Application of receptor helper protein 6 and inhibitor thereof in preparation of medicine for treating oral squamous cell carcinoma

Abstract

The invention discloses a receptor helper protein 6 and application of an inhibitor thereof in preparation of a medicine for treating oral squamous cell carcinoma. The invention discloses a receptor helper protein 6 as a novel ferroptosis inhibiting factor in OSCC cells, which is a key protein in a ferroptosis signal pathway and can be used as a drug target for overcoming the progress of oral squamous cell carcinoma. The knock-down of the REEP6 significantly inhibits the cell reproduction rate in the OSCC cell line, significantly promotes DNA damage in the OSCC cell line and significantly inhibits migration and invasion of the OSCC cell line, so that the inhibitor of the targeted receptor helper protein 6 can be applied as a drug for treating oral squamous cell carcinoma. The invention provides a new thought for diagnosing and preparing medicines for treating oral squamous cell carcinoma.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine, and specifically relates to the application of receptor accessory protein 6 and its inhibitor in the preparation of drugs for treating oral squamous cell carcinoma. Background Art

[0002] Oral squamous cell carcinoma (OSCC) is the most common malignant tumor in the oral and maxillary regions, mainly occurring in the tongue, floor of mouth, gums, buccal wall, and palate. Currently, the main treatment for patients with early oral cancer is surgical resection combined with radiotherapy and chemotherapy. Nevertheless, due to the high recurrence rate and high metastasis of OSCC, about 20%-40% of patients still have local recurrence, occult lymph node metastasis, and poor prognosis after surgery. Despite various methods to improve the quality of life of oral cancer patients, the overall 5-year survival rate of oral cancer patients has not improved significantly, hovering around 50% in recent years. Metastasis is the main cause of death in cancer patients. However, the key causes of OSCC and its molecular mechanisms remain unknown. The causes and mechanisms of oral cancer recurrence and metastasis are still unclear.

[0003] Receptor expression-enhancing protein 6 (REEP6) is a conserved member of the DP1 / Yop1p superfamily of endoplasmic reticulum (ER) shaping proteins. There are six proteins in the DP1 / Yop1p family, all of which are transmembrane proteins, including REEP1, REEP2, REEP3, REEP4, REEP5, and REEP6. Initially, the REEP family was thought to play a role in enhancing the expression of cell surface olfactory receptors, G protein-coupled receptors (GPCRs), and taste receptors, while there were few studies on the biological function of REEP6 in tumors. Previous studies have shown that REEP6 plays an important role in maintaining ER homeostasis. Interestingly, an increasing number of studies have reported that ER stress is closely related to ferroptosis.

[0004] Ferroptosis is a newly discovered form of non-cell death, iron-dependent cell death in recent years. The imbalance between the generation and degradation of reactive oxygen species (ROS) in cells may lead to ferroptosis. Ferroptosis inducers act directly or indirectly on glutathione peroxidase (GPX), leading to decreased cellular antioxidant capacity, accumulation of reactive oxygen species, and ultimately oxidative cell death. Because ferroptosis plays an important role in cell death, it has been found to be associated with the occurrence and development of many diseases, especially cancer. The ferroptosis signaling pathway in tumors is generally restricted, so anti-tumor therapy that induces ferroptosis in tumor cells has broad application prospects. Therefore, the identification of key proteins in the ferroptosis signaling pathway should be crucial, as these proteins can serve as drug targets to overcome disease progression. Summary of the invention

[0005] The purpose of the present invention is to address the deficiencies of the prior art and to provide an application of receptor accessory protein 6 and an inhibitor thereof in the preparation of a drug for treating oral squamous cell carcinoma.

[0006] The first object of the present invention is to provide a product for auxiliary diagnosis of oral squamous cell carcinoma, wherein the product is used to specifically detect the expression level of the REEF6 gene or the activity of the REEF6 gene expression product; the nucleotide sequence of the REEF6 gene is shown in SEQ ID NO.1.

[0007] Preferably, the product includes a reagent for specifically detecting changes in the expression level of REEF6 gene or the activity of REEF6 gene expression products by sequencing technology, nucleic acid hybridization technology, nucleic acid amplification technology or immunoassay.

[0008] Preferably, the product comprises a PCR amplification reagent and PCR primers for detecting the expression level of the REEF6 gene, and the nucleotide sequences of the PCR primers are shown in SEQ ID NO.11 and SEQ ID NO.12.

[0009] The second object of the present invention is to provide a drug for treating oral squamous cell carcinoma, wherein the drug comprises an inhibitor of the REEF6 gene or an inhibitor of the expression product of the REEF6 gene; the nucleotide sequence of the REEF6 gene is shown in SEQ ID NO.1.

