Application of circATP2B4 detection reagent in preparation of product for diagnosing oral squamous cell carcinoma

Abstract

The invention discloses an application of a reagent for detecting circATP2B4 in preparation of a product for diagnosing oral squamous cell carcinoma. The reagent for detecting circATP2B4 comprises a primer pair for amplifying circATP2B4. The expression of the biomarker circATP 2B4 disclosed by the invention has tissue specificity, the expression quantity of the biomarker circATP 2B4 is remarkably up-regulated in tumor tissues and OSCC cells of an OSCC patient, and a characteristic curve of a subject shows that the AUC value is more than 0.68; meanwhile, the circATP2B4 has a regulation and control effect on proliferation, migration and invasion of the OSCC cells. Therefore, circATP2B4 plays an important role in regulating and controlling the occurrence and development of OSCC and can be used as an effective OSCC clinical diagnosis marker, so that a prevention scheme or a treatment scheme is guided to be provided for a subject clinically.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to the use of a reagent for detecting circATP2B4 in the preparation of a product for diagnosing oral squamous cell carcinoma. Background Art

[0002] Oral squamous cell carcinoma (OSCC) is one of the most common oral malignancies in the oral and maxillofacial region, and most OSCC patients have a poor prognosis, with a 5-year overall survival rate of 55% to 65%. On the one hand, OSCC patients are often diagnosed in the advanced stage or have already developed lymph node metastasis; on the other hand, the pathogenic mechanism of OSCC is not yet fully understood, and there is a lack of effective targets for the diagnosis and treatment of OSCC in the clinic, so it is necessary to find new biomarkers.

[0003] Circular RNA (circRNA) is a special type of abundant non-coding RNA, whose expression level can be about 10 times higher than that of linear isomers, and often shows the characteristics of specific expression at different developmental stages. In addition, the closed ring structure of circular RNA makes it less susceptible to degradation by RNase, so it can exist more stably in the organism. Multiple evidences show that circRNA has abnormal expression in various types of cancer and may be a potential clinical diagnostic marker. However, at present, the potential biomarkers that have been found to be closely related to the occurrence and development of OSCC are mostly protein molecules and miRNAs, and relatively few potential circular RNA markers for OSCC have been reported. Summary of the invention

[0004] The present invention aims to solve at least one of the technical problems existing in the prior art.

[0005] To this end, the present invention proposes the use of a reagent for detecting circATP2B4 in the preparation of a product for diagnosing oral squamous cell carcinoma. circATP2B4 is a biomarker for oral squamous cell carcinoma, and the risk of oral squamous cell carcinoma of a subject can be determined by detecting its expression level.

[0006] The invention also provides a risk assessment system for oral squamous cell carcinoma.

[0007] The present invention also provides the use of substances that inhibit the expression of circATP2B4.

[0008] The present invention also provides the application of circATP2B4.

[0009] According to a first aspect of the present invention, there is provided use of a reagent for detecting circATP2B4 in the preparation of a product for diagnosing oral squamous cell carcinoma.

[0010] The circBank ID of circATP2B4 is hsa_circATP2B4_017, the circBase ID is hsa_circ_0007167, and its parent gene is ATPase Plasma Membrane Ca 2+ Transporting 4 (ATP2B4) gene, gene aliases include ATP2B2, MXRA1, PMCA4, PMCA4b and PMCA4x; the circular RNA is formed by the cyclization of exon 9 and exon 10 located at chr1:203676136-chr1:203677232, with a total length of 458bp; the specific nucleotide sequence is as follows:

[0011] 5'-GTCTGCTCATGTCTGCTCTCACGGTTTTCATCCTGATTCTATACTTTGTGATTGAC AACTTTGTGATAAATCGCAGACCATGGCTCCCTGAGTGTACTCCCATCTACATCCAGTACTTTGTCAAGTTCTTCATCATCGGCATCACTGTACTGGTGGTGGCTGTGCCAGAGGGGCTGCCTCTGGCTGTCACCATCTCACTGGCCTACTCTGTGAAGAAAATGATGAAAGACAATAACCTAGTACGGCACTTGGATGCTTGT GAGACCATGGGCAACGCCACCGCCATCTGCTCTGATAAGACAGGCACGTTGACCATGAACCGCATGACTGTGGTACAAGCTTATATTGGGGGCATCCATTACCGTCAAATCCCAAGCCCTGATGTCTTCCTGCCCAAAGTCCTGGACCTCATTGTCAATGGCATTTCTATCAACAGTGCTTATACCTCCAAGATTCTG-3'(SEQ ID NO:1).

