Bruchidius spp. population traceability SNP molecular marker and application thereof

By developing SNP molecular markers and detection primers for tracing the population origin of the common bean weevil, the problem of tracing and detecting the population origin of the common bean weevil in the existing technology has been solved. This enables rapid, simple and reliable tracing and detection of different geographical populations of the common bean weevil, and is applicable to the tracing and detection of the population origin of the common bean weevil.

CN119710017BActive Publication Date: 2025-12-30TECH CENT OF GUANGZHOU CUSTOMS
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202411874583.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-19
Publication Date
2025-12-30
Estimated Expiration
2044-12-19

AI Technical Summary

Technical Problem

Existing technologies lack precise and rapid detection methods for identifying the genetic differentiation characteristics of intraspecific geographic populations in the molecular identification of quarantine pests, making it difficult to accurately trace the source of the spread of quarantine pests, especially the population tracing and detection of the bean weevil.

Method used

A set of SNP molecular markers for tracing the origin of the bean weevil population was developed. Specific SNP sites were screened through genome sequence analysis, and corresponding detection primers were designed for tracing the origin of different geographical populations of the bean weevil. Tracing SNP markers and their amplification primers were provided for Guizhou, Yunnan, and overseas countries such as Ethiopia, Rwanda, Burundi, Cameroon, Congo, Uganda, Angola, Germany, and Chile.

Benefits of technology

It achieves rapid, simple, and reliable population tracing and detection of the bean weevil, ensuring the accuracy and stability of the detection results, saving detection workload, and is suitable for rapid detection needs in places such as ports.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119710017B_ABST
    Figure CN119710017B_ABST
Patent Text Reader

Abstract

The application discloses a bean weevil population tracing SNP molecular marker and application thereof. Through resequencing of genome samples of different geographical source populations of bean weevils, a SNP marker and corresponding detection primers thereof which can be used for tracing ten populations of the bean weevils, i.e., Guizhou, Yunnan, Ethiopia, Rwanda, Burundi, Cameroon, Congo, Uganda, Angola, Germany and Chile are developed. The population tracing SNP marker site has good genetic stability, and the detection result is reliable. According to a peak diagram after amplification of the detection site amplification primer, the attribution and source of the detected population can be accurately determined, which is helpful to clear the population source of the intercepted bean weevils, and guarantees international agricultural product trade and national ecological and agricultural safety.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of molecular biology detection technology, and in particular to an SNP molecular marker technology for tracing the origin of the bean weevil population and its application. Background Technology

[0002] Currently, routine molecular identification of quarantine pests and diseases both domestically and internationally primarily focuses on species identification, lacking precise and rapid detection technologies for identifying the genetic differentiation characteristics of intraspecific (infraspecific) geographical populations. It is noteworthy that intraspecific genetic differentiation within the same species, resulting from long-term geographical segmentation, can lead to genetic differences under corresponding ecological backgrounds (such as biotype and geographical population). Furthermore, the encounter of dissimilar infraspecific units (biotype and geographical type, etc.) may produce hybrid vigorous populations with stronger ecological adaptability than the original geographical populations themselves, and generate new pathogenic potential. Therefore, species-level identification cannot accurately identify the genetic differentiation characteristics of geographical populations. It is necessary to develop molecular detection and identification technologies at the infraspecific level that can be used to identify the genetic backgrounds of different geographical species, enabling accurate tracing and tracking of their dispersal origins and helping to solve the tracing challenges of quarantine pests in international trade.

[0003] The bean weevil, *Acanthoscelides obtectus* (Say), is an insect belonging to the order Coleoptera and the family Fabaceae. Its larvae bore into the seeds of more than 40 kinds of legume crops, including common beans, cowpeas, mung beans, adzuki beans, chickpeas, and peas, causing them to lose their commercial value and affecting global legume trade and food security.

[0004] There are four existing technologies similar to this invention: (1) simplified genome sequencing and analysis, (2) detection and analysis of specific barcode gene fragments (mitochondrial and nuclear genes, etc.), (3) microsatellite (SSR) molecular markers and analysis, and (4) SNP molecular marker technology. The first three technologies have significant limitations in population tracing and detection, while SNP molecular markers are mainly used for medical disease diagnosis, molecular markers of agricultural breeding traits, and molecular markers for meat tracing in food. Currently, there are no corresponding technologies or applications for developing SNP molecular markers for tracing quarantine pest populations.