[0010] The third object of the present invention is the use of an inhibitor of the REEF6 gene or an inhibitor of the REEF6 gene expression product in the preparation of a drug for treating oral squamous cell carcinoma, wherein the inhibitor can reduce the expression level of the REEF6 gene or reduce the activity of the REEF6 gene expression product in vitro and / or in vivo; the nucleotide sequence of the REEF6 gene is shown in SEQ ID NO.1.

[0011] The present invention confirms that the inhibitor of REEF6 gene or its expression product can inhibit the growth, increase in number, migration and / or invasion of oral squamous cell carcinoma cells.

[0012] Preferably, the inhibitor is any one of the following:

[0013] a. Antisense RNA, siRNA, shRNA, miRNA, TALEN or CRISPR targeting REEF6 gene;

[0014] b. Reagents that promote DNA methylation of the REEF6 gene promoter.

[0015] Preferably, the inhibitor is shRNA, and the forward primer and reverse primer used by the shRNA to inhibit REEF6 are shown as SEQ ID NO.7 and SEQ ID NO.8, respectively.

[0016] Preferably, the target sequence of the shRNA is GCATGGCTCCCAGGCCCTGGAA.

[0017] The fourth object of the present invention is an in vitro non-therapeutic method for inhibiting the growth, number growth, migration and / or invasion of oral squamous cell carcinoma cells, wherein oral squamous cell carcinoma cells are cultured in the presence of an inhibitor of the REEF6 gene or an inhibitor of the REEF6 gene expression product to inhibit the growth, number growth, migration and / or invasion of oral squamous cell carcinoma cells; the nucleotide sequence of the REEF6 gene is shown in SEQ ID NO.1.

[0018] Beneficial effects of the present invention:

[0019] The present invention discloses receptor accessory protein 6 (REEF6) as a novel ferroptosis inhibitor in OSCC cells, which is a key protein in the ferroptosis signaling pathway and can be used as a drug target for overcoming the progression of oral squamous cell carcinoma; knockdown of REEP6 significantly inhibits the cell proliferation rate in OSCC cell lines, significantly promotes DNA damage in OSCC cell lines, and significantly inhibits the migration and invasion of OSCC cell lines, so inhibitors targeting receptor accessory protein 6 can be used as oral squamous cell carcinoma therapeutic drugs. The present invention provides a new idea for preparing drugs for treating oral squamous cell carcinoma. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 REEP6 overexpression predicts poor prognosis of OSCC; A: subcellular location of REEP6 protein in human HepG2 cells obtained using Human Protein Atlas web tool; B: immunohistochemical staining method was used to determine the REEP6 protein level in paracancerous tissues and OSCC tissues (the data came from Human Protein Atlas web tool); C: immunohistochemical staining images of REEP6 in normal tissues and OSCC tissues; D: immunohistochemical scores of REEP6 protein levels in normal tissues (N=15) and OSCC tissues (N=20), REEP6 protein was significantly overexpressed in OSCC, *** indicates that there is a significant difference in immunohistochemical scores between OSCC tissues and normal tissues at the p≤0.001 level; E, F: expression levels of REEP6 in advanced pathological stage or T stage in TCGA_OSCC cohort; GI: effect of REEP6 expression level on overall survival, disease-specific survival and progression-free interval of OSCC patients.

[0021] Figure 2 REEP6 overexpression exhibits a tumor-promoting phenotype in OSCC cell lines; A: OSCC cell lines overexpressing REEP6 were established using lentiviral infection (CAL-27 and SCC-15 cells, Cal27 or CAL-27 in the figure represent CAL-27 cells, Scc15 or SCC-15 represent SCC-15 cells, the same below); B, C: qRT-PCR and Western blotting test results of REEP6 overexpression efficiency in OSCC cell lines; D: Growth rate of OSCC cell lines after REEP6 overexpression; E : Results of colony formation assay of OSCC cell lines with or without REEP6 overexpression; F, G: Effect of REEP6 overexpression on cell cycle transition of OSCC cell lines; H: Effect of REEP6 expression level on cell migration of OSCC cell lines; I: Effect of REEP6 expression level on cell invasion ability of OSCC cell lines; *, **, ***, **** indicate that the data results of OSCC cell lines with REEP6 overexpression and NC are significantly different at P≤0.05, P≤0.01, P≤0.001, P≤0.0001, respectively.

[0022] Figure 3 The proliferation, migration and invasion results of OSCC after REEP6 knockdown; A: Western blot test results to verify the knockdown efficiency of different shRNAs targeting REEP6 in OSCC cell lines; B: REEP6 mRNA level in shRNA#3 cell line targeting REEP6; C: Effect of REEP6 knockdown on the growth rate of OSCC cell lines; D, E: Effect of REEP6 knockdown on the proliferation rate of OSCC cell lines shown by Edu and colony formation assays; F: Effect of REEP6 knockdown on DNA damage in OSCC cell lines; G, H: Effect of REEP6 knockdown on migration and invasion of OSCC cell lines; **, **** indicate that the data results of OSCC cell lines with REEP6 knockdown are significantly different from those of NC at P≤0.01 and P≤0.0001, respectively.