[0012] In some embodiments of the present invention, the reagent for detecting circATP2B4 includes a primer pair for amplifying circATP2B4.

[0013] In some embodiments of the invention, the primer pair comprises:

[0014] The primer pair shown in SEQ ID NO:2-3; or,

[0015] The primer pairs shown in SEQ ID NO:6-7 and.

[0016] In some embodiments of the present invention, the oral squamous cell carcinoma refers to a cancer with squamous differentiation originating from the oral mucosal epithelium, wherein the oral mucosa includes at least one of the buccal mucosa, gingival mucosa, retromolar trigone mucosa, tongue (2 / 3 anterior to the terminal sulcus) mucosa, floor of mouth mucosa, hard palate mucosa and lip mucosa.

[0017] In some embodiments of the present invention, the reagent for detecting circATP2B4 is a reagent for detecting the expression level of circATP2B4 in a sample to be tested.

[0018] In some embodiments of the present invention, the sample to be tested includes at least one of a cell sample, a tissue sample, and a body fluid sample.

[0019] In some embodiments of the present invention, the tissue sample comprises an oral mucosal tissue sample.

[0020] In some embodiments of the present invention, the expression level of circATP2B4 is the relative expression level of circATP2B4 relative to an internal reference gene, and the internal reference gene includes any one of β-Actin, GAPDH and tubulin.

[0021] In some embodiments of the present invention, the internal reference gene used to calculate the relative expression level is β-Actin.

[0022] In some embodiments of the present invention, the product further comprises a nucleic acid extraction reagent and a reverse transcription reagent.

[0023] In some embodiments of the present invention, the nucleic acid extraction reagent includes TRIzol.

[0024] In some embodiments of the present invention, the reverse transcription reagent includes reverse transcription polymerase, dNTPs and RT primers.

[0025] In some embodiments of the invention, the reverse transcriptase polymerase comprises Evo M-MLV RTase.

[0026] In some embodiments of the present invention, the RT primer comprises at least one of a random primer and oligo dT.

[0027] In some embodiments of the present invention, the reverse transcription reagent further comprises an RNase inhibitor, a gDNA removal reagent and RNase-free water.

[0028] In some embodiments of the present invention, the product further comprises an internal reference primer pair.

[0029] In some embodiments of the present invention, the internal reference primer pair is a primer pair for detecting β-Actin.

[0030] According to a second aspect of the present invention, there is provided an oral squamous cell carcinoma risk assessment system, the oral squamous cell carcinoma risk assessment system comprising an acquisition module and an assessment module;

[0031] The acquisition module is used to obtain information on the expression level of circATP2B4 in the subject sample.

[0032] The evaluation module is used to compare the expression level of circATP2B4 with a threshold value, and indicate whether the subject has squamous cell carcinoma based on the comparison result.

[0033] In some embodiments of the present invention, the oral squamous cell carcinoma risk assessment system further comprises a detection module, and the detection module is used to detect the expression level of circATP2B4 based on the sample of the subject.

[0034] It is understandable that the acquisition module can obtain the information on the expression level of circATP2B4 in the subject's sample according to the detection result of circATP2B4 in a direct or indirect manner.

[0035] In some embodiments of the present invention, the sample to be tested includes at least one of a cell sample, a tissue sample, and a body fluid sample.

[0036] In some embodiments of the present invention, the tissue sample comprises an oral mucosal tissue sample.

[0037] In some embodiments of the present invention, the expression level of circATP2B4 is the relative expression level of circATP2B4 relative to an internal reference gene, and the internal reference gene includes any one of β-Actin, GAPDH and tubulin.

[0038] In some embodiments of the present invention, the internal reference gene used to calculate the relative expression level is β-Actin.

[0039] In some embodiments of the present invention, the product further comprises a nucleic acid extraction reagent and a reverse transcription reagent.

[0040] In some embodiments of the present invention, the nucleic acid extraction reagent includes TRIzol.

[0041] In some embodiments of the present invention, the reverse transcription reagent includes reverse transcription polymerase, dNTPs and RT primers.

[0042] In some embodiments of the invention, the reverse transcriptase polymerase comprises Evo M-MLV RTase.

[0043] In some embodiments of the present invention, the RT primer comprises at least one of a random primer and oligo dT.

[0044] In some embodiments of the present invention, the reverse transcription reagent further comprises an RNase inhibitor, a gDNA removal reagent and RNase-free water.

