[0076] 24. The "NPM" gene described in the present disclosure is a gene related to nuclear phosphoprotein (Nucleophosmin, NPM). NPM genes are widely present in various organisms and have multiple biological functions, including regulating the cell cycle, participating in DNA damage repair, and regulating gene expression. In the cell nucleus, NPM interacts with a variety of proteins to form a complex network structure, which plays an important regulatory role in the biological activities in the cell nucleus. In some cases, the NPM gene will mutate or mutate, resulting in abnormal expression or dysfunction of the NPM protein. These abnormal NPM proteins may cause abnormalities in processes such as cell growth, differentiation and apoptosis, thereby causing certain diseases, such as cancer. Therefore, research on the NPM gene helps to gain a deeper understanding of its biological functions and regulatory mechanisms, and provide new ideas and targets for disease diagnosis and treatment.

[0077] 25. The "NUP98" gene described in the present disclosure is a nucleoporin gene located on chromosome 11p15.5. It encodes a 186kDa precursor protein, which undergoes self-protection cleavage to produce a 98kDa nucleoporin and a 96kDa nucleoporin. The 98kDa nucleoporin contains a Gly-Leu-Phe-Gly (GLFG) repeat domain and is involved in many cellular processes, including nuclear import, nuclear export, mitotic progression, and gene expression regulation. In addition, the NUP98 gene is also involved in regulating the transport of substances such as proteins and RNA inside and outside the nucleus. In acute myeloid leukemia (AML), the NUP98-NSD1 fusion gene can encode a fusion protein with dual activity of acetyltransferase and methyltransferase, which can be detected in 16.1% of childhood hereditary AML and 2.3% of adult AML, and such patients often have a poor prognosis.

[0078] 26. The "SET" gene described in the present disclosure is a gene that plays an important role in organisms. Its full name is "Suppressor of variegation, Enhancer of yellow, Flare", which is translated into Chinese as "Suppressor of variegation, Enhancer of yellow, Flare". The SET gene was first discovered in fruit flies, and homologous genes were found in many other organisms, such as humans and mice. The protein product of the SET gene, SET protein, is a widely expressed nuclear protein that participates in a variety of biological processes, including cell cycle regulation, cell apoptosis and DNA repair. The functions of the SET gene in organisms are multifaceted. Studies have shown that the SET gene affects the growth and development of organisms and cell differentiation through interactions with other genes. In addition, the SET gene is also involved in the regulation of cell apoptosis and DNA repair, and plays an important role in maintaining cell stability and preventing cell canceration.

[0079] 27. The "TEL" gene described in the present disclosure is also called the ETV6 gene. It is a gene located on chromosome 12p13, which encodes a transcription factor belonging to the ETS family. This is a tumor suppressor gene that plays an important role in the development and maintenance of hematopoiesis and vascular networks. The TEL gene is also a member of the ETS transcription factor family. The TEL gene can undergo chromosomal translocation with a variety of genes, among which genes encoding protein kinases are the most susceptible to chromosomal translocation effects with the TEL gene. For example, the fusion of the TEL gene and the ABL kinase as well as the JAK2 and NTRK3 genes has been discovered. When the TEL gene and the ABL gene undergo chromosomal translocation, the kinase of ABL will be continuously activated, and cell growth will gradually lose its dependence on IL-3, and the expression of c-myc downstream of the signaling pathway will be activated.

[0080] 28. The "TLS" gene described in the present disclosure is called TERT promoter, which is a gene expressed in many different types of cells. It plays an important role in the regulation of telomerase and can affect the life span of cells. Telomerase is an enzyme that maintains the length of telomeres at the ends of chromosomes during cell division, and the TLS gene regulates cell life span by affecting the activity of telomerase. In normal cells, as the number of cell divisions increases, the length of telomeres at the ends of chromosomes gradually shortens, causing the cells to gradually age. However, in certain types of cells, the expression of the TLS gene is activated, which enhances the activity of telomerase, thereby maintaining the length of the telomeres and extending the life span of the cells.

[0081] 29. The "CBFB" gene described in the present disclosure is a gene related to leukemia. The protein it encodes is the β subunit of the heterodimeric core binding transcription factor of the PEBP2 / CBF transcription factor family. This gene locus is an important factor leading to leukemia. Therefore, by detecting the DNA sequence of the CBFB gene locus, it can be determined whether there is a pathogenic gene mutation. If there is a gene mutation, it may lead to the occurrence of leukemia. By early detection of people with potential risks, effective prevention and treatment measures can be taken to ensure health.

[0082] 30. The "VMP1" gene described in the present disclosure is also known as the TMEM49 gene, which is a stress-inducible gene. It encodes a vacuole envelope protein, which is closely related to the autophagy process of the cell and is considered to be an important regulatory factor in the autophagy process of the cell. Autophagy plays an important role in determining the fate of cells. It can reduce some aged and low-functioning organelles, recycle some cellular components and respond to cell stress. Therefore, the relationship between autophagy and tumors has also been widely studied. The protein expressed by the MP1 gene is a transmembrane protein with 6 hydrophobic regions, so it can be localized in the endoplasmic reticulum and Golgi apparatus in the cell membrane. Among these organelles, VMP1 was found to be necessary to maintain the normal function and integrity of these organelles. In cells lacking VMP1, the secretory function pathways of these organelles are disrupted.

[0083] 31. The "CLDN18" gene described in the present disclosure is a gene encoding a tight junction protein and belongs to the Claudin family. This gene plays a key role in maintaining cell polarity and signal transduction, and also plays an important role in the occurrence and development of some diseases. The CLDN18 gene is located in the 3q22.3 region of human chromosome 3. Its first exon has two splice variants, forming two different protein subtypes, CLDN18.1 and CLDN18.2, respectively, and their N-termini have 69 different amino acid sequences. The expression of Claudin-18 is cell-specific. CLDN18.1 is only expressed in alveolar epithelial cells in normal tissues, while CLDN18.2 is only expressed in differentiated gastric mucosal epithelial cells in normal tissues. It has the barrier function of maintaining the gastric mucosa and can prevent H+ in gastric acid from leaking through the paracellular pathway.

[0084] 32. The "ARHGAP" gene described in the present disclosure is a type of gene that has important regulatory functions on neural activity. Members of this gene family include ARHGAP1, ARHGAP2 (CHN1), ARHGAP3 (CHN2), ARHGAP4, ARHGAP5, ARHGAP6 (STARD8), ARHGAP7 (STARD12 or DLC1), ARHGAP8, ARHGAP9, ARHGAP10, ARHGAP12, ARHGAP13 (SRGAP1), ARHGAP14 (SRGAP2), ARHGAP15, ARHGAP17 (RICH1), ARHGAP18, ARHGAP19, ARHGAP20, ARHGAP21, ARHGAP22, ARHGAP23, ARHGAP24, ARHGAP25, ARHGAP26, STRAD13 (DLC2), HA-1, GMIP, PARG1, PIK3RACGAP1 and FNBP2, etc. The functions of this gene family are mainly related to the development and signal transduction of nerve cells. Studies have shown that mutations in some ARHGAP genes can lead to neurodevelopmental disorders and neurological diseases, such as intellectual disability, autism and Parkinson's disease. At the same time, studies have shown that the ARHGAP11B gene may affect the formation of the neocortex and define it as a "smart" gene. Scientists have found through studying the ARHGAP11B gene in marmosets that this gene forms complex folds and gyrus-like structures in the marmoset cerebral cortex, and significantly increases the number of upper-layer neurons, and the brain capacity also increases accordingly.

[0085] 33. The "CD44" gene described in the present disclosure is a gene located on human chromosome 11, with a total length of about 50kb and composed of 20 highly conserved exons. These exons can be divided into two categories: constitutive exons (C) and variant spliced ​​exons (V) according to the different transcription modes. The expression product of the CD44 gene is a cell surface glycoprotein that has functions such as participating in cell-cell interactions, cell adhesion and cell migration. The transcription products of the CD44 gene have various forms, including standard CD44 (CD44S) and CD44V. The CD44 gene plays an important role in many physiological and pathological processes, such as lymphocyte homing, tumor occurrence and development, etc.

[0086] 34. The proteins encoded by the "SLC1A2" gene described in the present disclosure play an important role in the pathogenesis of ET. They play a key role in removing glutamate from the synaptic cleft and are responsible for about 90% of glutamate uptake in most brain regions. Glutamate is an excitatory neurotransmitter in the central nervous system. Long-term elevated glutamate concentration in the synaptic cleft is neurotoxic. This gene misregulation is believed to be related to some neurological diseases.

[0087] 35. The "TSC2" gene described in the present disclosure is the abbreviation of tuberous sclerosis complex 2, which is a gene that can explain about 80% of cases of sarcoidosis complex disease. Sarcoidosis complex is a common genetic disease characterized by tumor-like warts on the human body surface, as well as malformations or multiple lesions of the brain, heart, kidneys, eyes and other organs. TSC2 gene testing is to detect whether this gene is affected by substitution or activating mutations. This test result is very important because it can help doctors diagnose sarcoidosis complex and develop more targeted and effective plans for future treatment.