[0023] Figure 4The figure shows the effect of REEP6 overexpression on the progression of OSCC in vivo; A, B: the size and weight of subcutaneous transplanted tumors in nude mice 30 days later; C: the body weight of nude mice on the specified day after the corresponding cells were injected into nude mice; D: the tumor volume on the specified day after the corresponding cells were injected into nude mice, and the data represent the average tumor volume ± scanning electron microscopy; E: the expression of cell proliferation biomarkers (Ki-67 and PCNA) in transplanted tumors determined by immunohistochemistry; F: the expression levels of epidermal-mesenchymal transition biomarkers (E-cad / CDH1 and Vimentin) in transplanted tumors and corresponding cell lines determined by protein blotting experiments; G: the effect of REEP6 overexpression on EMT signaling in OSCC in vivo and in vitro; *, **, *** indicate that the data results of OSCC cell lines overexpressing REEP6 are significantly different from those of NC at P≤0.05, P≤0.01, and P≤0.001, respectively, and ns indicates that the data results of OSCC cell lines overexpressing REEP6 are not significantly different from those of NC.

[0024] Figure 5 REEP6 plays a negative role in ferroptosis in OSCC cell lines; A: Differentially expressed genes after REEP6 overexpression shown in the heat map after RNA-seq analysis; B: Downregulated genes in the heat map further analyzed by GO / KEGG analysis indicated that they were enriched in ferroptosis signals; C: GSEA analysis based on RNA-seq data showed that ferroptosis signals were significantly inactivated in REEP6-overexpressing cells; D: Gene expression correlation analysis of REEP6 with ferroptosis inhibitors (GPX4, SLC7A11, and NFE2L2) or ferroptosis drivers (ACSL4, ACSL5, HMOX1, ALOX5, and IFNG) in OSCC in the TCGA_OSCC cohort; E: Effect of REEP6 overexpression on Fe 2+ F, G: Effect of REEP6 overexpression on the production of reactive oxygen species in OSCC cell lines; *, *** indicate that the data results of OSCC cell lines overexpressing REEP6 are significantly different from those of NC at P≤0.05 and P≤0.001, respectively.

[0025] Figure 6REEP6 overexpression showed resistance to RSL3-induced ferroptosis; A, B: The effect of REEP6 overexpression on the mitochondrial morphology of OSCC cell lines was observed by electron microscopy; C, D: IC 50 values ​​of RSL3 in REEP6 overexpression or REEP6 knockdown cell lines; E: qRT-PCR detection of REEP6 mRNA expression levels in OSCC cell lines exposed to different concentrations of RSL3; F, G: Rescue experiments confirmed that REEP6 promoted OSCC progression by inhibiting ferroptosis in OSCC cell lines; *, ** indicate that the result data between different treated cell lines were significantly different at P≤0.05 and P≤0.01, respectively.

[0026] Figure 7 REEP6 overexpression inhibits ER stress-mediated ferroptosis in OSCC cell lines; A: ACSL4 mRNA expression level in OSCC cell line (SCC-15) with REEP6 overexpression; B, C: expression levels of ER stress-related biomarker genes and ferroptosis-related biomarker genes in OSCC cell lines with or without REEP6 overexpression; DF: the effect of REEP6 overexpression on the protein levels of ER stress-related biomarkers and ferroptosis-related biomarkers evaluated by western blotting, confirming that REEP6 overexpression negatively regulates ER stress signaling and ferroptosis signals in OSCC cell lines; ** indicates that the expression levels of different genes or proteins were significantly different at P≤0.01 in REEF6-overexpressing cell lines and NC cell lines.

[0027] Figure 8 DNA hypomethylation leads to REEP6 overexpression in OSCC; A: UCSC web tool confirmed the existence of a CpG island in the promoter region of REEP6 gene; B, C: Relationship between methylation level of CpG site and expression level of REEP6; D: After RNA-seq analysis, heat map showed differentially expressed genes after 5-Aza-CDR treatment; E: Effect of 5-Aza-CdR treatment on transcript abundance of REEP6 in OSCC cell lines; F, G: Expression level of REEP6 in OSCC cell lines with or without 5-Aza-CdR treatment; H: DNA methylation analysis of GSE 98807 cohort of REEP6 in OSCC, which included DNA methylation chip results of head and neck cancer and adjacent tissues; *, ** indicate that the data results between different treatments were significantly different at P≤0.05 and P≤0.01, respectively.

[0028] Fig. 9 is a working model that REEP6 overexpression drives OSCC progression. DETAILED DESCRIPTION

[0029] The following examples are provided to further illustrate the present invention, rather than to limit the present invention.