[0045] In some embodiments of the present invention, the product further comprises an internal reference primer pair.

[0046] In some embodiments of the present invention, the internal reference primer pair is a primer pair for detecting β-Actin.

[0047] In some embodiments of the present invention, in the evaluation module, when the expression level of circATP2B4 in the sample of the subject is higher than a threshold, it indicates that the subject has oral squamous cell carcinoma.

[0048] In some embodiments of the present invention, the threshold is a cutoff value when a ROC curve constructed by the OSCC patient group and the control group meets a certain specificity and / or sensitivity, for example, a cutoff value when the sum of specificity and sensitivity is maximum.

[0049] In some embodiments of the present invention, the OSCC patient group and the control group are cancer tissues and paracancerous tissues of OSCC patients, respectively, or cancer tissues of OSCC patients and sample tissues of normal persons, respectively.

[0050] According to a third aspect of the present invention, there is provided a use of a substance for inhibiting the expression of circATP2B4 in the preparation of (1) to (2):

[0051] (1) Drugs for the treatment and / or prevention of oral squamous cell carcinoma;

[0052] (2) Drugs that inhibit the proliferation, migration or invasion of oral squamous cell carcinoma cells.

[0053] In some embodiments of the present invention, the substance that inhibits the expression of circATP2B4 includes: any one of antisense oligonucleotide (ASO) of circATP2B4, small interfering RNA (siRNA), short hairpin RNA (shRNA), micro RNA (miRNA), clustered regularly interspaced short palindromic repeats (CRSIPR) system, transcription activator-like effector nuclease (TALEN) system, and zinc finger nuclease (ZFN) system.

[0054] In some embodiments of the present invention, the nucleotide sequences of the sense strand and the antisense strand of the shRNA are shown as SEQ ID NO: X and SEQ ID NO: X, respectively.

[0055] In some embodiments of the present invention, the substance that inhibits the expression of circATP2B4 also includes a vector loaded with the above-mentioned ASO, siRNA, shRNA, miRNA, CRS IPR system, TALEN system, and ZFN system.

[0056] In some embodiments of the present invention, the vector comprises any one of a plasmid, a lentivirus, an adenovirus and an adeno-associated virus.

[0057] According to a fourth aspect of the present invention, there is provided a use of circATP2B4 in constructing a computational model for assessing the risk of oral squamous cell carcinoma.

[0058] In some embodiments of the present invention, the computational model uses the expression level of circATP2B4 as an input variable, performs calculations using a bioinformatics method, and outputs the risk of oral squamous cell carcinoma.

[0059] The present invention has at least the following beneficial effects:

[0060] The expression of the biomarker circATP2B4 provided by the present invention is tissue-specific, and its expression level is significantly upregulated in tumor tissues and OSCC cells of OSCC patients, and the receiver characteristic curve shows that the AUC value is above 0.68; at the same time, circATP2B4 has a regulatory effect on the proliferation, migration and invasion of OSCC cells. Therefore, circATP2B4 plays an important regulatory role in the occurrence and development of OSCC, and can be used as an effective clinical diagnostic marker for OSCC, thereby guiding the provision of prevention or treatment plans to subjects in the clinic.

[0061] Additional aspects and advantages of the present application will be given in part in the description below, and in part will become apparent from the description below, or will be learned through the practice of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0062] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0063] Figure 1 This is a schematic diagram of the structure of circATP2B4 in Example 1 of the present invention;

[0064] Figure 2 This is a graph showing the relative expression levels of circATP2B4 in cancer tissues and adjacent paracancerous tissues of OSCC patients in Example 3 of the present invention; wherein, “*” represents p<0.05;

[0065] Figure 3 The relative expression level of circATP2B4 in different OSCC cell lines in Example 3 of the present invention is shown in the figure; wherein, "*" represents p<0.05, "**" represents p<0.01, and "***" represents p<0.001;

[0066] Figure 4 This is a ROC curve diagram of the diagnostic efficacy of circATP2B4 for OSCC using cancer tissue and paracancerous tissue in Example 3 of the present invention;

[0067] Figure 5 This is a diagram showing the knockdown efficiency test results of HSC3 and HN6 cells knocking down circATP2B4 in Example 4 of the present invention;

[0068] Figure 6 This is a CCK-8 experimental result diagram of the HSC3 stably transfected cell line with knockdown of circATP2B4 in Example 4 of the present invention, wherein "***" represents p<0.001;