[0088] 36. The protein encoded by the "RNF216" gene described in the present disclosure is involved in the ubiquitination process. Ubiquitination is a cellular process by which unwanted proteins are tagged with ubiquitin and then broken down. One of the proteins tagged by RNF216 is found in nerve cells (neurons) and plays a role in the process of synaptic plasticity. Synaptic plasticity is the ability of the connections between neurons (synapses) to change and adapt over time in response to experience. This process is essential for learning and memory.

[0089] 37. The "AGTARP" gene described in the present disclosure is the abbreviation of the adenylate cyclase-GTPase regulatory protein gene, which is a gene that plays an important role in the human body. It is involved in regulating signal transduction and metabolic processes in cells and is essential for maintaining normal physiological functions of the human body. Mutations in the AGTARP gene may cause a series of diseases, such as cancer, neurodegenerative diseases, etc. Understanding the role and function of the AGTARP gene will help to further explore the pathogenesis of these diseases and provide new ideas and methods for disease diagnosis, prevention and treatment.

[0090] 38. The "TACC2" gene described in the present disclosure is a gene associated with cancer. The protein it encodes is concentrated in the centrosome throughout the cell cycle, which is a conservative family of microtubule-interacting proteins. The TACC2 gene is located in a chromosomal region associated with tumorigenesis, and its expression may be induced by erythropoietin and is believed to affect the progression of breast tumors. In addition, some transcriptional variants encoding different subtypes of the TACC2 gene have been found.

[0091] 39. The "PPAPDC1A" gene described in the present disclosure is a gene that plays an important role in the human body, mainly participating in the phosphorylation reaction and glycolysis process in cells. The expression of this gene is affected by many factors, including lifestyle, eating habits and environmental factors. By studying the PPAPDC1A gene, scientists can gain a deeper understanding of its role in cell biology and the occurrence and development of diseases, and provide new ideas and directions for future medical research.

[0092] 40. The "RAS" gene described in the present disclosure is a proto-oncogene that exists in the genome of humans and many other organisms. It encodes a GTPase that plays a key role in cell signal transduction. The RAS gene is involved in regulating cell proliferation and tumorigenesis by regulating processes such as cell growth, differentiation and apoptosis. The protein encoded by the RAS gene is a GTP-binding protein with a relative molecular mass of 21,000 and has GTPase activity. It can bind to and hydrolyze GTP (guanine nucleotide), thereby playing a switching role in the signal transduction process. When GTP is bound, the RAS protein is in an activated state and can trigger the downstream signal transduction pathway; when GTP is hydrolyzed, the RAS protein is in an inactivated state and the signal transduction process is terminated.

[0093] 41. The "RPS6KB1" gene described in the present disclosure is ribosomal protein S6 kinase B1, a gene in the species Rattus norvegicus (rat), and synonyms include p70 S6K-alpha. The gene ID is 83840, and the gene type is protein coding. In addition, regarding the RPS6KB1 gene, there is a product called RPS6KB1 Knockout Lentivirus (RPS6KB1 gene knockout lentivirus), which can simultaneously express Cas9, target gene sgRNA and puromycin resistance gene after infecting animal cells, and can be used to knock out target genes in animal cells based on CRISPR / Cas9 technology.

[0094] 42. The "MAN2A1" gene described in the present disclosure is also known as mannosidase alpha class 2A member 1, which is a protein-encoding gene. Diseases associated with this gene include congenital dyserythropoietic anemia and systemic autoimmune diseases. Its related pathways include translation of structural proteins and mid / trans-Gol body N-glycosyl side chain extension. Gene ontology (GO) annotations associated with this gene include carbohydrate binding and alpha-mannosidase activity.

[0095] 43. The "FER" gene described in the present disclosure is a member of the plant receptor protein kinase gene (RLK) family, specifically belonging to the plant-specific crRLK gene family. The protein coding region of this gene has only one short intron in the 5′-UTR (untranslated region), and no introns in other positions. FER protein is a membrane receptor protein with four distinct domains: an extracellular N-terminal signal peptide, two repeated Malectin-like domains, an intermediate transmembrane domain, and an intracellular serine / threonine kinase domain. FER protein is polarly expressed on the filamentous apparatus of the synergid cells of the ovule, and was first recognized in the process of recognition between Arabidopsis pollen tubes and synergid cells. When the pollen tube enters the ovule with a FER gene mutation, the top of the pollen tube does not break but continues to grow inside the ovule, making it impossible to complete the fertilization process. As a positive regulator, FER protein can activate the phosphatase activity of ABI2, thereby negatively regulating the plant's response to ABA.

[0096] 44. The full name of the "DNAJB1" gene described in the present disclosure is DnaJ (Hsp40) homolog, subfamily B, member 1, also known as Hdj1, Hsp40, HSPF1, RSPH16B, Sis1. This gene is located at position 19p13.12 of the human chromosome, and the gene type is protein coding. The protein encoded by the DNAJB1 gene is a molecular chaperone that participates in a variety of cellular activities, such as protein folding and oligomeric protein complex assembly. The protein it encodes is a highly conserved J domain protein, which is one of the two main types of molecular chaperones and participates in a wide range of cellular events.

[0097] 45. The "ATP1B1" gene described in the present disclosure is a gene related to Na + / K + Ion transport related genes, the protein it encodes is Na + / K + β1 subunit of the ion pump. Na + / K + Ion pumps are important molecules that maintain ion balance inside and outside cells and participate in a variety of physiological and pathological processes. Mutations in the ATP1B1 gene can lead to a variety of diseases, such as congenital nephrotic syndrome and pseudoaldosteronism. In addition, the expression of the ATP1B1 gene is also related to the occurrence and development of some cancers.

[0098] 46. ​​The "FIG" gene described in the present disclosure is a gene related to the calcium signaling pathway, and plays an important role in the response to osmotic pressure in Aspergillus cristatus. The full length of this gene is 994 nt, contains 3 introns, is predicted to encode 271 amino acids, and has four transmembrane regions, belonging to a hydrophobic protein. In addition, the conserved domains and transmembrane structures of the Fig gene are similar to those of other Aspergillus Fig genes. In the calcium signaling pathway, the Fig gene may play a key role. It responds to changes in osmotic pressure by transporting calcium ions, which may affect processes such as sexual development, asexual spore production and hyphal growth.

[0099] 47. The "PRKACA" gene described in the present disclosure is a gene encoding the catalytic subunit of protein kinase A. This gene plays an important role in the human body, especially in processes such as cell differentiation, proliferation and apoptosis. The PRKACA gene participates in the synthesis of the protein kinase A holoenzyme by encoding the catalytic subunit. This holoenzyme is a tetramer, including two regulatory subunits and two catalytic subunits. When cAMP (a second messenger) binds to the holoenzyme, a regulatory subunit dimer can be dissociated, and at the same time, it binds to the catalytic subunits of four cAMPs and two free monomers, thereby activating protein kinase A. Mutations in the PRKACA gene are associated with a variety of diseases. Constitutive activation of the gene, caused by somatic mutations or genomic duplications of the region including the gene, is associated with adrenal cortical hyperplasia and adenoma, and is associated with adrenocorticotropic hormone-dependent Cushing's syndrome. In addition, mutations in the PRKACA gene may also be associated with cancers such as liver cancer.

[0100] 48. The "PRKACB" gene described in the present disclosure is a gene encoding protein kinase A catalytic subunit β, which belongs to the serine / threonine protein kinase family. This gene is located on chromosome 1 and participates in the signal transduction of cyclic AMP-dependent protein kinase by encoding protein kinase A catalytic subunit β. Cyclic AMP signal transduction plays an important role in processes such as cell proliferation and differentiation. There are many alternative splicing transcript variants of the PRKACB gene, and different transcripts have different functions. PRKACB gene mutations are associated with the occurrence of many diseases, including tumors, cardiovascular diseases, etc. In terms of tumors, PRKACB gene mutations can lead to abnormal cell proliferation and apoptosis, thereby promoting the occurrence and development of tumors. In terms of cardiovascular, PRKACB gene mutations can affect the contraction and relaxation function of cardiomyocytes, thereby causing heart disease.

[0101] 49. The "IRF2BP2" gene described in the present disclosure is an interferon regulatory factor, which is expressed in humans and animals and mainly plays a role in heart and skeletal muscle tissue. It contains two alternative splicing isoforms, namely IRF2BP2A and IRF2BP2B. The IRF2BP2 gene was first screened out by Stephen et al. through the yeast two-hybrid system in 2003 and was identified as a transcription factor co-acting factor of IRF2. In addition, studies have shown that IRF2BP2 is a target gene of p53 and can act as a transcriptional co-repressor of p53, inhibiting the expression of genes downstream of p53 such as p21 and BAX, and thus playing an important role in biological processes such as cell cycle, cell differentiation and cell apoptosis.

[0102] 50. The "SEC16A" gene described in the present disclosure is located on human chromosome 9q34.3, is commonly expressed in tissues such as the stomach, ovary, and bone marrow, and encodes a protein that forms part of the Sec16 complex, which plays an important role in protein transport from the endoplasmic reticulum to the Golgi apparatus. Alternative splicing is a post-transcriptional regulatory mechanism that affects protein diversity, participates in the development of cancer, and is significantly associated with the overall survival of ovarian cancer patients. Alternative splicing of SEC16A has been shown to be associated with the occurrence, invasion, and metastasis of gastric cancer, and its gene expression level is negatively correlated with patient survival.