[0030] Example 1

[0031] 1. Materials and Methods

[0032] 1.1 Tissue samples and clinical analysis

[0033] All tissue samples were collected from a total of 20 OSCC patients who underwent surgical resection at Taihe Hospital between January 10, 2017 and July 15, 2020. Normal oral gingival tissue samples were collected from 15 patients who underwent mandibular third molar extraction during the same period, and informed consent was obtained from all patients. This study was approved by the Ethics Committee of Taihe Hospital, Hubei Medical College. Correlation analysis between REEP6 mRNA expression and clinical characteristics of OSCC patients was performed in the Cancer Genome Atlas (TCGA) cohort. Gene expression data and clinical information of the TCGA_OSCC cohort were downloaded from the https: / / www.cbioportal.org database.

[0034] 1.2 Immunohistochemical staining and evaluation

[0035] Primary antibody (12088-1-AP, Proteintech, Wuhan) was used to evaluate REEP6 protein levels. The expression level of REEP6 was quantified using staining intensity scores and positive cell percentage scores. Staining intensity score: 0 = no staining, 1 = weak staining, 2 = moderate staining, 3 = strong staining. Positive cell percentage score, score 0 = 0% to 5% positive cells, 1 = 6% to 25% positive cells, 2 = 26% to 50% positive cells, 3 = 51% to 75% positive cells, 4 = 76% to 100% positive cells.

[0036] 1.3 Cell transfection and establishment of cell lines

[0037] OSCC cell line and normal oral epithelial cell line HOK-8 were purchased from Shanghai Cell Bank. The cells were placed in MEK medium containing 10% fetal bovine serum (FSB) and incubated at 37°C and 5% CO 2 REEP6 overexpression and knockdown lentiviruses were purchased from Genechem, and cell transplantation was performed according to the manufacturer's protocol. Western blot and qRT-PCR analysis were used to further determine the efficiency of REEP6 overexpression or knockdown in the cell lines.

[0038] 1.4 Cell proliferation, migration, invasion and comet assays

[0039] The proliferation of OSCC cells was determined using CCK-8, colony formation, and EdU assays, the migration of OSCC cells was assessed using a cell scratch assay, and the invasion of OSCC cells was examined using a transwell invasion assay (CCK-8, colony formation, EdU, cell scratch, and transwell invasion assay methods reference: Xia L, Zhang T, Yao J, Lu K, Hu Z, Gu X, et al. Fibromodulin overexpression drives oral squamous cell carcinoma viaactivating downstream EGFR signaling. Iscience. 2023; 26(11): 108201). The comet assay was designed to determine the relative degree of DNA damage in OSCC cells. Briefly, a first layer of 1% normal melting point gel was prepared using a glass slide. The collected cells were mixed with a 0.7% low melting point gel and spread on the first layer of gel to prepare a second layer of gel. The gel was then placed in a cell lysis buffer and ruptured at 4°C for 2 hours, followed by a PBS rinse for 3 minutes. The slide was soaked in an electrophoresis buffer to unwind the helix for 30 minutes. Electrophoresis was then performed for 30 minutes. After electrophoresis, the slides were placed in a neutral buffer for 10 minutes. Finally, propyl iodine solution was added to the slides, incubated in the dark for 20 minutes, and then observed under a fluorescence microscope. The Comet Electrophoresis Kit (Biyuntian, C2041M) was used.

[0040] 1.5 RNA isolation and quantitative RT-PCR

[0041] Using One Step TB PrimeScript TM qPCR analysis was performed using RT-PCR Kit II (Takara, RR086). GAPDH was used as a reference gene (GAPDH_qF: GACATGCCGCCTGGAGAAAC, SEQ ID NO.9; GAPDH_qR: AGCCCAGGATGCCCTTTAGT, SEQ ID NO.10). Each gene was run in triplicate. The relative fold change of gene expression was calculated using the comparative ΔΔCt method. The quantitative PCR primer base sequences of other genes in this experiment are as follows (expressed as 5'-3'):

[0042] REEP6_qF: CCAAGCAAGGACGACGACACTG, SEQ ID NO.11;

[0043] REEP6_qR: AGAAAGGGAACCAGGACAGGAGTAG, SEQ ID NO.12;

[0044] DDIT3_qF: TCTCCTTCATGCGCTGCTTT, SEQ ID NO.13;

[0045] DDIT3_qR: AGAACCAGGAAACGGAAACAGA, SEQ ID NO.14;

[0046] GPR78_qF: AAAGCTAAGAAGAAGGAACTGGAAG, SEQ ID NO.15;

[0047] GPR78_qR: CAACTCATCTTTTTCTGCTGTATCC, SEQ ID NO.16;

[0048] PERK_qF: TACAAGAGGGAGAGGAACAAACGAA, SEQ ID NO.17;

[0049] PERK_qR: CCTGTGAGGATGAGGATGGAAAAG, SEQ ID NO.18;

[0050] ACSL4_qF: CATCCCTGGAGCAGATACTCT, SEQ ID NO.19;

[0051] ACSL4_qR: TCACTTAGGATTTCCCTGGTCC, SEQ ID NO.20;

[0052] ACSL5_qF:ACCCATGAAAATGTTGTTTCAA, SEQ ID NO.21;

[0053] ACSL5_qR:GAGGTGGGCTGGAAGATAGG, SEQ ID NO. 22.