[0069] Figure 7This is a CCK-8 experimental result diagram of the HN6 stable cell line with knockdown of circATP2B4 in Example 4 of the present invention, wherein "*" represents p<0.05 and "***" represents p<0.001;

[0070] Figure 8 The figure is the result of the scratch test of the HSC3 stably transfected cell line with knockdown of circATP2B4 in Example 4 of the present invention, wherein "***" represents p<0.001, and the scale bar is 100 μm;

[0071] Fig. 9 The figure is the result of the scratch test of the HN6 stable cell line knocking down circATP2B4 in Example 4 of the present invention, wherein "***" represents p<0.001, and the scale bar is 100 μm;

[0072] Fig.10 The figure shows the results of the cell migration experiment of the HSC3 stable cell line and the HN6 stable cell line with knockdown of circATP2B4 in Example 4 of the present invention, wherein "***" represents p<0.001, and the scale bar is 250 μm;

[0073] Fig.11 The figure shows the invasion experiment results of HSC3 stable cell line and HN6 stable cell line with knockdown of circATP2B4 in Example 4 of the present invention, wherein "***" represents p<0.001, and the scale bar is 250 μm;

[0074] Fig.12 This is a graph showing the tumor size results in the control group and tumor-bearing mice after knockdown of circATP2B4 in Example 5 of the present invention;

[0075] Fig.13 This is a statistical graph of tumor weights in the control group and tumor-bearing mice after circATP2B4 knockdown in Example 5 of the present invention; wherein, “**” represents p<0.01. DETAILED DESCRIPTION

[0076] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0077] In the description of the present invention, if there is a description of first, second, etc., it is only for the purpose of distinguishing technical features, and cannot be understood as indicating or implying relative importance or implicitly indicating the number of the indicated technical features or implicitly indicating the order of the indicated technical features.

[0078] When a numerical range is disclosed herein, the above range is considered to be continuous and includes the minimum and maximum values ​​of the range, as well as every value between such minimum and maximum values. Further, when a range refers to an integer, every integer between the minimum and maximum values ​​of the range is included. In addition, when multiple ranges are provided to describe features or characteristics, the ranges can be combined. In other words, unless otherwise indicated, all ranges disclosed herein should be understood to include any and all subranges included therein.

[0079] The following will be combined with the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of the present invention.

[0080] Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0081] Materials and instruments

[0082] The sources of the main materials and instruments used in the following examples of the present invention are as follows:

[0083] TRIzol reagent was purchased from Dalian TaKaRa Company;

[0084] High-fidelity PCR polymerase ApexHF HSDNA polymerase premix-FS (Cat.#AG12206), reverse transcription kit Evo M-MLV RT Mix Kit with gDNAClean for qPCR (Cat.#AG11728), and fluorescent quantitative PCR reagent SYBR Green Premix Pro Taq HS qPCR Kit II (Cat.#AG11702) were purchased from Hunan Aikerui Bioengineering Co., Ltd.;

[0085] RNase-free water was purchased from Biosharp, China;

[0086] The primers were commissioned to be synthesized by Shanghai Sangon Biotechnology Co., Ltd.;

[0087] HSC3 was purchased from Beina Biotechnology;

[0088] HN6 was obtained from Peking University School of Stomatology;

[0089] CAL27 and SCC15 were purchased from ATCC Biological Resource Center;

[0090] HOK was purchased from Shanghai Meixuan Biotechnology Co., Ltd.;

[0091] DMEM (Dulbecco's Modified Eagle Medium) and streptomycin-penicillin double antibody mixture were purchased from Ther mo Fisher Scientific, USA;

[0092] Fetal bovine serum was purchased from PAN-Biotech, Germany;

[0093] Lentivirus and polybrene were purchased from Hanheng Biotech Shanghai Co., Ltd.;

[0094] CCK-8 (Cell Counting Kit-8) cell proliferation detection kit was purchased from Shenzhen Aipno Biomedical Technology Co., Ltd.;

[0095] Matrigel was purchased from Corning, USA;

[0096] 10% paraformaldehyde was purchased from Guangzhou Weiges Biotechnology Co., Ltd.;

[0097] The PCR instrument was purchased from Applied Biosystems, USA;

[0098] NanoDrop One Nucleic Acid Analyzer was purchased from Thermo Fisher Scientific, USA;

[0099] Lightcycler480Ⅱ real-time fluorescence quantitative PCR instrument was purchased from Roche, Switzerland;

[0100] Multiskan GO automatic microplate reader was purchased from Thermo Fisher Scientific, USA;

[0101] The DMi8 inverted fluorescence microscope was purchased from LEICA, Germany.