[0103] 51. The "NOTCH1" gene described in the present disclosure is a single transmembrane receptor that was originally discovered in the Drosophila nervous system. It is named because of the partial loss of function mutation that causes a notch (Notch) on the edge of the Drosophila wing. The protein encoded by the NOTCH1 gene is a highly conserved cell surface receptor that belongs to the Notch family, which also includes four receptors: NOTCH2, NOTCH3, and NOTCH4. The NOTCH1 gene is located on chromosome 9 in humans, with a start site of 139388896 and a stop site of 139440314, on the negative chain. Disorders in the Notch signal not only directly, but also indirectly induce tumorigenesis through multiple other signal pathways. It has been found that abnormalities in the Notch signaling pathway are closely related to esophageal cancer, gastric cancer, cervical cancer, and colorectal cancer, among which Notch1 abnormalities are most commonly detected in tumor tissues.

[0104] 52. The "RUNX1" gene described in the present disclosure is also known as Runt-related transcription factor 1, which is a protein-coding gene that plays an important role in many biological processes, including cell development and regulation of expression of specific genes. The RUNX1 gene is located on chromosome 21q22, and it can regulate the expression of multiple genes necessary for hematopoiesis. Mutations in the RUNX1 gene, especially those in the germline, are associated with a range of blood diseases. Germline mutations may cause autosomal dominant familial platelet diseases and increase the risk of blood malignancies, such as acute myeloid leukemia (AML) or myelodysplastic syndrome (MDS). These diseases may progress, for example, from MDS to AML. In the common gene mutation group with RUNX1 germline mutations, pathogenic mutations include nonsense mutations, frameshift mutations, duplications, deletions, and missense mutations. MDS and AML are the most common blood tumors with germline RUNX1 mutations. In addition, they have also been reported in chronic myeloid leukemia (CMML), T lymphocytic leukemia / lymphoma, and very few B cell tumors (including hairy cell leukemia).

[0105] (II) Detailed technical solution

[0106] In a specific embodiment, in a first aspect, the present disclosure provides a method for enriching a fusion gene or a splicing isoform, comprising amplifying the fusion gene using random primers and specific primers targeting a first fusion gene, wherein the specific primers carry a modification group for purification, and after completion of the amplification, recovering the amplified product carrying the modification group.

[0107] In an alternative embodiment, the modifying group comprises biotin.

[0108] In an optional embodiment, the target fragment of the specific primer in the first fusion gene is 1 to 100 nt away from the fusion breakpoint, preferably 4 to 79 nt, further preferably 10 to 79 nt, and more preferably 10 to 78 nt; the random primer is 6 to 30 nt in length, preferably 8 to 25 nt, and more preferably 16 to 20 nt.

[0109] In an optional embodiment, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1.

[0110] In an optional embodiment, the breakpoint of the ALK gene is optionally located at the junction of exon 19 and exon 20; the breakpoint of the ROS1 gene is optionally located at the junction of exon 31 and exon 32, at the junction of exon 32 and exon 33, or at the junction of exon 33 and exon 34; the breakpoint of the RET gene is optionally located at the junction of exon 11 and exon 12; the breakpoint of the NRG1 gene is optionally located at the junction of exon 1 and exon 2; the breakpoint of the BRAF gene is optionally located at the junction of exon 3 and exon 4, or at the junction of exon 10 and exon 11; the FGFR gene includes the FGFR1 gene located on chromosome 8, the FGFR2 gene located on chromosome 10, or the FGFR3 gene located on chromosome 4, and optionally, the The breakpoint is located at the junction of exon 9 and exon 10 of the FGFR1 gene, at the junction of exon 2 and exon 3 of the FGFR2 gene, or at the junction of exon 17 and exon 18 of the FGFR3 gene; the NTRK gene includes the NTRK1 gene located on chromosome 1, the NTRK2 gene located on chromosome 9, or the NTRK3 gene located on chromosome 15. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the NTRK1 gene, at the junction of exon 13 and exon 14 of the NTRK2 gene, at the junction of exon 14 and exon 15 of the NTRK3 gene, or at the junction of exon 19 and exon 20 of the NTRK3 gene; the breakpoint of the MET gene is optionally located at the junction of exon 13 and exon 14.

[0111] In an optional embodiment, the specific primer of the ALK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 1 to 9, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0112] The specific primer of the ROS1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 10 to 11, 49 to 51, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0113] The RET gene-specific primer has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 12 to 14, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0114] The specific primer for the BRAF gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 15 to 18, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0115] The specific primer of the NRG1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 19 to 21, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0116] The specific primer of the FGFR gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 22 to 27, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0117] The specific primer of the NTRK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 28 to 38, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0118] The specific primer for the MET gene has a nucleotide sequence that is 80% to 100% identical to the nucleotide sequence shown in any one of SEQ ID Nos: 52 to 53, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%.

[0119] In an optional embodiment, a blocker probe for blocking the amplification of the wild-type first fusion gene is further added to the amplification reaction system.

[0120] In an optional embodiment, the recovery method includes adding a purification reagent for capturing the modification group to the amplification product.

[0121] Optionally, the purification reagent comprises magnetic beads, to which modified group binding molecules are attached.

[0122] In a second aspect, the present disclosure provides enrichment primers for fusion genes or splicing isoforms, including random primers and specific primers targeting a first fusion gene, wherein the specific primers carry a modification group for purification, and the purification modification is used to separate the enriched product of the random primer and the specific primer as a primer pair.

[0123] In an optional embodiment, the target fragment of the specific primer in the first fusion gene is 1 to 100 nt away from the fusion breakpoint, preferably 4 to 79 nt, further preferably 10 to 79 nt, and more preferably 10 to 78 nt; the random primer is 6 to 30 nt in length, preferably 8 to 25 nt, and more preferably 16 to 20 nt.

[0124] Preferably, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1.

[0125] The breakpoint of the ALK gene is optionally located at the junction of exon 19 and exon 20; the breakpoint of the ROS1 gene is optionally located at the junction of exon 31 and exon 32, at the junction of exon 32 and exon 33, or at the junction of exon 33 and exon 34; the breakpoint of the RET gene is optionally located at the junction of exon 11 and exon 12; the breakpoint of the NRG1 gene is optionally located at the junction of exon 1 and exon 2; the breakpoint of the BRAF gene is optionally located at the junction of exon 3 and exon 4, or at the junction of exon 10 and exon 11; the FGFR gene includes the FGFR1 gene located on chromosome 8, the FGFR2 gene located on chromosome 10, or the FGFR3 gene located on chromosome 4, and optionally, the breakpoint is located at the junction of exon 11 and exon 12; The breakpoint is located at the junction of exon 9 and exon 10 of the FGFR1 gene, at the junction of exon 2 and exon 3 of the FGFR2 gene, or at the junction of exon 17 and exon 18 of the FGFR3 gene; the NTRK gene includes the NTRK1 gene located on chromosome 1, the NTRK2 gene located on chromosome 9, or the NTRK3 gene located on chromosome 15. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the NTRK1 gene, at the junction of exon 13 and exon 14 of the NTRK2 gene, at the junction of exon 14 and exon 15 of the NTRK3 gene, or at the junction of exon 19 and exon 20 of the NTRK3 gene; the breakpoint of the MET gene is optionally located at the junction of exon 13 and exon 14.

[0126] In an optional embodiment, the specific primer of the ALK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 1 to 9, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0127] The specific primer of the ROS1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 10 to 11, 49 to 51, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0128] The RET gene-specific primer has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 12 to 14, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0129] The specific primer for the BRAF gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 15 to 18, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0130] The specific primer of the NRG1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 19 to 21, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0131] The specific primer of the FGFR gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 22 to 27, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0132] The specific primer of the NTRK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 28 to 38, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0133] The specific primer for the MET gene has a nucleotide sequence that is 80% to 100% identical to the nucleotide sequence shown in any one of SEQ ID Nos: 52 to 53, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%.

[0134] In an alternative embodiment, the modifying group comprises biotin.

[0135] In an optional embodiment, a blocker probe for blocking amplification of the wild-type first fusion gene is also included.

[0136] In a third aspect, the present disclosure provides an enrichment composition for fusion genes or splice isoforms, comprising the enrichment primers described in the second aspect and a purification reagent for capturing modification groups.

[0137] Optionally, the purification reagent comprises magnetic beads, to which modified group binding molecules are attached.

[0138] In a fourth aspect, the present disclosure provides use of the enrichment primer described in the second aspect or the enrichment composition described in the third aspect in the preparation of a reagent or kit for gene fusion enrichment.

[0139] In a fifth aspect, the present disclosure provides an enrichment reagent or kit for a fusion gene or splicing isoform, comprising the enrichment primers described in the second aspect or the enrichment composition described in the third aspect; preferably, it also includes a sampling tool and / or other consumables.