[0054] 1.6 RNA sequencing

[0055] RNA-seq studies were performed in REEP6-overexpressing SCC-15 cells. Briefly, a total amount of 1.5 μg RNA per sample was used for RNA sample preparation. The entire process of library construction and sequencing was performed at Shanghai Life Gene Technology Co., Ltd. to obtain RNA-seq data.

[0056] 1.7 Mouse transplant tumor model

[0057] The study protocol was approved by the Experimental Animal Research Ethics Committee of Hubei Medical College. All animals were treated in accordance with the guidelines of the Animal Committee of Hubei Medical College. NC (Negative Control) and REEP6-overexpressing CAL-27 cells were injected into the subcutaneous tissue of female MCB / c nude mice. After 28 days, all mice were euthanized, and tumors were collected for weighing and volume measurement. Tumor volume was calculated using the following formula: Volume = length × (width) 2 / 2.

[0058] 1.8 Active oxygen detection and iron ion content

[0059] Relative reactive oxygen species production levels were determined using flow cytometry. The levels of hydrogen peroxide in OSCC cells were determined by staining cells with a 2',7'-dichlorofluorescein (DCF) probe. The intensity of DCF fluorescence is proportional to the amount of hydrogen peroxide produced in the cells. In brief, OSCC cells were incubated with DCF at 37°C for 15 minutes. Then, the cells were removed, washed and resuspended in PBS, and the DCF fluorescence was analyzed using a CycloFLEX machine (Beckman, USA). Hydrogen peroxide treatment was used as a positive control group. Relative iron ion levels were determined using PGSK combined with flow cytometry. The level of iron ions in cells was determined using the PGSK probe.

[0060] 1.9 Western blot assay

[0061] Western blotting was performed according to the literature (Li D, Xia L, Huang P, Wang Z, Guo Q, Huang C, et al. Cancer-associated fibroblast-secreted IGFBP7 promotes gastric cancer by enhancing tumor associated macrophage infiltration via FGF2 / FGFR1 / PI3K / AKTaxis. Cell death discovery. 2023; 9(1): 17.). OSCC cell lines were dissolved in RIPA buffer containing 1 mM PMSF. The protein concentrations of all samples were quantified and standardized using the BSA method. Then, the protein samples were layered and transferred to a polyvinylidene fluoride membrane, and after incubation with the primary antibody and the secondary antibody (Multi-rAb HRP-Goat Anti-Rabbit Recombinant Secondary Antibody (H+L), RGAR001, Mitaka, Wuhan, China), the final image was visualized using a Bio-Rad imaging system (USA). The primary antibodies used in this experiment are as follows: PERK (3192, Cell Signaling Technology, Danvers, MA), p-PERK (Thr 980, BS-3330R, Bioss, USA), CHOP (SC-7351, Santa Cruz, CA), GPR78 (ab21685, AbCam, Cambridge, UK), E-cad (A24874, AB clone, Wuhan, China), VIM (A19607, AB clone, Wuhan, China), TFRC (A5865, AB clone, Wuhan, China), ACSL4 (A20414, AB clone, Wuhan, China), ACSL5 (A14130, AB clone, Wuhan, China), SLC7A11 (A25219, AB clone, Wuhan, China), and GPX4 (A21440, AB clone, Wuhan, China).

[0062] 1.10 Statistical analysis

[0063] For gene expression analysis of different OSCC subtypes, P values ​​were estimated using the Mann-Whitney nonparametric test. Survival curves were calculated using the Kaplan-Meier method, and differences between curves were analyzed using the log-rank test. All remaining experiments were tested using unpaired t-tests or one-way ANOVA. For all experiments, each group was repeated at least three times and at least three times for reproducibility. All tests with P values ​​less than 0.05 were considered statistically significant.