[0102] Example 1 Screening of differentially expressed circular RNA in OSCC tissues

[0103] 1. Sample source:

[0104] In this example, OSCC cancer tissues and corresponding adjacent normal mucosal tissues from 8 patients treated in the Department of Oral and Maxillofacial Surgery of Peking University Shenzhen Hospital were collected for screening of differentially expressed circular RNAs;

[0105] All experimental patient samples did not receive other treatment before surgery, and all OSCC cancer tissues were confirmed by strict pathological examination; the clinical and pathological characteristics of the patients were based on the World Health Organization classification and UICC TNM classification; clinical samples were collected after the patients or their families agreed and signed the informed consent form with the approval of the Ethics Committee of Peking University Shenzhen Hospital.

[0106] 2. RNA extraction:

[0107] After obtaining clinical samples through surgery, they were immediately frozen with liquid nitrogen. OSCC tissues and adjacent tissues of 8 patients were ground, and total RNA was extracted using the TRIzol method. The total RNA concentration was measured using the NanoDrop One nucleic acid analyzer.

[0108] 3. Library construction and sequencing:

[0109] 1) After extracting the total RNA of each group of samples, the total RNA was treated with RNase R to degrade linear RNA, and then purified using RNeasy MinElute Clean up Kit (purchased from QIAGEN);

[0110] 2) According to the instruction manual, VAHTS Total RNA-seq (H / M / R) Library Prep Kit for Illumi na (purchased from Vazyme) was used to remove ribosomal RNA and construct a strand-specific library;

[0111] 3) First, the enriched circRNA is fragmented into short fragments using a fragmentation buffer and reverse transcribed into cDNA using random primers; the second-strand cDNA is synthesized using DNA polymerase I, RNase H, dNTP (dUTP instead of dTTP) and buffer;

[0112] 4) Purify the cDNA fragments with VAHTSDNAClean magnetic beads (purchased from Vazyme), repair the ends, add poly(A), and connect to Illumina sequencing adapters, and then digest the second-strand cDNA with UNG (uracil-N-glycosylase);

[0113] 5) Purify the digestion product using VAHTSDNAClean magnetic beads;

[0114] 6) The purified product was used as a template for PCR amplification, and high-throughput deep sequencing was performed by Guangzhou Kidio Biotechnology Co., Ltd. using the Illumina HiSeq 2500 sequencing system.

[0115] 4. Quantification of circular RNA abundance:

[0116] The reads obtained from the sequencer include raw reads containing adapters or low quality. In order to quantify high-quality circRNA, the data of the reverse splicing sites were normalized by RPM (Reads Per Million mapped reads); the calculated expression levels can be directly used to compare the differential expression between groups of samples.

[0117] 5. Data Analysis:

[0118] The edgeR software package (https: / / www.bioconductor.org / ) was used to screen the differentially expressed circRNAs in each group of samples or between groups, with Fold change ≥ 2 and p value < 0.05. Furthermore, after comparison and annotation with the circBase database, circATP2B4 was identified as one of the differentially expressed circular RNAs.

[0119] The circBank ID of circATP2B4 is hsa_circATP2B4_017, and the circBase ID is hsa_circ_0007167. Its parent gene is ATPase Plasma Membrane Ca 2+ Transporting 4 (ATP2B4) gene, gene aliases include ATP2B2, MXRA1, PMCA4, PMCA4b and PMCA4x; this circular RNA is formed by the cyclization of exon 9 and exon 10 located at chr1:203676136~chr1:203677232 (its structural schematic diagram is shown in Figure 1 The total length is 458 bp; the specific nucleotide sequence is as follows:

[0120] 5'-GTCTGCTCATGTCTGCTCTCACGGTTTTCATCCTGATTCTATACTTTGTGATTGAC AACTTTGTGATAAATCGCAGACCATGGCTCCCTGAGTGTACTCCCATCTACATCCAGTACTTTGTCAAGTTCTTCATCATCGGCATCACTGTACTGGTGGTGGCTGTGCCAGAGGGGCTGCCTCTGGCTGTCACCATCTCACTGGCCTACTCTGTGAAGAAAATGATGAAAGACAATAACCTAGTACGGCACTTGGATGCTTGT GAGACCATGGGCAACGCCACCGCCATCTGCTCTGATAAGACAGGCACGTTGACCATGAACCGCATGACTGTGGTACAAGCTTATATTGGGGGCATCCATTACCGTCAAATCCCAAGCCCTGATGTCTTCCTGCCCAAAGTCCTGGACCTCATTGTCAATGGCATTTCTATCAACAGTGCTTATACCTCCAAGATTCTG-3'(SEQ ID NO:1). Example 2 Identification of circATP2B4 in OSCC cells