[0140] Optionally, the sample collected by the sampling tool includes tumor cells and / or body fluids; preferably, the body fluids include blood, saliva, urine, pleural effusion or peritoneal effusion.

[0141] In a sixth aspect, the present disclosure provides a method for detecting a fusion gene or a splice isoform, comprising adding a detection primer pair to a sample containing a fusion gene to amplify the fusion gene, separating the fusion gene enriched product from the amplified product using a purification reagent after amplification, and then sequencing the fusion gene enriched product using a sequencing primer pair;

[0142] The detection primer pair includes a random primer and a specific primer targeting the first fusion gene, the random primer is connected to the first universal primer, the specific primer is connected to the second universal primer with a modification group for purification, and the purification modification is used to separate the enriched product of the random primer and the specific primer as the primer pair;

[0143] The sequencing primer pair includes a first sequencing primer and a second sequencing primer, wherein the first sequencing primer contains a sequence that hybridizes with the first universal primer and a first sequencing primer adapter sequence, and the second sequencing primer contains a sequence that hybridizes with the second universal primer and a second sequencing primer adapter sequence. The detection method can be used to detect whether a suspected case sample contains a fusion gene or a splicing isomer, and to predict the disease risk of the individual from which the sample is derived. Alternatively, the detection method can also be used to detect fusion genes or splicing isomers prepared in vitro, such as evaluating the quality of the prepared fusion gene product or the splicing efficiency of the constructed splicing isomer system.

[0144] In an alternative embodiment, the modifying group comprises biotin.

[0145] In an optional embodiment, a blocker probe for blocking the amplification of the wild-type first fusion gene is also added to the fusion gene amplification reaction system.

[0146] In an optional embodiment, the purification reagent includes magnetic beads, and the magnetic beads are linked to modifying group binding molecules.

[0147] In an optional embodiment, the target fragment of the specific primer in the first fusion gene is 1 to 100 nt away from the fusion breakpoint, preferably 4 to 79 nt, further preferably 10 to 79 nt, and more preferably 10 to 78 nt; the random primer is 6 to 30 nt in length, preferably 8 to 25 nt, and more preferably 16 to 20 nt.

[0148] Preferably, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1.

[0149] The breakpoint of the ALK gene is optionally located at the junction of exon 19 and exon 20; the breakpoint of the ROS1 gene is optionally located at the junction of exon 31 and exon 32, at the junction of exon 32 and exon 33, or at the junction of exon 33 and exon 34; the breakpoint of the RET gene is optionally located at the junction of exon 11 and exon 12; the breakpoint of the NRG1 gene is optionally located at the junction of exon 1 and exon 2; the breakpoint of the BRAF gene is optionally located at the junction of exon 3 and exon 4, or at the junction of exon 10 and exon 11; the FGFR gene includes the FGFR1 gene located on chromosome 8, the FGFR2 gene located on chromosome 10, or the FGFR3 gene located on chromosome 4, and optionally, the breakpoint is located at the junction of exon 11 and exon 12; The breakpoint is located at the junction of exon 9 and exon 10 of the FGFR1 gene, at the junction of exon 2 and exon 3 of the FGFR2 gene, or at the junction of exon 17 and exon 18 of the FGFR3 gene; the NTRK gene includes the NTRK1 gene located on chromosome 1, the NTRK2 gene located on chromosome 9, or the NTRK3 gene located on chromosome 15. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the NTRK1 gene, at the junction of exon 13 and exon 14 of the NTRK2 gene, at the junction of exon 14 and exon 15 of the NTRK3 gene, or at the junction of exon 19 and exon 20 of the NTRK3 gene; the breakpoint of the MET gene is optionally located at the junction of exon 13 and exon 14.

[0150] In an optional embodiment, the specific primer of the ALK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 1 to 9, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0151] The specific primer of the ROS1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 10 to 11, 49 to 51, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0152] The RET gene-specific primer has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 12 to 14, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0153] The specific primer for the BRAF gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 15 to 18, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0154] The specific primer of the NRG1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 19 to 21, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0155] The specific primer of the FGFR gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 22 to 27, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0156] The specific primer of the NTRK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 28 to 38, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0157] The specific primer for the MET gene has a nucleotide sequence that is 80% to 100% identical to the nucleotide sequence shown in any one of SEQ ID Nos: 52 to 53, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%.

[0158] In an optional embodiment, the sample includes tumor cells and / or body fluid; preferably, the body fluid includes blood, saliva, urine, pleural effusion or peritoneal effusion.

[0159] In the seventh aspect, the present disclosure provides a detection primer for a fusion gene or splicing isoform, comprising a random primer and a specific primer targeting a first fusion gene, wherein the random primer is connected to a first universal primer, and the specific primer is connected to a second universal primer with a modification group for purification, and the purification modification is used to separate the enriched product of the random primer and the specific primer as a primer pair.

[0160] In an alternative embodiment, the modifying group comprises biotin.

[0161] In an optional embodiment, the detection primer further comprises a blocker probe for blocking amplification of the wild-type first fusion gene.

[0162] In an optional embodiment, the target fragment of the specific primer in the first fusion gene is 1 to 100 nt away from the fusion breakpoint, preferably 4 to 79 nt, further preferably 10 to 79 nt, and more preferably 10 to 78 nt; the random primer is 6 to 30 nt in length, preferably 8 to 25 nt, and more preferably 16 to 20 nt.

[0163] Preferably, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1.

[0164] The breakpoint of the ALK gene is optionally located at the junction of exon 19 and exon 20; the breakpoint of the ROS1 gene is optionally located at the junction of exon 31 and exon 32, at the junction of exon 32 and exon 33, or at the junction of exon 33 and exon 34; the breakpoint of the RET gene is optionally located at the junction of exon 11 and exon 12; the breakpoint of the NRG1 gene is optionally located at the junction of exon 1 and exon 2; the breakpoint of the BRAF gene is optionally located at the junction of exon 3 and exon 4, or at the junction of exon 10 and exon 11; the FGFR gene includes the FGFR1 gene located on chromosome 8, the FGFR2 gene located on chromosome 10, or the FGFR3 gene located on chromosome 4, and optionally, the breakpoint is located at the junction of exon 11 and exon 12; The breakpoint is located at the junction of exon 9 and exon 10 of the FGFR1 gene, at the junction of exon 2 and exon 3 of the FGFR2 gene, or at the junction of exon 17 and exon 18 of the FGFR3 gene; the NTRK gene includes the NTRK1 gene located on chromosome 1, the NTRK2 gene located on chromosome 9, or the NTRK3 gene located on chromosome 15. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the NTRK1 gene, at the junction of exon 13 and exon 14 of the NTRK2 gene, at the junction of exon 14 and exon 15 of the NTRK3 gene, or at the junction of exon 19 and exon 20 of the NTRK3 gene; the breakpoint of the MET gene is optionally located at the junction of exon 13 and exon 14.

[0165] In an optional embodiment, the specific primer of the ALK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 1 to 9, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0166] The specific primer of the ROS1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 10 to 11, 49 to 51, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0167] The RET gene-specific primer has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 12 to 14, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0168] The specific primer for the BRAF gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 15 to 18, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0169] The specific primer of the NRG1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 19 to 21, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0170] The specific primer of the FGFR gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 22 to 27, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0171] The specific primer of the NTRK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 28 to 38, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%;

[0172] The specific primer for the MET gene has a nucleotide sequence that is 80% to 100% identical to the nucleotide sequence shown in any one of SEQ ID Nos: 52 to 53, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%.

[0173] In an eighth aspect, the present disclosure provides a detection composition for a fusion gene or a splice isoform, comprising the detection primer described in the seventh aspect, a purification reagent for capturing a modification group, and a sequencing primer pair suitable for a sequencing platform;

[0174] The sequencing primer pair includes a first sequencing primer and a second sequencing primer, wherein the first sequencing primer contains a sequence hybridizing with a first universal primer and a first sequencing primer adapter sequence, and the second sequencing primer contains a sequence hybridizing with a second universal primer and a second sequencing primer adapter sequence.

[0175] Optionally, the purification reagent comprises magnetic beads, to which modified group binding molecules are attached.

[0176] In a ninth aspect, the present disclosure provides a use of the detection primer described in the seventh aspect or the detection composition described in the eighth aspect in the preparation of a reagent or kit for detecting gene fusions or splicing isoforms.

[0177] In a tenth aspect, the present disclosure provides a fusion gene detection reagent or kit, comprising the detection primer described in the seventh aspect or the detection composition described in the eighth aspect; preferably, it also includes a sampling tool and / or other consumables.

[0178] In an optional embodiment, the sample includes tumor cells and / or body fluid; preferably, the body fluid includes blood, saliva, urine, pleural effusion or peritoneal effusion.

[0179] In the eleventh aspect, the present disclosure provides a method for diagnosing diseases related to gene fusion mutation or abnormal splicing of precursor mRNA, comprising collecting a sample to be tested, sequencing and detecting the breakpoints related to the gene fusion mutation according to the detection method described in the sixth aspect, and estimating the risk of gene fusion mutation in the sample to be tested.