[0005] (1) Simplified genome sequencing and analysis

[0006] This technology integrates and analyzes the genetic differentiation characteristics and sources of variation among populations at the genomic level through simplified genome sequencing of samples from different sources. Examples include strain typing and transmission source analysis of COVID-19 based on genome sequence, and research on the rapid expansion mechanism of the invasive weed Mikania micrantha (Liu, Bo; Yan, Jian; Li, Weihua et al. Mikania micrantha genome provides insights into the molecular mechanism of rapid growth. Nature Communications, 2020, 11(1). DOI:10.1038 / s41467-019-13926-4). The advantage of this technology is that it provides comprehensive and accurate population typing information. However, this technology requires the use of second-generation (library construction) or third-generation sequencing technology to sequence and analyze population samples, which is labor-intensive, costly, and time-consuming. It is particularly unsuitable for routine detection of species with large genomic data, such as port insects, and it is difficult to determine the population origin under the condition of a single population sample.

[0007] (2) Detection and analysis of specific barcode gene fragments (mitochondrial and nuclear genes, etc.)

[0008] Barcode gene fragments are mainly used as molecular markers for species identification and can also be used for preliminary analysis of population genetic structure, such as the analysis of geographic population genetic structure of the common bean weevil based on the mitochondrial CO1 gene (Oliveira MRC, Corre^a AS, Souza GA d, Guedes RNC, Oliveira LO D. 2013. Mesoamerican Origin and Pre-and Post-Columbian Expansions of the Ranges of Acanthoscelides obtectus Say, a Cosmopolitan Insect Pest of the Common Bean. PLoS ONE 8(7):e70039)(doi:10.1371 / journal.pone.0070039). However, due to the relative conservation of barcode sequences and the very limited information they can reflect on population genetic differentiation and diversity, coupled with the poor stability of variable marker sites, they are not suitable as molecular markers for tracing the origin of specific populations.

[0009] (3) Microsatellite (SSR) molecular markers and analysis

[0010] Microsatellite markers, also known as short tandem repeats (STRs) or simple sequence repeats (SSRs), are simple repetitive sequences uniformly distributed throughout the genomes of eukaryotes. They consist of tandem repeats of 2–6 nucleotides. Due to the high variability and abundance of repeat units among individuals, microsatellite markers are widely used as molecular markers for population genetics. Microsatellite loci are typically amplified by PCR, and the amplified products are analyzed by electrophoresis to separate alleles based on size for detection. However, microsatellites, as molecular markers of genetic variability, also suffer from poor stability, lack reliable molecular markers for specific populations, and require large population samples for routine detection. The origin of a population cannot be determined under single-sample conditions. Furthermore, the reliability of determining allele differences through electrophoretic mapping is poor.

[0011] (4) SNP Molecular Markers and Detection SNP (Single Nucleotide Polymorphism) molecular marker technology refers to DNA sequence polymorphism caused by a single nucleotide variation at the genomic level. This variation may occur as a single base transition (e.g., C←→T) or transversion (e.g., C←→A), or it may be caused by base insertion or deletion. SNPs have wide applications in biology, medicine, agriculture, and many other fields. In the medical field, SNP research helps in the localization, cloning, and identification of disease genes, and can be used for disease diagnosis and prediction of pathogenicity risk, as well as pharmacogenomics and the discovery of new drugs. In the agricultural field, SNP analysis can help breeding experts better understand crop genetic diversity and accelerate the breeding of superior varieties. In the food industry, SNP molecular markers can be used to trace the variety of meat sold.

[0012] In the field of plant quarantine, SNP molecular markers are not currently used for population tracing of quarantine pests. Because SNP molecular marker detection and application lack universality, specific SNP molecular marker technologies require screening genomic data for specific species to be developed and established. Summary of the Invention

[0013] To address the shortcomings of existing population tracing technologies, this invention develops and applies a set of SNP molecular markers for population tracing of the bean weevil (Acanthoscelides obtectus) from the genome sequence. Through genome resequencing of bean weevil population samples from different geographical origins, comparative analysis of genome sequence data reveals SNP molecular markers specific to different geographical populations of the bean weevil, serving as identification markers for their specific geographical population origins, thus forming a detection method applicable to population tracing.