[0121] In this example, the total RNA of HSC3 and HN6 cells was extracted by TRIzol method, and cDNA was synthesized by reverse transcription kit EvoM-MLV RT Mix Kit with gDNAClean for qPCR. The circATP2B4 in HSC3 and HN6 cells was amplified by high-fidelity PCR polymerase 2×Vazyme Lamp Master Mix (Dye Plus) and PCR instrument (the amplification primer sequences are shown in Table 1). The reaction solution was then sent to Shanghai Biotech Co., Ltd. for sequencing, and the sequencing results were consistent with the sequences provided by the circBank database and the circBase database.

[0122] Table 1 Primer sequences for amplifying circATP2B4

[0123]

[0124] Example 3 Detection of relative expression of circATP2B4 in OSCC patient tissue samples and different OSCC cell lines

[0125] 1. Source of clinical tissue samples:

[0126] In this example, based on the diagnostic criteria for OSCC by the World Health Organization, approved by the Ethics Committee of Peking University Shenzhen Hospital, and after the patients themselves or their families agreed and signed the informed consent form, cancer tissues and adjacent normal mucosal tissues (no tumor cells) were collected from 12 patients treated in the Department of Oral and Maxillofacial Surgery of Peking University Shenzhen Hospital. The selection criteria for the patients were:

[0127] 1) All patients were diagnosed based on histopathological results;

[0128] 2) All patients had complete follow-up data after surgery;

[0129] 3) All patients underwent thorough primary lesion clearance surgery and selective neck lymph node dissection.

[0130] All patients had not received preoperative chemoradiotherapy, and had no history of other systemic diseases such as rheumatoid arthritis, cardiovascular disease, diabetes, hyperthyroidism, or other tumor diseases. The pathological data of the patients are shown in Table 2.

[0131] Table 2 Clinical pathological information of OSCC patients

[0132]

[0133]

[0134] 2. Extraction of total RNA and detection of relative expression of circATP2B4:

[0135] 1) OSCC tissues and adjacent tissues from 12 patients were ground and frozen in liquid nitrogen, and total RNA from each tissue was extracted using the TRIzol method. At the same time, total RNA from HSC-3, HN6, and CAL-27 cell lines was extracted.

[0136] 2) After the total RNA concentration was detected by a nucleic acid analyzer, cDNA was obtained using the reverse transcription kit Evo M-MLV RT Mix Kit with gDNAClean for qPCR;

[0137] 3) The fluorescence quantitative PCR reagent SYBR Green Premix Pro Taq HS qPCR Kit II and Lightcycler480II real-time fluorescence quantitative PCR instrument were used to detect the cycle threshold (Ct) of the internal reference gene (β-Actin) and circATP2B4 in each sample. -ΔΔCt The relative expression levels of circATP2B4 in each group of tissue samples and different OSCC cell lines were calculated by the formula; the primer sequences used for qRT-PCR are shown in Table 3; the results obtained by qRT-PCR are shown in Figure 2 and Figure 3 shown.

[0138] Depend on Figure 2 It can be seen that the expression level of circATP2B4 in OSCC cancer tissues was significantly upregulated compared with that in adjacent normal tissues. Figure 3 It can be seen that compared with HOK cells (human oral keratinocytes), the expression level of circATP2B4 was significantly increased in HSC3, CAL27, SCC15 and HN6 cells.

[0139] In addition, the ROC curve was established based on the relative expression levels of circATP2B4 in cancer tissues and adjacent normal tissues of 12 OSCC patients to verify its diagnostic efficacy. Figure 4 shown.

[0140] Depend on Figure 4 It can be seen that the area under the ROC curve was 0.7500 and the p value was 0.0377, indicating that circATP2B4 has a good diagnostic significance for OSCC.

[0141] Table 3 qRT-PCR primer sequences

[0142]

[0143] Example 4 Detection of the effect of circATP2B4 on OSCC cell proliferation, invasion and migration

[0144] 1. Construction of stable cell lines with knockdown of circATP2B4:

[0145] HSC3 and HN6 cells were inoculated in cell culture well plates, respectively. Then, lentivirus carrying short hairpin RNA (shRNA) vector and control vector lentivirus were used to infect HSC3 and HN6 cells, respectively, to obtain a stable cell line (CircATP2B4) knocking down circATP2B4 and a control cell line (Control). The knockdown efficiency of circATP2B4 was detected by qRT-PCR according to the primers shown in Table 3 in Example 3. The results are shown in FIG. Figure 5 shown.