[0180] Exemplarily, the enrichment method of unknown fusion genes used in a specific embodiment of the present disclosure includes:

[0181] (1) extracting total RNA from the sample to be tested and reversely transcribing it to obtain cDNA; (2) PCR amplification: using random primers and specific primers to perform a first amplification on the cDNA obtained in step (1) to obtain a fusion gene amplification product; the specific primers are modified with biotin; (3) secondary PCR amplification: using streptavidin magnetic beads to purify the product, and the purified material is subjected to secondary amplification to obtain an unknown fusion gene library.

[0182] Exemplarily, the method for detecting an unknown fusion gene used in a specific embodiment of the present disclosure includes:

[0183] (1) extracting total RNA from the sample to be tested, and reverse transcribing to obtain cDNA; (2) PCR amplification: using a random primer and a specific primer pair to perform a first amplification on the cDNA obtained in step (1) to obtain a fusion gene amplification product; the 5' end of the random primer is connected to a first universal primer (read-1) sequence; the 5' end of the specific primer is connected to a second universal primer (read-2) sequence, and the second universal primer is also modified with biotin; (3) secondary PCR amplification: using streptavidin magnetic beads to purify the product, and the purified product is subjected to a second PCR amplification CR reaction. In order to sequence the amplified product using the Illumina sequencing platform, the upstream primer used in the secondary PCR was P5+i5+read1 (5' end to 3' end, where P5 is the upstream sequencing primer adapted to the Illumina sequencing platform, and i5 is the corresponding upstream label sequence); the downstream primer was P7+i7+read2 (5' end to 3' end, where P7 is the downstream sequencing primer adapted to the Illumina sequencing platform, and i7 is the corresponding downstream label sequence). Finally, the target region library was obtained; (4) Library quality control and sequencing.

[0184] The optional nucleotide sequence of the upstream primer P5+i5+read1 includes 5'-(P5)AATGATACGGCGACCACCGAGAT CTACAC(i5)NNNNNNNN(read1)TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3'(SEQ ID No: 39).

[0185] The optional nucleotide sequence of the downstream primer P7+i7+read2 includes 5′-(P7)CAAGCAGAAGACGGCATACGAGAT(i7)NNNNNNNN(read2)GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3′ (SEQ ID No: 40).

[0186] In actual clinical samples, the mRNA quality of FFPE samples (Formalin-fixed paraffin-embedding, tissue samples) is not high and is severely fragmented; the mRNA quality of fresh tissues and CTCs (circulating tumor cells) is good and has a complete Poly A tail. The possible forms of mRNA that may exist in different samples are as follows: Figure 1 When the enrichment primers or detection primers are used to perform the first PCR amplification on clinical samples, the following reactions may occur: Figure 2 As shown, the specific primer is the specific primer described in the present disclosure.

[0187] The type of amplification product obtained, such as Figure 3 As shown, where:

[0188] 1. Product 1 is the product of random primers. The product is not biotinylated and can be purified and filtered out by streptavidin magnetic beads;

[0189] 2. Product 2 is the target product;

[0190] 3. Product 3 is a wild-type product, and the amplification of most wild-type products can be blocked by Blocker to enrich the generation of the target product;

[0191] 4. Product 4 is the product of biotinylated specific primers and random primers, and the product does not pass through the fusion mutation breakpoint. The generation of such products can be reduced by adjusting the distance between the specific primer and the fusion mutation breakpoint and the competitive amplification effect of the Blocker.

[0192] It should be noted that the content of wild-type mRNA in mRNA derived from some clinical tissue samples is very low, that is, the content of product 3 in the product obtained by the first PCR is low, and at the same time, the fragment of the first fusion gene targeted by the specific primer provided by the present disclosure is 4 to 79 nt away from the breakpoint, which can effectively reduce the content of the fusion gene that does not contain the breakpoint in the amplified product. Therefore, for mRNA from such sources, it is not necessary to use a blocker during the first PCR amplification process.

[0193] Further, the fusion gene product containing the breakpoint obtained by the first PCR was subjected to a second PCR using sequencing primers. The reaction process is as follows: Figure 4 As shown, the final product can be directly used for gene sequencing using the Illumina sequencing platform. The overall technical route is as follows Figure 5 shown.

[0194] When the total RNA contains splicing isoforms obtained by alternative splicing of pre-mRNA, the enrichment and detection method can realize the detection of the splicing isoforms.

[0195] In conjunction with the accompanying drawings, some embodiments of the present disclosure are described in detail below. In the absence of conflict, the following embodiments and features in the embodiments can be combined with each other.

[0196] The cell lines or plasmid information used in the following examples are as follows:

[0197] Cell line (or plasmid) name Where to buy Part Number Plasmid SEQ ID NCI-H2228 Zhejiang Meisen Cell Technology Co., Ltd. CTCC-001-0340 - SW780 CyBio icell-h278 - TPC-1 CyBio icell-h309 - HCC78 Zhejiang Meisen Cell Technology CTCC-001-0872 - MDA MB 175VII Wuhan Prosai Biotech CL-0381B - KG-1a CyBio icell-h308 - Plasmid ABM28599-6 Shanghai Bioengineering Synthetic plasmid SEQ ID No: 41 Plasmid ABM28599-7 Shanghai Bioengineering Synthetic plasmid SEQ ID No: 42 Plasmid ABM28599-8 Shanghai Bioengineering Synthetic plasmid SEQ ID No: 43 KM12-SM Zhejiang Meisen Cell Technology CTCC-001-0315 - Plasmid ABM28599-1 Shanghai Bioengineering Synthetic plasmid SEQ ID No: 44 Plasmid ABM28599-2 Shanghai Bioengineering Synthetic plasmid SEQ ID No: 45 Plasmid ABM28599-3 Shanghai Bioengineering Synthetic plasmid SEQ ID No: 46 Plasmid ABM28599-4 Shanghai Bioengineering Synthetic plasmid SEQ ID No: 47 Plasmid ABM28599-5 Shanghai Bioengineering Synthetic plasmid SEQ ID No: 48 Hs746T ATCC HTB-135 -

[0198] Example 1 Detection of fusion gene

[0199] This example describes an exemplary method for detecting fusion genes. Taking different starting amounts of fusion cell line templates as examples, the accuracy of the detection method provided by the present disclosure is verified.

[0200] (1) RNA extraction and reverse transcription

[0201] RNA extraction steps: RNA samples were extracted using OMEGA Total RNA Kit I.

[0202] RNA reverse transcription step: add 1 μg RNA sample and random primer 6N, use HiScript III 1st Strand cDNA Synthesis Kit (+gDNA wiper) of Novozymes to reverse transcribe the sample into cDNA for later use.

[0203] (2) PCR-1 reaction steps

[0204] Prepare the primer extension master mix by mixing 5 μL cDNA, 5 μL PCR buffer (4×VAHTS Multi-PCR Mix), 8 μL nuclease-free water, 1 μL random primers (final reaction concentration 2.5 μM) and 1 μL biotin-labeled specific primers (final reaction concentration 2.4 μM). The reaction procedure is as follows:

[0205]

[0206] After the PCR-1 reaction, the extension products were collected and stained with Beaver Bio's streptavidin magnetic beads (BeaverBeads TM Streptavidin, 300 nm) was used to purify the extension product to obtain biotinylated nucleic acid bound to streptavidin magnetic beads.

[0207] The random primer contains a read1 sequence at the 5' end. The selected length of the random primer can be 6 to 30 nt, or a mixture of random primers of different nt lengths. This embodiment uses a 16 nt random primer; the specific primer contains a sequence of a known fusion site, and contains a read2 sequence at the 5' end, and is labeled with biotin. The specific primer can be a sequence or multiple sequences for a single site, or a sequence or a combination of multiple sequences for a single site under multi-site detection. The design principle of read-1 and read-2 is 16 to 30 nt, and this solution selects 23 nt.

[0208] Exemplarily, the specific primers used in the present disclosure are shown in the following table: wherein the italic fragments are read-2 sequences, and the normal fragments are specific primer sequences.

[0209]

[0210]

[0211]

[0212]

[0213]

[0214] Note: (fusion site exonA-RP / FP) indicates the position of the fusion breakpoint detected by the primer, wherein the fusion site exonA-RP indicates that the breakpoint is between exon A-1 and exon A; exonA-FP indicates that the breakpoint is between exon A and exon A+1; A is a positive integer.

[0215] “*” indicates that the base on the left side of “*” has a thiolation modification, “+” indicates that the base on the left side of “+” has a locked nucleic acid modification, and “ / 3ddC / ” indicates a dideoxyribonucleotide modification.

[0216] Specifically, the PCR-1 reaction step further comprises an internal reference primer, which may be one or more internal reference primers; more specifically, the internal reference primer is a primer combination consisting of multiple internal reference primers. Specifically, the internal reference primer is used at a concentration selected from 50 to 200 nM. In some specific embodiments, the internal reference primer combination used is an internal reference primer combination consisting of N029, N030, N174, N064, and N065.