[0014] This invention provides SNP markers for population tracing in 10 populations of the common bean weevil in Guizhou and Yunnan provinces, as well as in Ethiopia, Rwanda, Burundi, Cameroon, Congo, Uganda, Angola, Germany, and Chile, along with corresponding amplification primers for their detection. The population tracing SNP markers developed in this invention exhibit good genetic stability and reliable detection results. The peak diagram obtained after amplification using the SNP marker amplification primers accurately determines the affiliation and origin of the detected population.

[0015] This invention provides SNP molecular markers for tracing the population origin of the bean weevil, which include one or more of the following molecular markers:

[0016] For the source SNP locus of the German population, the 546923rd base on chromosome CAVLJG010001675.1 of the common bean weevil reference genome is T, and the molecular marker of the source SNP locus of the German population is G.

[0017] For the source SNP locus of the Guizhou population, the 48615734th base on the reference genome chromosome CAVLJG010000007.1 of the common bean weevil is G, and the source SNP molecular marker of the Guizhou population at this locus is A.

[0018] For the source SNP locus of the Ethiopian population, the 44479353rd base on chromosome CAVLJG010000003.1 of the common bean weevil reference genome is A, and the source SNP molecular marker of the Ethiopian population at this locus is G.

[0019] For the source SNP locus of the Angolan population, the 29220510th base position on chromosome CAVLJG010000006.1 of the common bean weevil reference genome is A, and the molecular marker for the source SNP locus of the Angolan population is G.

[0020] For the source SNP locus of the Yunnan population, the 20116048th base position on chromosome CAVLJG010000002.1 of the common bean weevil reference genome is C, and the source SNP molecular marker of the Yunnan population at this locus is A.

[0021] For the source SNP locus of the Chilean population, the 76234th base on the reference genome chromosome CAVLJG010000001.1 of the common bean weevil is T, and the source SNP molecular marker of the Chilean population at this locus is A.

[0022] For the source SNP locus of the Cameroonian population, the 110012864th base on the reference genome chromosome CAVLJG010000003.1 of the common bean weevil is T, and the source SNP molecular marker of the Cameroonian population at this locus is A.

[0023] For the source SNP locus of the Ugandan population, the base position at 23872448 on chromosome CAVLJG010000008.1 of the common bean weevil reference genome is G, and the molecular marker of the source SNP locus of the Ugandan population is T.

[0024] The source SNP locus for the Burundi population is A at base position 39379808 on chromosome CAVLJG010000004.1 of the common bean weevil reference genome, and the source SNP molecular marker for the Burundi population at this locus is G.

[0025] The source SNP locus for the Congo population is located at base position 92046044 on chromosome CAVLJG010000005.1 of the common bean weevil reference genome, and the source SNP molecular marker for the Congo population at this locus is C.

[0026] The present invention also provides detection primers for detecting the SNP molecular markers for tracing the population origin of the bean weevil.

[0027] Specifically, it includes one or more pairs of the following primers:

[0028] The primers for detecting the molecular markers of the source SNP sites in the German population are GER-6923-F / GER-6923-R, with the forward primer sequence TTAGAATGATTGATGACCGGGTG and the reverse primer sequence ACCATAGAAAGGCATCTTCAAGC; the primers for detecting the molecular markers of the source SNP sites in the Guizhou population are GZ-5734-F / GZ-5734-R, with the forward primer sequence AACATGAAGGACATTACCGAGTC and the reverse primer sequence TAACCAAGATATCCGACGCTTTC.

[0029] The detection primers for the molecular marker G for the source SNP site in the Ethiopian population are 9353-F / 9353-R, with the forward primer sequence being CTTCTCCCACTCCCAGTCTC and the reverse primer sequence being GACAAATCCGTGGTGGGAAC.

[0030] The detection primers for molecular markers of SNP sites for tracing the origin of the Angolan population are 0510-F / 0510a-R, with the forward primer sequence being TATCCCCACTAGGTCGTTGAAG and the reverse primer sequence being AGTGCATCACTTGGTCATAACG.

[0031] The primers for detecting molecular markers of SNP sites for tracing the origin of the Yunnan population are 6048-F / 6048-R, with the forward primer sequence being ACACGGGTGAAAACAACTGG and the reverse primer sequence being TCATCGGCTTGTTGCTATGG.

[0032] The primers for detecting molecular markers of SNP sites for tracing the origin of the Chilean population are 6234-F / 6234-R, with the forward primer sequence being GCCAATTCCTGAAACCCTATCC and the reverse primer sequence being TTAAATGCGCCCCAAAATTTGC.