[0146] Depend on Figure 5 It can be seen that this example successfully constructed a stable cell line with knockdown of circATP2B4.

[0147] The above-mentioned vectors carrying shRNA include a control vector and a circATP2B4 interference vector, and both vectors used are lentiviral vectors (purchased from Hanbio Biotech (Shanghai) Co., Ltd.).

[0148] The shRNA sequences of the above control vector (NC) include:

[0149] Top strand: 5'-GATCCGTTCTCCGAACGTGTCACGTAATTCAAGAGATTACGTGACACGTTCGGAGAATTTTTTC-3' (SEQ ID NO: 8);

[0150] Bottom strand: 5'-AATTGAAAAAATTCTCCGAACGTGTCACGTAATCTCTTGAATTACGTGACACGTTCGGAGAACG-3' (SEQ ID NO: 9).

[0151] The shRNA sequences of the above circATP2B4 interference vector include:

[0152] Top strand: 5'-GATCCGCAAGATTCTGGTCTGCTCACTCGAGTGAGCAGACCAGAATCTTGTTTTTTG-3' (SEQ ID NO: 10);

[0153] Bottom strand: 5'-AATTCAAAAAACAAGATTCTGGTCTGCTCACTCGAGTGAGCAGACCAGAATCTTGCG-3' (SEQ ID NO: 11).

[0154] 2.CCK-8 experiment:

[0155] In the cell culture well plate, control group (Control) and experimental group (CircATP2B4) cells were inoculated respectively, and 1:10 CCK-8 reagent was added at 24h, 48h, 72h and 96h respectively. After incubation for 1h, the absorbance at 450nm was detected by microplate reader; Graphpad prism software was used to draw the cell proliferation curve and complete the statistical analysis (unpaired t test, p < 0.05 was significant difference). The results are shown in the figure. Figure 6 and Figure 7 shown.

[0156] Depend on Figure 6 and Figure 7 It can be seen that knockdown of circATP2B4 inhibited the proliferation rate of both OSCC cell lines.

[0157] 3. Scratch and cell migration assay:

[0158] 1) Scratch test:

[0159] In the cell culture plate, the control group (Control) and the experimental group (CircATP2B4) cells were inoculated respectively. When the cell coverage reached 100%, the tip of the gun was perpendicular to the bottom of the plate to scrape a uniform width of scratch. After culturing with serum-free DMEM for a period of time, the migration of cells at the scratch was observed under a microscope and photographed. The scratch area was calculated using Image J, and the cell migration rate (%) = (initial scratch area - scratch area at time t) / initial scratch area × 100%. Graphpad prism software was used to draw statistical graphs and perform statistical analysis (unpaired t test, p < 0.05 is considered significant); the results are shown in the figure. Figure 8 and Fig. 9 shown.

[0160] 2) Cell migration assay:

[0161] The control group (Control) and experimental group (CircATP2B4) cells suspended in serum-free DMEM were inoculated in the permeable cell culture chamber, and DMEM containing 10% serum was added to the bottom of the chamber. After the cells migrated in the incubator (37°C, 5% CO 2), they were washed 2-3 times with PBS, fixed with 10% paraformaldehyde, and stained with 1% crystal violet solution. Finally, the dye was rinsed off and the residual dye in the chamber was wiped clean with a cotton swab. The images were taken under a microscope and the number of migrated cells was calculated using Image J software. Graphpad prism software was used to draw statistical graphs and perform statistical analysis (unpaired t test, p < 0.05 was considered significant). The results are shown in the figure. Fig.10 shown.

[0162] Depend on Figure 8 to Figure 10 It can be seen that knockdown of circATP2B4 inhibited the migration ability of both OSCC cell lines.

[0163] 4. Cell invasion assay:

[0164] Matrigel was added to the bottom of the permeable cell culture chamber. After drying the matrigel, cells of the control group (Control) and experimental group (CircATP2B4) suspended in serum-free DME M were inoculated respectively. DME M containing 10% serum was added to the bottom of the chamber. The cells were cultured in an incubator (37°C, 5% CO2) until the cells invaded. Then, the cells were washed 2-3 times with PBS, fixed with 10% paraformaldehyde, and stained with 1% crystal violet solution. Finally, the dye was rinsed off and the residual dye in the chamber was wiped clean with a cotton swab. The images were taken under a microscope and the number of migrated cells was calculated using Image J software. Graphpad prism software was used to draw statistical graphs and perform statistical analysis (unpaired t test, p < 0.05 was considered significant); the results are shown in the figure. Fig.11 shown.