[0217] (3) PCR-2 amplification step

[0218] Prepare the sequencing product by mixing 23 μL of nuclease-free water, 25 μL of PCR reaction buffer (VAHTS HiFi Universal Amplification Mix), the magnetic beads bound to biotinylated nucleic acid obtained in step (2), 1 μL of the first upstream primer and 1 μL of the first downstream primer. The reaction procedure is as follows:

[0219]

[0220] After the PCR-2 reaction, the PCR reaction products were collected and eluted with nuclease-free water and magnetic beads ( The purified product was purified by DNA Selection Beads and the concentration of the product was quantified using Qubit.

[0221] The first upstream primer comprises a sequence that hybridizes with the read1 base sequence and a first sequencing adapter sequence; the first downstream primer comprises a sequence that hybridizes with the read2 base sequence and a second sequencing adapter sequence; the number of base overlaps between the first upstream primer and the read-1 sequence is 16 to 30, preferably 23; the number of base overlaps between the first downstream primer and the read-2 sequence is 16 to 30, preferably 23.

[0222] (4) Sequencing

[0223] Sequencing was performed using the Illumina sequencing system according to standard protocols.

[0224] (5) Data analysis

[0225] S1: Perform targeted sequencing on the library samples to obtain the original fastq files;

[0226] S2: Quality control of the original fastq file, removal of adapter sequences, removal of low-quality data, and removal of too short reads (Q30>80%); S3: Read the number of target sequences (specific primers and target sequences) under 1G data volume (if the number of internal reference primer reads is greater than 200, the library is considered to be successfully built, and if the number of target sequence reads is greater than 200, the fusion is considered to be expressed); specifically, the target sequence is combined with sequence alignment, and the target sequence contains at least 10nt bases on both sides of the template fusion gene mutation breakpoint.

[0227] Example 2 Experimental study on the distance between specific primer and breakpoint

[0228] NCI-H2228 cell line cDNA was used as template, and the cDNA information is shown in the following table:

[0229] Cell line (or plasmid) name Mutation type NCI-H2228 EML4-ALK.E6bA20.COSF411

[0230]

[0231] N143, N144, N032, N146, N092, N148, and N149 were used as specific primers, and N029, N030, N174, N064, and N065 were used as internal reference primer sets. Experimental detection was performed according to steps 1 to 5 in Example 1. The detection results are shown in the table above. The results show that N032 has the best effect in detecting EML4-ALK.E6aA20.COSF411.

[0232]

[0233] N143, N144 and N032 are specific primer combination 1, characterized by the closest distance to the breakpoint, N143, N032, N092 and N148 are specific primer group 2, characterized by the best detection performance of a single primer, and N143, N144, N032, N146, N092, N148 and N149 are specific primer combination 3, characterized by including all specific primers. The above primer combinations are experimentally tested according to steps 1 to 5 in Example 1, and the test results are shown in the table above. The results show that the performance of using the specific primer combination with the best detection performance is better than other combinations, and is also better than the performance of using a single primer.

[0234] Example 3 Validation of detection systems based on other fusion sites

[0235] N143, N032, N092, N148, N102, N209, N213, N214, N078, N184, N185, N187, N188, N215, N216, N217, N181, N182, N276, N277, N204, N205, N104, N105, N180, N266, N267, NTRK2, N108, N273, N2 74, N271, and N110 are detection panels, and N029, N030, N174, N064, and N056 are used as internal reference primer sets. According to steps 1 to 5 in Example 1, the samples to be tested are respectively detected for the presence of ALK, RET, BRAF, NRG1, FGFR1, FGFR2, FGFR3, NTRK1, NTRK2, NTRK3, and ROS1-related fusion genes and their read numbers.

[0236] The cell line cDNA or plasmid DNA with different mutation information was used as a mutant template and the cDNA of WBC was used as a wild template to be combined as a detection template, and the detection template was detected using a panel according to the steps of Example 1. The detection results are as follows:

[0237] Cell line (or plasmid) name Fusion Type Target sequence (statistical sequence of reads) reads NCI-H2228 ALK fusion EML4-ALK.E6aA20.COSF411 11445 NCI-H2228 ALK fusion EML4-ALK.E6bA20.COSF474 2160 SW780 RET fusion CCDC6-RET.C1R12.COSF1271 12,917 TPC-1 RET fusion CCDC6-RET.C1R12.COSF1271 5,006 HCC78 ROS1 fusion SLC34A2-ROS1.S4R32.COSF1196 3,004 MDA MB 175VII NRG1 fusion TENM4-NRG1.T12N2 41,678 KG-1a FGFR1 fusions FGFR1OP2-FGFR1.F4F10 11,373 Plasmid ABM28599-6 FGFR2 fusions FGFR2-ATE1.F2A9 7,466 SW780 FGFR3 fusions FGFR3-BAIAP2L1.F17B2 6,757 Plasmid ABM28599-7 BRAF fusion BRAF-SLC26A4.B3S6 10,350 Plasmid ABM28599-8 BRAF fusion MKRN1-BRAF.M4B11 3,909 KM12-SM NTRK1 fusions TPM3-NTRK1.T7N10.COSF1329 11,315 Plasmid ABM28599-1 NTRK2 fusions NACC2-NTRK2.N4N13.COSF1449 75,439 Plasmid ABM28599-2 NTRK2 fusions QKI-NTRK2.Q6N16.COSF1447 18,942 Plasmid ABM28599-3 NTRK3 fusions NTRK3-ETV6.N14E6.COSF825 65,637 Plasmid ABM28599-4 NTRK3 fusions ETV6-NTRK3.E4N15.COSF823 81,786 Plasmid ABM28599-5 NTRK3 fusions ETV6-NTRK3.E5N15.COSF571 18,202

[0238] Experimental conclusion:

[0239] For the above different samples, the Panel of this embodiment can accurately detect the corresponding fusion gene target sequence, and the number of reads of the target sequence can meet the library construction requirements for sequencing to determine the fusion sequence. Therefore, the method provided in this solution can be based on the specific primers designed according to the known fusion gene site, in combination with random primers, to achieve the enrichment and sequencing library construction of the fusion gene, and cover the known fusion genes and the unknown fusion genes of "unknown gene-known fusion gene site".

[0240] Example 4 Experiment of random primer length

[0241] Based on N143 (ALK exon20-RP), N144 (ALK exon20-RP), N145 (ALK exon20-RP), N032 (ALK exon20-RP), N146 (ALK exon20-RP), N092 (ALK exon20-RP), N147 (ALK exon20-RP), N148 (ALK exon20-RP), and N149 (ALK exon20-RP) as specific primer sets, the detection templates are shown in the table below.

[0242]

[0243] The experiment was carried out according to the detection method of steps 1-5 in Example 1, and random primers of different lengths were selected for detection. The read numbers of EML4-ALK.E6A20.COSF411 and EML4-ALK.E6A20.COSF474 under different random primer lengths were detected. The results are shown in the following table and Figure 6 As shown, it can be seen that when the length of the random primer is 16-20 nt, more reads are obtained.

[0244] Random primer length 6N 8N 16N 20N 25N 30N EML4-ALK.E6A20.COSF411 1,270 1,907 3,710 7,889 4,698 271 EML4-ALK.E6A20.COSF474 5,534 13,867 37,026 33,588 10,100 1,453

[0245] Example 5 Detection Limit

[0246] (1) Cell line validation

[0247] 1μg total RNA of cell lines H2228, Hs746T, TPC-1 and HCC78 was reverse transcribed using a reverse transcription kit. The reverse transcription system was 20μl, and the default cDNA sample after reverse transcription was 50ng / μl. The cDNA of the above four cell lines was mixed in equal volumes to prepare the positive quality control FR-02, with a concentration of 50ng / μl. FR-02 was quantified by digital PCR to determine the copy number concentration of each fusion positive point in the sample. The results are as follows:

[0248] Preparation of positive control: FR-02 (cDNA-concentration: 50ng / μl)

[0249]

[0250] Take 10 μL of FR-02 sample and dilute it 10 times and 100 times with enzyme-free water to obtain FR-02-10X and FR-02-100X. After digital PCR quantification, the copy number concentration of each fusion positive point in FR-02-10X and FR-02-100X is as follows:

[0251]

[0252]

[0253] Take 5 μL of FR-02-100X sample and mix it with 5 μL of HEK293 cell line cNDA sample with a concentration of 19.5 ng / μL to obtain sample FR-03. After digital PCR quantification, the copy number concentration of each fusion positive point in FR-03 is as follows:

[0254]

[0255] FR-02-10X (2 μL), FR-02-100X (2 μL) and FR-03 (1 μL) were used as starting templates, N143 (, N032, N092, N148, N102, N265, N213, N214, N316, N078, were used as detection panels, and N029, N030, N174, N064, N056 were used as internal reference primer sets. According to steps 1 to 5 of Example 1, ALK, RET, MET, and ROS1-related fusion genes and their reads numbers in the test samples were detected, respectively. The results are as follows:

[0256]

[0257]

[0258] As can be seen from the above table, in the three groups of tests FR-02-10X, FR-02-100X, and FR-03, the detection method provided by the present disclosure can detect fusion genes related to ALK, RET, MET, and ROS1. In the FR-02-100X test with a sample load of 1ng, it can support the detection of fusion-positive mutations as low as 50 total copies; in the FR-03 test with a sample load of 10ng, it can support the detection of fusion-positive mutations as low as 12 total copies. Therefore, the technical solution provided by the present disclosure can realize the enrichment and detection method of unknown fusion genes with low starting amount and low sample load.