[0033] The detection primers for molecular markers of SNP sites for tracing the origin of Cameroon populations are 2864-F / 2864-R, with the forward primer sequence being TTGTTGGCCTGTAAACGAAGC and the reverse primer sequence being ACCTAATGCTCAATGCGCTG.

[0034] The primers for detecting molecular markers of SNP sites for tracing the origin of the Ugandan population are 2448-F / 2448-R, with the forward primer sequence being TCTATTTTGTCGGTGCACAGC and the reverse primer sequence being ATCAGATCCCTCTTTGGCCC.

[0035] The detection primers for the molecular markers of the source SNP sites in the Burundi population are 9808-F / 9808-R, with the forward primer sequence being TAAGCTTGTAGCCCCATCCC and the reverse primer sequence being AGATGCACTGTGTAATCGGC.

[0036] The detection primers for the molecular markers of the SNP sites for tracing the Congo population are 6044-F / 6044-R, with the forward primer sequence being AACAGGATACCTACTCCCTGAC and the reverse primer sequence being ATCGTCTTGTGTGTAAAAGGGC.

[0037] This invention provides the application of the aforementioned SNP molecular markers for tracing the origin of the bean weevil population in the geographical population tracing and detection of the bean weevil.

[0038] This invention also provides the application of the aforementioned detection primers in the geographical population tracing and detection of the common bean weevil.

[0039] This invention further provides a method for tracing the origin of a bean weevil population using SNP molecular markers, which includes the following steps: extracting genomic DNA from a single bean weevil sample and amplifying it using the aforementioned detection primers; sequencing or analyzing the amplification products based on the amplification peak diagram, and determining the origin of the population to be tested by comparing the genotype of a specific population tracing locus.

[0040] The bean weevil populations mentioned are from Guizhou, Ethiopia, Rwanda, Burundi, Cameroon, Congo, Uganda, Angola, Germany, or Chile.

[0041] In this study, the method for extracting genomic DNA from a single bean weevil sample was performed using a kit suitable for micro-sample extraction.

[0042] In the specific implementation, the amplification conditions are as follows: pre-denaturation at 94℃ for 4 min before cycling; denaturation at 94℃ for 30 s, annealing at 50℃~58℃ (depending on the specific primers) for 30 s, extension at 72℃ for 45 s, 36 cycles, and a final extension at 72℃ for 10 min. The system temperature is then lowered to 12℃ to end the PCR amplification.

[0043] Specifically, the amplification system is prepared in 25 μL volumes, and the concentration of the genomic DNA template is adjusted to no less than...

[0044] The concentration of the primer was 0.4 ng / μL, and the concentrations of the upstream and downstream primers were 0.24 mmol / L, respectively.

[0045] In a specific implementation, the method for tracing and detecting the origin of the bean weevil population involves amplifying the target detection sequence of the bean weevil population sample using one or more primers. The ab1 sequencing file is opened with SnapGene to locate the flanking sequences of the SNP. The target region is determined on the sequencing peak diagram based on the flanking sequences (typically 10 bp). The sample origin can be determined based on the SNP type. Specific criteria are as follows:

[0046] Based on the amplification peak diagram of the SNP source sites obtained by primers GER-6923-F / GER-6923-R, the source SNP genotype of the German population is GG, while the genotypes of Ethiopia, Angola, Burundi, Congo, Guizhou, Cameroon, Rwanda, Uganda, Yunnan and Chile are all TT.

[0047] Based on the amplification peak diagram of the SNP source sites obtained by primers 6048-F / 6048-R, the source SNP genotype of the Yunnan population is AA, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda and Chile are all CC or AC.

[0048] Based on the amplification peak diagram of the SNP source sites obtained by primers GZ-5734-F / GZ-5734-R, the source SNP genotype of the Guizhou population is AA, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Cameroon, Uganda, Yunnan and Chile are all GG.

[0049] Based on the amplification peak diagram of the SNP source sites obtained by primers 9353-F / 9353-R, the source SNP genotype of the Ethiopian population is GG, while the genotypes of Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA.

[0050] Based on the amplification peak diagram of the SNP source sites obtained by primers 0510-F / 0510a-R, the source SNP genotype of the Angolan population is GG, while the genotypes of Ethiopia, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA.

[0051] Based on the amplification peak diagram of the SNP source sites obtained by primers 9808-F / 9808-R, the source SNP genotype of the Burundi population is GG, while the genotypes of Ethiopia, Angola, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA.