[0165] Depend on Fig.11 It can be seen that knockdown of circATP2B4 inhibited the invasion ability of both OSCC cell lines.

[0166] In summary, the expression of circATP2B4 is tissue-specific, and the expression of circATP2B4 is significantly upregulated in tumor tissues and OSCC cells of OSCC patients; at the same time, circATP2B4 has a regulatory effect on the proliferation, migration and invasion of OSCC cells. Therefore, circATP2B4 plays an important regulatory role in the occurrence and development of OSCC and is expected to become an effective clinical diagnostic marker and targeted therapeutic drug for OSCC.

[0167] Example 5: Validation of the effect of knocking down circATP2B4 on tumor growth in tumor-bearing mice

[0168] In this example, a mouse model was used for subcutaneous tumor formation, and the growth of tumor cells knocked down circATP2B4 in the subcutaneous part of the mouse was tested. The specific detection method is as follows:

[0169] Four-week-old female NOD-SCID immunodeficient mice (purchased from Guangdong Yaokang Biotechnology Co., Ltd.) were randomly divided into two groups, with 5 mice in each group. HN6 stable transfected cells with knockdown of circATP2B4 (5×10 per mouse) were injected subcutaneously. 6 The cells were resuspended in 100 μL injection) and injected into the abdomen of mice, and then the tumor growth and mouse weight were monitored every 3 days; this animal study was approved by the Experimental Animal Ethics Committee of the Shenzhen Peking University Hong Kong University of Science and Technology Medical Center; the results are shown in Fig.12 and Fig.13 shown.

[0170] Depend on Fig.12 and Fig.13It can be seen that 3 weeks after injection, the tumor volume and weight of mice with circATP2B4 knockdown cells were smaller than those of the control group, indicating that knockdown of circATP2B4 can significantly inhibit the proliferation of HN6 cells in vivo.

[0171] The embodiments of the present invention are described in detail above in conjunction with the accompanying drawings, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. Use of a reagent for detecting circATP2B4 in the preparation of a product for diagnosing oral squamous cell carcinoma.

2. The use according to claim 1, characterized in that: The reagent for detecting circATP2B4 includes a primer pair for amplifying circATP2B4.

3. The use according to claim 2, characterized in that: The primer pair comprises: The primer pair shown in SEQ ID NO:2-3; or, The primer pair shown in SEQ ID NO:6-7.

4. The use according to claim 1, characterized in that: The product also includes nucleic acid extraction reagents and reverse transcription reagents.

5. An oral squamous cell carcinoma risk assessment system, characterized in that: The oral squamous cell carcinoma risk assessment system includes an acquisition module and an assessment module; The acquisition module is used to obtain information on the expression level of circATP2B4 in the subject sample. The evaluation module is used to compare the expression level of circATP2B4 with a threshold value, and indicate whether the subject suffers from squamous cell carcinoma according to the comparison result.

6. The oral squamous cell carcinoma risk assessment system according to claim 5, characterized in that: The oral squamous cell carcinoma risk assessment system also includes a detection module, which is used to detect the expression level of circATP2B4 based on the sample of the subject.

7. Use of substances that inhibit the expression of circATP2B4 in the preparation of (1) to (2): (1) Drugs for the treatment and / or prevention of oral squamous cell carcinoma; (2) Drugs that inhibit the proliferation, migration or invasion of oral squamous cell carcinoma cells.

8. The use according to claim 7, characterized in that: The substance that inhibits the expression of circATP2B4 includes: any one of antisense oligonucleotides, siRNA, shRNA, miRNA, CRSIPR system, TALEN system and ZFN system of circATP2B4; Preferably, the nucleotide sequences of the sense strand and antisense strand of the shRNA are shown as SEQ ID NO: 10 and SEQ ID NO: 11, respectively.

9. Application of circATP2B4 in constructing a computational model for assessing the risk of oral squamous cell carcinoma.

10. The use according to claim 9, characterized in that: The computational model uses the expression level of circATP2B4 as an input variable, performs calculations using a bioinformatics method, and outputs the risk profile of oral squamous cell carcinoma.

Images