[0259] (2) Validation of clinical FFPE samples

[0260] This embodiment uses the clinical FFPE samples preserved by the applicant as the test samples. The samples have been confirmed as EML4-ALK fusion cases using the Feishuo 10 gene lung cancer mutation detection kit. At the same time, the H2228 cell line is used as a control. The primer set and reaction system of Example 4 are used to detect the number of reads of EML4-ALK.E6A20.COSF411 and EML4-ALK.E6A20.COSF474 in the two samples, respectively.

[0261] The qsep (high performance capillary electrophoresis) test data of FFPE samples and H2228 cell lines are shown in Figure 2. Figure 7 and Figure 8 As shown, the RNA length of the FFPE sample is distributed in multiple lengths, while the RNA length of the H2228 cell sample is mainly distributed around 2k and between 4k and 6k. The results of fusion gene detection of FFPE samples and H2228 cell lines are shown in the following table:

[0262] sample FFPE samples H2228 Sample amount (ng) 10 10 ALK-ex20-N143-EML4-ALK.E6A20.COSF411 53,092 20,794 ALK-ex20-N143-EML4-ALK.E6A20.COSF474 33,452 11,992

[0263] It can be seen that based on the detection method of this scheme, when the low-quality FFPE sample is used as the detection sample, the number of reads of EML4-ALK.E6A20.COSF411 is 53092, and the number of reads of EML4-ALK.E6A20.COSF474 is 33452, which is higher than the number of reads of the H2228 cell sample of the high-quality RNA sample, indicating that the fusion gene enrichment method and the detection method provided by the present invention can be applied to high-quality RNA samples, and can also be applied to low-quality RNA samples.

[0264] Example 6 Detection system using Blocker

[0265] Using Hs746T-cD as the MET 14 exon skipping mutant template, HCC78-cD as the MET 14 exon skipping wild-type template, N120 as the specific primer, N029, N30, N174, and N064 as internal reference primers, and N099 as the MET14 exon skipping wild-type blocker, experimental groups 1 to 4 were set as shown in the following table, and the number of reads containing the MET13 exon segment and the number of reads containing the MET14 exon skipping mutant gene in experimental groups 1 to 4 were detected according to steps 1 to 5 in Example 1.

[0266] Experimental groups 1 to 4

[0267]

[0268]

[0269] The experimental results are shown in the following table:

[0270]

[0271] From the experimental results, it can be seen that the use of MET Blocker inhibits the amplification of MET wild-type in wild-type samples, and basically does not affect the amplification of MET14 exon skipping in mutant samples. Therefore, it can be seen that adding blocker probes to the fusion gene enrichment and detection method provided by the present invention can increase the concentration of fusion genes in samples after library construction and improve enrichment and detection efficiency.

[0272] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present disclosure, rather than to limit them. Although the present disclosure has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present disclosure.

Claims

1. A method for enriching a fusion gene or splicing isoform, comprising amplifying the fusion gene using random primers and a specific primer set targeting a first fusion gene, wherein the specific primer carries a modification group for purification, and after the amplification is completed, recovering the amplification product carrying the modification group.

2. The enrichment method according to claim 1, wherein: The modifying group includes biotin.

3. The enrichment method according to claim 1, wherein: The random primers are 6 to 30 nt in length, preferably 8 to 25 nt, and more preferably 16 to 20 nt in length; the distance between the target fragment of the specific primer in the first fusion gene and the fusion breakpoint is 1 to 100 nt, preferably 4 to 79 nt, further preferably 10 to 79 nt, and more preferably 10 to 78 nt.

4. The enrichment method according to any one of claims 1 to 3, wherein: The first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1.

5. The enrichment method according to claim 4, wherein: The breakpoint of the ALK gene is optionally located at the junction of exon 19 and exon 20; The breakpoint of the ROS1 gene is optionally located at the junction of exon 31 and exon 32, at the junction of exon 32 and exon 33, or at the junction of exon 33 and exon 34; The breakpoint of the RET gene is optionally located at the junction of exon 11 and exon 12; The breakpoint of the NRG1 gene is optionally located at the junction of exon 1 and exon 2; The breakpoint of the BRAF gene is optionally located at the junction of exon 3 and exon 4, or at the junction of exon 10 and exon 11; The FGFR gene includes the FGFR1 gene located on chromosome 8, the FGFR2 gene located on chromosome 10, or the FGFR3 gene located on chromosome 4. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the FGFR1 gene, at the junction of exon 2 and exon 3 of the FGFR2 gene, or at the junction of exon 17 and exon 18 of the FGFR3 gene; The NTRK gene includes the NTRK1 gene located on chromosome 1, the NTRK2 gene located on chromosome 9, or the NTRK3 gene located on chromosome 15. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the NTRK1 gene, at the junction of exon 13 and exon 14 of the NTRK2 gene, at the junction of exon 14 and exon 15 of the NTRK3 gene, or at the junction of exon 19 and exon 20 of the NTRK3 gene; The breakpoint of the MET gene is optionally located at the junction of exon 13 and exon 14.

6. The enrichment method according to claim 5, wherein: The specific primer of the ALK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 1 to 9, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the ROS1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 10 to 11, 49 to 51, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The RET gene-specific primer has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 12 to 14, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer for the BRAF gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 15 to 18, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the NRG1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 19 to 21, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the FGFR gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 22 to 27, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the NTRK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 28 to 38, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer for the MET gene has a nucleotide sequence that is 80% to 100% identical to the nucleotide sequence shown in any one of SEQ ID Nos: 52 to 53, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%.

7. The enrichment method according to any one of claims 1 to 6, wherein: A blocker probe for blocking the amplification of the wild-type first fusion gene is also added to the amplification reaction system.

8. The enrichment method according to any one of claims 1 to 7, wherein: The recovery method comprises adding a purification reagent for capturing the modification group to the amplification product; Optionally, the purification reagent comprises magnetic beads, to which modified group binding molecules are attached.

9. Primers for enrichment of fusion genes or splice isoforms, comprising random primers and specific primers targeting the first fusion gene, wherein the specific primers carry modification groups for purification, and the purification modification is used to separate the enriched products of the random primers and the specific primers as primer pairs.

10. The enrichment primer according to claim 9, wherein The distance between the target fragment of the specific primer in the first fusion gene and the fusion breakpoint is 1 to 100 nt, preferably 4 to 79 nt, more preferably 10 to 79 nt, and more preferably 10 to 78 nt; the length of the random primer is 6 to 30 nt, preferably 8 to 25 nt, and more preferably 16 to 20 nt; Preferably, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1; The breakpoint of the ALK gene is optionally located at the junction of exon 19 and exon 20; The breakpoint of the ROS1 gene is optionally located at the junction of exon 31 and exon 32, at the junction of exon 32 and exon 33, or at the junction of exon 33 and exon 34; The breakpoint of the RET gene is optionally located at the junction of exon 11 and exon 12; The breakpoint of the NRG1 gene is optionally located at the junction of exon 1 and exon 2; The breakpoint of the BRAF gene is optionally located at the junction of exon 3 and exon 4, or at the junction of exon 10 and exon 11; The FGFR gene includes the FGFR1 gene located on chromosome 8, the FGFR2 gene located on chromosome 10, or the FGFR3 gene located on chromosome 4. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the FGFR1 gene, at the junction of exon 2 and exon 3 of the FGFR2 gene, or at the junction of exon 17 and exon 18 of the FGFR3 gene; The NTRK gene includes the NTRK1 gene located on chromosome 1, the NTRK2 gene located on chromosome 9, or the NTRK3 gene located on chromosome 15. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the NTRK1 gene, at the junction of exon 13 and exon 14 of the NTRK2 gene, at the junction of exon 14 and exon 15 of the NTRK3 gene, or at the junction of exon 19 and exon 20 of the NTRK3 gene; The breakpoint of the MET gene is optionally located at the junction of exon 13 and exon 14.

11. The enrichment primer according to claim 10, wherein The specific primer of the ALK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 1 to 9, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the ROS1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 10 to 11, 49 to 51, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The RET gene-specific primer has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 12 to 14, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer for the BRAF gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 15 to 18, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the NRG1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 19 to 21, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the FGFR gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 22 to 27, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the NTRK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 28 to 38, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer for the MET gene has a nucleotide sequence that is 80% to 100% identical to the nucleotide sequence shown in any one of SEQ ID Nos: 52 to 53, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%.

12. The enrichment primer according to any one of claims 9 to 11, wherein The modifying group includes biotin. 13 . The enrichment primer according to any one of claims 9 to 12, further comprising a blocker probe for blocking amplification of the wild-type first fusion gene.

14. A composition for enriching fusion genes or splice isoforms, comprising the enrichment primer according to any one of claims 9 to 13 and a purification reagent for capturing a modification group; Optionally, the purification reagent comprises magnetic beads, to which modified group binding molecules are attached.