[0064] 2. Research Results

[0065] 2.1 REEP6 overexpression predicts poor prognosis in oral cancer

[0066] To explore the biological function of REEP6 (the nucleotide sequence of its genomic DNA is shown in SEQ ID NO.1 and the amino acid sequence is shown in SEQ ID NO.2) in OSCC, we first used the Human Protein Atlas web tool to study the subcellular localization of REEP6 protein in human cells. According to the images taken with the confocal microscope, REEP6 is indeed a protein located in the endoplasmic reticulum ( Figure 1 A), which is consistent with its reported function. In the Human Protein Atlas database, based on the immunohistochemical staining (IHC) results of OSCC tissues and adjacent tissues, it was shown that REEP6 protein was highly expressed in OSCC ( Figure 1 Next, we further evaluated the expression of REEP6 in adjacent normal oral tissue samples (N=15) and OSCC samples (N=20) using immunohistochemical staining analysis ( Figure 1 C). IHC results showed that REEP6 protein was significantly overexpressed in OSCC compared with adjacent normal oral tissues ( Figure 1 D). On the other hand, we performed a clinical analysis of REEP6 in the TCGA_OSCC cohort. The results showed that REEP6 overexpression was positively correlated with advanced pathological stage and pathological T stage in OSCC patients ( Figure 1 E, F). More importantly, OSCC patients with relatively high REEP6 expression had shorter overall survival, disease-specific survival, and progression-free interval ( Figure 1 G, H, I). In conclusion, REEP6 gene may act as an oncogene in OSCC.

[0067] 2.2 REEP6 overexpression promotes OSCC cell proliferation, migration and invasion

[0068] To confirm the tumor-promoting effect of REEP6, gain-of-function and loss-of-function studies were performed to explore the effect of REEP6 on the biological behavior of OSCC cells. Figure 2 A). Western blot and qRT-PCR analysis together confirmed the successful overexpression of REEP6 in two OSCC cell lines (CAL-27, SCC-15). Figure 2 B, C). CCK-8 assay showed that REEP6 overexpression significantly increased the growth rate of CAL-27 and SCC-15 cell lines ( Figure 2 D). Colony formation assay confirmed that REEP6 overexpression significantly increased the number of OSCC cell colonies ( Figure 2 E). Since REEP6 has a significant promoting effect on OSCC cell proliferation, flow cytometry was used to further evaluate the effect of REEP6 overexpression on OSCC cell cycle phase distribution. The results showed that REEP6 overexpression promoted the transition from G1 phase to S phase and G2 / M phase in CAL-27 and SCC-15 cell lines ( Figure 2 F, G). Interestingly, cell scratch and transwell invasion assays also showed that REEP6 overexpression significantly enhanced the migration and invasion abilities of OSCC cell lines ( Figure 2 H, I).

[0069] 2.3REEP6 deficiency inhibits cell proliferation and invasion and induces DNA damage in OSCC cell lines

[0070] The lentivirus-short hairpin RNA (shRNA) system is a widely used RNA interference tool. Loss-of-function studies of REEP6 were performed in two OSCC cell lines using three different shRNAs to avoid off-target effects. Specifically, lentivirus production was customized by GeneCare, and three different shRNA targets were inserted into the vector GV298, respectively. The primer sequences used were shown in SEQ ID NO.3-SEQ ID NO.8 (Table 1). Western blotting experiments showed that shRNA #3 (target sequence: GCATGGCTCCCAGGCCCTGGAA) had the highest REEP6 knockout efficiency in OSCC cell lines ( Figure 3 A). shRNA#3 cell line targeting REEP6 was selected for loss-of-function studies. The REEP6 mRNA level in shRNA#3 cell line was greatly reduced to 30% of the original level ( Figure 3 B). Therefore, shRNA#3 cell line was selected to verify the inhibitory effect of REEP6 deficiency on OSCC cell lines. CCK-8( Figure 3 C) EdU staining ( Figure 3 D) and colony formation assay ( Figure 3 E) confirmed that REEP6 deficiency significantly inhibited the growth rate and proliferation rate of cells in OSCC cell lines. In addition, REEP6 knockdown significantly promoted DNA damage in OSCC cell lines ( Figure 3 F). In addition, cell scratches ( Figure 3 G) and transwell ( Figure 3 H) Experiments showed that REEP6 knockdown significantly inhibited the migration and invasion of OSCC cell lines. These results collectively suggest that the REEP6 gene acts as an oncogene in OSCC progression.

[0071] Table 1 Primers used for shRNA knockdown of REEF6

[0072]

[0073] 2.4REEP6 overexpression promotes tumor growth and activates EMT signaling in cell lines and transplanted tumors

[0074] Based on these in vitro results, REEP6 plays an oncogenic role in OSCC. Here, we further validated the oncogenic role of REEP6 in vivo. We evaluated the ability of REEP6-overexpressing CAL-27 cells to form orthotopic tumors using a nude mouse subcutaneous transplantation model. The results showed that REEP6 overexpression significantly accelerated the growth (weight and volume) of transplanted tumors, but had no significant effect on the body weight of nude mice ( Figure 4 AD). In addition, the expression of cell proliferation biomarkers (Ki-67 and PCNA) in the xenografts formed by REEP6-overexpressing CAL-27 cells was higher than that in the xenografts formed by negative control CAL-27 cells ( Figure 4 E). Western blot experiments in CAL-27 cell lines and transplanted tumors showed that REEP6 overexpression significantly activated epidermal-mesenchymal transition (EMT) signaling in vitro and in vivo ( Figure 4 F, G). Tumor metastasis is closely related to EMT signaling. Therefore, we speculate that REEP6 may promote the metastasis of OSCC by activating EMT signaling.