15. Use of the enrichment primer according to any one of claims 9 to 13 or the enrichment composition according to claim 14 in the preparation of a reagent or kit for enriching gene fusion or splicing isoforms.

16. A fusion gene or splice isoform enrichment reagent or kit, comprising the enrichment primer according to any one of claims 9 to 13 or the enrichment composition according to claim 14; preferably, it also comprises a sampling tool and / or other consumables; Optionally, the sample collected by the sampling tool includes tumor cells and / or body fluids; Preferably, the body fluid comprises blood, saliva, urine, pleural effusion or peritoneal effusion.

17. A method for detecting a fusion gene or splice isoform for non-diagnostic purposes, comprising adding a detection primer pair to a sample containing the fusion gene to amplify the fusion gene, separating the fusion gene enrichment product from the amplification product using a purification reagent after amplification, and then sequencing the fusion gene enrichment product using a sequencing primer pair; The detection primer pair includes a random primer and a specific primer targeting the first fusion gene, the random primer is connected to the first universal primer, the specific primer is connected to the second universal primer with a modification group for purification, and the purification modification is used to separate the enriched product of the random primer and the specific primer as the primer pair; The sequencing primer pair includes a first sequencing primer and a second sequencing primer, wherein the first sequencing primer contains a sequence hybridizing with a first universal primer and a first sequencing primer adapter sequence, and the second sequencing primer contains a sequence hybridizing with a second universal primer and a second sequencing primer adapter sequence.

18. The detection method according to claim 17, wherein: The modifying group includes biotin.

19. The detection method according to claim 17 or 18, wherein: A blocker probe for blocking the amplification of the wild-type first fusion gene is also added to the fusion gene amplification reaction system.

20. The detection method according to any one of claims 17 to 19, wherein: The purification reagent comprises magnetic beads, and the magnetic beads are connected with modification group binding molecules.

21. The detection method according to any one of claims 17 to 20, wherein: The distance between the target fragment of the specific primer in the first fusion gene and the fusion breakpoint is 1 to 100 nt, preferably 4 to 79 nt, more preferably 10 to 79 nt, and more preferably 10 to 78 nt; the length of the random primer is 6 to 30 nt, preferably 8 to 25 nt, and more preferably 16 to 20 nt; Preferably, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1; The breakpoint of the ALK gene is optionally located at the junction of exon 19 and exon 20; The breakpoint of the ROS1 gene is optionally located at the junction of exon 31 and exon 32, at the junction of exon 32 and exon 33, or at the junction of exon 33 and exon 34; The breakpoint of the RET gene is optionally located at the junction of exon 11 and exon 12; The breakpoint of the NRG1 gene is optionally located at the junction of exon 1 and exon 2; The breakpoint of the BRAF gene is optionally located at the junction of exon 3 and exon 4, or at the junction of exon 10 and exon 11; The FGFR gene includes the FGFR1 gene located on chromosome 8, the FGFR2 gene located on chromosome 10, or the FGFR3 gene located on chromosome 4. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the FGFR1 gene, at the junction of exon 2 and exon 3 of the FGFR2 gene, or at the junction of exon 17 and exon 18 of the FGFR3 gene; The NTRK gene includes the NTRK1 gene located on chromosome 1, the NTRK2 gene located on chromosome 9, or the NTRK3 gene located on chromosome 15. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the NTRK1 gene, at the junction of exon 13 and exon 14 of the NTRK2 gene, at the junction of exon 14 and exon 15 of the NTRK3 gene, or at the junction of exon 19 and exon 20 of the NTRK3 gene; The breakpoint of the MET gene is optionally located at the junction of exon 13 and exon 14.

22. The detection method according to claim 21, wherein: The specific primer of the ALK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 1 to 9, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the ROS1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 10 to 11, 49 to 51, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The RET gene-specific primer has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 12 to 14, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer for the BRAF gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 15 to 18, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the NRG1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 19 to 21, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the FGFR gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 22 to 27, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the NTRK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 28 to 38, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer for the MET gene has a nucleotide sequence that is 80% to 100% identical to the nucleotide sequence shown in any one of SEQ ID Nos: 52 to 53, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%.

23. The detection method according to any one of claims 17 to 22, wherein: The sample includes tumor cells and / or body fluid; Preferably, the body fluid comprises blood, saliva, urine, pleural effusion or peritoneal effusion.

24. Detection primers for fusion genes or splicing isomers, comprising a random primer and a specific primer targeting a first fusion gene, wherein the random primer is connected to a first universal primer, and the specific primer is connected to a second universal primer with a modification group for purification, wherein the purification modification is used to separate the enriched product of the random primer and the specific primer as a primer pair.

25. The detection primer according to claim 24, wherein The modifying group includes biotin.

26. The detection primer according to claim 24 or 25, further comprising a blocker probe for blocking amplification of the wild-type first fusion gene.

27. The detection primer according to any one of claims 24 to 26, wherein The distance between the target fragment of the specific primer in the first fusion gene and the fusion breakpoint is 1 to 100 nt, preferably 4 to 79 nt, more preferably 10 to 79 nt, and more preferably 10 to 78 nt; the length of the random primer is 6 to 30 nt, preferably 8 to 25 nt, and more preferably 16 to 20 nt; Preferably, the first fusion gene includes ALK, ROS1, RET, BRAF, NRG1, FGFR, NTRK, EGFR, ERBB2, MET, ESR1, AML1, BCR, RARα, E2A, TAL1, DEK, AML1, PDGFRA, KMT2A, NPM, NUP98, SET, TEL, TLS, CBFB, VMP1, CLDN18, ARHGAP, CD44, SLC1A2, TSC2, RNF216, AGTARP, TACC2, PPAPDC1A, RAS, RPS6KB1, MAN2A1, FER, DNAJB1, ATP1B1, FIG, PRKACA, PRKACB, IRF2BP2, SEC16A, NOTCH1 or RUNX1; The breakpoint of the ALK gene is optionally located at the junction of exon 19 and exon 20; Optionally, the breakpoint of the ROS1 gene is optionally located at the junction of exon 31 and exon 32, at the junction of exon 32 and exon 33, or at the junction of exon 33 and exon 34; The breakpoint of the RET gene is optionally located at the junction of exon 11 and exon 12; The breakpoint of the NRG1 gene is optionally located at the junction of exon 1 and exon 2; The breakpoint of the BRAF gene is optionally located at the junction of exon 3 and exon 4, or at the junction of exon 10 and exon 11; The FGFR gene includes the FGFR1 gene located on chromosome 8, the FGFR2 gene located on chromosome 10, or the FGFR3 gene located on chromosome 4. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the FGFR1 gene, at the junction of exon 2 and exon 3 of the FGFR2 gene, or at the junction of exon 17 and exon 18 of the FGFR3 gene; The NTRK gene includes the NTRK1 gene located on chromosome 1, the NTRK2 gene located on chromosome 9, or the NTRK3 gene located on chromosome 15. Optionally, the breakpoint is located at the junction of exon 9 and exon 10 of the NTRK1 gene, at the junction of exon 13 and exon 14 of the NTRK2 gene, at the junction of exon 14 and exon 15 of the NTRK3 gene, or at the junction of exon 19 and exon 20 of the NTRK3 gene; The breakpoint of the MET gene is optionally located at the junction of exon 13 and exon 14.

28. The detection primer according to claim 27, wherein The specific primer of the ALK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 1 to 9, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the ROS1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 10 to 11, 49 to 51, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The RET gene-specific primer has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 12 to 14, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer for the BRAF gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 15 to 18, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the NRG1 gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 19 to 21, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the FGFR gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 22 to 27, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer of the NTRK gene has a nucleotide sequence with a nucleotide sequence identity of 80% to 100% with the nucleotide sequence shown in any one of SEQ ID Nos: 28 to 38, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%; The specific primer for the MET gene has a nucleotide sequence that is 80% to 100% identical to the nucleotide sequence shown in any one of SEQ ID Nos: 52 to 53, and the identity is preferably 80%, 82%, 84%, 86%, 88%, 90%, 92%, 94%, 96%, 98% or 100%.

29. A composition for detecting a fusion gene or a splice isoform, comprising the detection primer according to any one of claims 24 to 28, a purification reagent for capturing a modification group, and a sequencing primer pair suitable for a sequencing platform; The sequencing primer pair comprises a first sequencing primer and a second sequencing primer, wherein the first sequencing primer comprises a sequence hybridizing with a first universal primer and a first sequencing primer adapter sequence, and the second sequencing primer comprises a sequence hybridizing with a second universal primer and a second sequencing primer adapter sequence; Optionally, the purification reagent comprises magnetic beads, to which modified group binding molecules are attached.

30. Use of the detection primer according to any one of claims 24 to 28 or the detection composition according to claim 29 in the preparation of a detection reagent or kit for gene fusion or splicing isoforms.

31. A detection reagent or kit for a fusion gene or a splicing isoform, comprising the detection primer according to any one of claims 24 to 28 or the detection composition according to claim 29; preferably, further comprising a sampling tool and / or other consumables; Optionally, the sample collected by the sampling tool includes tumor cells and / or body fluids; Preferably, the body fluid comprises blood, saliva, urine, pleural effusion or peritoneal effusion.

Images