[0075] 2.5REEP6 as an inhibitor of ferroptosis

[0076] To understand the molecular mechanism of REEP6's tumor-promoting effect in OSCC, we performed RNA sequencing studies in the SCC-15 cell line. The most significantly differentially expressed genes (DEGs) after REEP6 overexpression, including several ferroptosis-driving genes (TFRC, SAT1, ACSL4, and ACSL5), are shown in the heat map ( Figure 5 A). GO / KEGG analysis showed that the DEGs after REEP6 overexpression were enriched in ferroptosis signals ( Figure 5 B). GSEA analysis based on RNA-seq data showed that ferroptosis signaling was significantly inactivated in REEP6-overexpressing cells ( Figure 5 C). In addition, gene expression correlation analysis performed in the TCGA_OSCC cohort showed that REEP6 was positively correlated with ferroptosis suppressors (GPX4, SLC7A11, and NFE2L2) but negatively correlated with ferroptosis drivers (ACSL4, ACSL5, HMOX1, ALOX5, and IFNG) in OSCC ( Figure 5 D) These results collectively suggest that REEP6 may play a role in regulating ferroptosis.

[0077] Ferroptosis is a new type of programmed cell death that is iron-dependent and different from cell death, necrosis, and autophagy. Under the action of ferrous iron or ester oxygenase, unsaturated fatty acids highly expressed on the cell membrane undergo lipid peroxidation, leading to cell death. To verify the role of REEP6 in ferroptosis in OSCC cells, we used PGSK and DCF probes to evaluate the effect of REEP6 overexpression on the relative content of ferrous iron and reactive oxygen species in OSCC cell lines. Flow cytometry results showed that REEP6 overexpression reduced the accumulation of ferrous iron in OSCC cell lines ( Figure 5 E) and reactive oxygen species production ( Figure 5 FG).

[0078] Furthermore, compared with the control group, REEP6-overexpressing OSCC cells showed better mitochondrial membrane and inner crest integrity ( Figure 6 A, B). Together, these evidences suggest that REEP6 plays an important role in ferroptosis in OSCC cells. Therefore, we further evaluated the effects of REEP6 overexpression or knockdown in OSCC cell lines exposed to different concentrations of RSL3, a well-known ferroptosis inducer. The results showed that REEP6 overexpression significantly increased the RSL3 resistance of OSCC cell lines, while REEP6 knockdown increased the RSL3 sensitivity of OSCC cell lines ( Figure 6 C, D). In addition, we noticed that RSL3 treatment could significantly upregulate the mRNA expression of RSL3 in OSCC cell lines ( Figure 6 E). Therefore, we speculated that REEP6 might promote the progression of OSCC by inhibiting ferroptosis. To verify this possibility, we performed a rescue assay of cell colony formation in OSCC cell lines using RSL3. The results showed that the promoting effect of REEP6 on OSCC cell proliferation could be rescued by RSL3 treatment ( Figure 6 F, G). These results collectively indicate that REEP6 promotes OSCC progression by inhibiting ferroptosis.

[0079] Long-chain fatty acid-CoA ligase 4 (ACSL4) is known to be a ferroptosis driver by participating in the synthesis of membrane phospholipids that are easily oxidized. Recent evidence has shown that the CHOP / ACSL4 axis is involved in ferroptosis associated with endoplasmic reticulum (ER) stress. Consistently, REEP6 has been reported to play a role in maintaining ER homeostasis. Therefore, we speculated that REEP6 may inhibit ferroptosis by maintaining ER homeostasis. Based on RNA-seq analysis, ACSL4 mRNA was downregulated in REEP6-overexpressing OSCC cells ( Figure 7 A). To validate the RNA-seq data, we further determined the expression levels of ACSL4 / 5 and ER stress-related genes (e.g., DDIT3 / CHOP, GPR78, and PERK / EIF2AK3) in SCC-15 and CAL-27 cell lines with or without REEP6 overexpression. The results showed that REEP6 overexpression significantly reduced the expression levels of ACSL4 / 5 and ER stress-related genes in OSCC cell lines ( Figure 7 In addition, we further examined the protein levels of ferroptosis-related classical biomarkers (GPX4, SLC7A11, TFRC, ACSL4, and ACSL5) and ER stress-related biomarkers (CHOP, GPR78, PERK, and p-PERK) in REEP6-overexpressing OSCC cell lines using Western blotting experiments ( Figure 7 D). The results showed that REEP6 overexpression significantly reduced the protein levels of ER stress-related biomarkers (CHOP, GPR78, and p-PERK) and the expression levels of well-known ferroptosis drivers (ACSL4 / 5, TFRC) in OSCC cell lines ( Figure 7 E, F). In contrast, the expression levels of ferroptosis inhibitory proteins (GPX4, SLC7A11) were significantly increased in OSCC cell lines overexpressing REEP6 ( Figure 7 F) In summary, REEP6 overexpression suppresses ferroptosis by maintaining ER homeostasis through the CHOP / ACSL4 axis.

[0080] DNA hypomethylation activates REEP6 expression in OSCC

[0081] According to the annotation of REEP6 gene on the UCSC website, there is a CpG island in the promoter region of REEP6 gene ( Figure 8 A). This CpG island contains more than 20 CpG sites, about half of which have undergone extensive methylation modification ( Figure 8 B). In addition, the methylation modification levels of these CpG sites were significantly negatively correlated with the expression level of the REEP6 gene in the TCGA_OSCC cohort ( Figure 8B, C). These results suggest that REEP6 gene expression may be regulated by DNA methylation of its promoter. To verify this possibility, we treated the two OSCC cell lines with a DNA methylase inhibitor (5-Aza-CdR) for 48 h and then performed transcriptome sequencing. After RNA-seq analysis, we noticed that 5-Aza-CdR greatly upregulated REEP6 expression in CAL-27 and SCC-15 cell lines ( Figure 8 D, E). In addition, qRT-PCR and Western blot experiments together showed that REEP6 was significantly activated by 5-Aza-CdR in OSCC cell lines ( Figure 8 F, G). These results suggest that REEP6 gene expression is negatively regulated by DNA methylation of its promoter. Considering the overexpression of REEP6 in OSCC, we further performed methylation analysis of the REEP6 gene between cancer tissues and normal tissues of OSCC patients. The results showed that the methylation level of the REEP6 gene promoter in cancer tissues was significantly lower than that in normal tissues ( Figure 8 H). In other words, it is DNA hypomethylation that leads to REEP6 overexpression in OSCC.

[0082] In conclusion, REEP 6 is a novel ferroptosis suppressor. Our findings highlight that REEP 6 overexpression mediated by DNA hypomethylation promotes OSCC progression by inhibiting ferroptosis. Fig. 9 ).

Claims

1. A product for auxiliary diagnosis of oral squamous cell carcinoma, characterized in that: The product is used to specifically detect the expression level of REEF6 gene or the activity of REEF6 gene expression product; the nucleotide sequence of the REEF6 gene is shown in SEQ ID NO.

1.

2. The product according to claim 1, characterized in that The product includes a reagent for specifically detecting changes in the expression level of REEF6 gene or the activity of REEF6 gene expression products by sequencing technology, nucleic acid hybridization technology, nucleic acid amplification technology or immunoassay.

3. The product according to claim 1, characterized in that The product comprises a PCR amplification reagent and PCR primers for detecting the expression level of the REEF6 gene, and the nucleotide sequences of the PCR primers are shown in SEQ ID NO.11 and SEQ ID NO.

12.

4. A drug for treating oral squamous cell carcinoma, characterized in that: The drug includes an inhibitor of REEF6 gene or an inhibitor of REEF6 gene expression product; the nucleotide sequence of the REEF6 gene is shown in SEQ ID NO.

1.

5. Use of an inhibitor of REEF6 gene or an inhibitor of REEF6 gene expression product in the preparation of a drug for treating oral squamous cell carcinoma, characterized in that: The inhibitor can reduce the expression level of REEF6 gene or reduce the activity of the expression product of REEF6 gene in vitro and / or in vivo; the nucleotide sequence of REEF6 gene is shown in SEQ ID NO.

1.

6. The use according to claim 5, characterized in that: The inhibitor is any of the following: a. Antisense RNA, siRNA, shRNA, miRNA, TALEN or CRISPR targeting REEF6 gene; b. Reagents that promote DNA methylation of the REEF6 gene promoter.

7. The use according to claim 6, characterized in that: The inhibitor is shRNA, and the forward primer and reverse primer used by the shRNA to inhibit REEF6 are shown as SEQ ID NO.7 and SEQ ID NO.8 respectively.

8. The use according to claim 7, characterized in that: The target sequence of the shRNA is GCATGGCTCCCAGGCCCTGGAA.

9. A method for non-therapeutic in vitro inhibition of oral squamous cell carcinoma cell growth, number increase, migration and / or invasion, characterized in that: Oral squamous cell carcinoma cells are cultured in the presence of an inhibitor of the REEF6 gene or an inhibitor of the REEF6 gene expression product to inhibit the growth, number increase, migration and / or invasion of oral squamous cell carcinoma cells; the nucleotide sequence of the REEF6 gene is shown in SEQ ID NO.1.

Images