[0052] Based on the amplification peak diagram of the SNP source sites obtained by primers 6044-F / 6044-R, the source SNP genotype of the Congo population is CC, while the genotypes of Ethiopia, Angola, Burundi, Germany, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA.

[0053] Based on the amplification peak diagram of the SNP source sites obtained by primers 2864-F / 2864-R, the source SNP genotype of the Cameroon population is AT, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Uganda, Yunnan and Chile are all TT.

[0054] Based on the amplification peak diagram of the SNP source sites obtained by primers 2448-F / 2448-R, the source SNP genotype of the Ugandan population is TT, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Yunnan and Chile are all GG.

[0055] Based on the amplification peak diagram of the SNP source sites obtained by primers 6234-F / 6234-R, the source SNP genotype of the Chilean population is AA, while the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, and Yunnan are all TT.

[0056] The beneficial effects achieved by this invention are as follows:

[0057] The SNP loci for tracing the population of the common bean weevil established in this invention are obtained by screening the whole genome sequence. Its technical advantage lies in the richer quantity and quality of the SNP loci available for screening, which can fully meet the reliability and stability of the marker loci, thereby ensuring the quality of the detection results.

[0058] The population tracing SNP locus detection method established in this invention is simple, convenient, and highly practical. Since the SNP molecular markers target a single locus for each target population, there is no need for multi-locus combination markers, thus greatly reducing the workload and making the application detection fast and convenient.

[0059] The SNP loci for tracing the population of the common bean weevil in this invention are obtained by screening for genomic sequence variation sites. The candidate SNP screening sites for population tracing are more abundant, and the selected sites are more stable and reliable, which can effectively ensure the quality of the test results. Attached Figure Description

[0060] Figure 1 A map showing the SNP source sites for the German population of the Common Bean Wee;

[0061] Figure 2 A map showing the SNP source sites for the Yunnan population of the Common Bean Wee;

[0062] Figure 3 A map showing the SNP source sites for the Guizhou population of the Common Bean Wee;

[0063] Figure 4 A map showing the SNP source sites for the Ethiopian bean weevil population;

[0064] Figure 5 A map showing the SNP source sites for the Angolan bean weevil population.

[0065] Figure 6 A map showing the source sites for the SNPs of the common bean weevil population in Burundi.

[0066] Figure 7 A map showing the source sites for SNP tracing in the Congo population of the Common Bean Wee;

[0067] Figure 8 A map showing the source sites for SNPs in the Cameroonian population of the common bean weevil.

[0068] Figure 9 A map showing the source sites for SNPs in the Ugandan population of the common bean weevil.

[0069] Figure 10 A map showing the SNP source sites for the Chilean population of the Common Bean Weevil. Detailed Implementation

[0070] The present invention will be further described below with reference to specific embodiments, but the present invention is not limited to the embodiments.

[0071] Unless otherwise specified, the experimental materials, reagents, instruments and methods used in the following examples are all conventional experimental materials, reagents, instruments and methods in the art, and can be purchased through commercial channels.

[0072] Example 1: Mining SNP Molecular Markers for Population Tracing of the Bean Weevil

[0073] The following population-specific sequences were obtained through screening and analysis of the whole genome sequence of the common bean weevil population:

[0074] 1. Ethiopian population

[0075] >CAVLJG010000003.1_44479353-44479353:._us:400_ds:400

[0076] CAVLJG010000003.1_44479353_A_G

[0077] TTAGTTTTGTATAAAATCTCAGTATAAATATATAAAATATAAATATACAGCTCTATGCATTCCTTGCTTCCTATT

[0078] ACTATCAGTCTCGTTCCTAACACCGTTTCTTGCCTCTGTAGAAGGTGTTTCCACCTTCTCCCACTCCCAGTCTCCAT

[0079] CTAGAGGTACTTCGTTTTCGAAATCGAAATTCCATTTCTCAGCTGCTCTCTTCCTTTCAGCCTATGAAATCATGAAT

[0080] TTGTTAATAGTCATCCAAAATAAAAAAAAACATAGCTAAAAGCCTTATTTTGATATCTCAAAGATATCCTAAACAGC

[0081] AATTGAATCAGGCAAACCGTAAGAGATACGAAGTCAGTTAAATAGTGGCAAAAGGACAACAAAATTTTTGCCCGACTTTATTTGTGGTGGGATT[A / G]TAAAATAAATTGCATTATAACAATGCAACTTTTTCTCCTCTCCAAAACGGCATAA TCAGAATTTCAATATAACGTTTCGACTCTTGTTCTCAATCGGTAACTTTACTTTTTCTAATGGACGCTAAAATTTACAGGGCTAAATGCAGTTTTTGCCTCTGATTTCAAAAATTTACAACTTATCATACAGGGTGTTTATTTGAAAAGTTCCCACCACGGATTTGTCGAAAATCACTGATTAGAAGGAAAAACGCCGAGACACGTGAAAAGATTTAACTTTAACCGAAGACTACTCCACCCAGTTTCACCCTCTGCACGCCAGGGTCATTCCCTTAAAAATCTTAAATGACAAGGGGTAACGAGAAATAGCTTGTTTAAAAGGTCTTTCGATGTCCTTCATTTT。

[0082] 2. Angola

[0083] >CAVLJG010000006.1_29220510-29220510:._us:400_ds:400

[0084] CAVLJG010000006.1_29220510_A_G

[0085] TCCATCTCTAAAATTGACGGGGTCTTATTTCTGATTCAACCCTCGTAATATGCCTCAGAATTATAACAAATTTTG

[0086] ATGTATCTTACCTAAGAGGGTATGCCAATCAAATTTCACATCCATTCTGTTCTTTATCCCCACTAGGTCGTTGAAGT

[0087] ATACGTTTAATATACTGCTATCGTTGGTTACTTTCACATCAGCACTGAAACATTTAAAAAAATACAATGCAGACCTT

[0088] CTACTATGACTCAGATGTGAGTATAAAGGTATATCACATTCAAATGCAACATTTCTGATAGCCGGTTGCTGCTGAAT

[0089] CAAATCAAAGAATACCCATTTCCAAACTTCAATAGATCTAAATTTTAAACAAGTCTTTTAAAAGTTACAATGTTAACAGTTGCAAACACAATAC[A / G]ATCTTGCCACTAGCCTAACCAGTGTTACCTGCCATATTATAATTATTATTATTAT TATTATTAGATGTGTTGCTAACTATATGTCCAAGGGTTTGAGAATTAAAGGTACTCACTATGCATTGCTTCTGATGTACTTGAAGTTCAATACTCCAGCCGAGCTTTCGGCATAGTACTCCGTAGATTCGCAGTCTGGCAGACATCCACATGCCCTTCCAGTTACTTTCTCCAGCGTCGTGAAATCTTTCGATGTAACGTTATGACCAAGTGATGCACTGATCAATAACTCTTCAAGGAAAAAACTTATTGTTACATAACGTCCCTTAAATCCACATATAAAACTCCCTCATTCTTGGTGAGACTCGTTATTACGGTACAGGCATTGAACAACATATGGAAACCT。

[0090] 3. Burundi

[0091] >CAVLJG010000004.1_39379808-39379808:._us:400_ds:400

[0092] CAVLJG010000004.1_39379808_A_G

[0093] TGGTTGTTTTAGGTGATTCGATTCAATGGTTTTGATCCTGGCCTGTCATAACACATCCAAAAAATGGCGTCAGGT

[0094] AGGCTGACTCACATAAAGGGAATCTGTAATGCTAAGCTTGTAGCCCCATCCCTGGGATATACTCCGAACTTTTTATA

[0095] GAGTCTATACGAACTGTTATAAAACCCTTTAAAAATATAGAATACCTTTGGGCTTCCCCCTTACACTGTGGAGCTAA

[0096] ATTTGATTTGAATATTCAAATGATACAAGATATTTTAAGTAAAATGAGGCTCAACCTAATTTTATTTCTAAAATGTT

[0097] TATTTTTTTAATACAATACATAAAAATACCTGTTATTCAAGTTGTTTGTAATCTAAAAATAATCGGTATTACCGATGTACCGTGTAAATTTACA[A / G]TTGGCAATTTCTCTACATGAGTTTCGGGACTATCTAAACATTTTCCGAAACCATA CCTAAAAAAAGAATTGAATTTCATTATTTTTATGCTAGGTAAATTTTTCCAAAGATTGTGCAAACCGTAAATACTGTCAAAGTTTTTAGGACACCAAAATATTCGAATCATTTAATCCTGATTATTCGCCGATTACACAGTGCATCTACCTGATTTATATACATATGTGATAAAAGTTATTACTTACTTGAAGATTGAAGTTCAGGAAGATGTAATGTGAGGCAAGCAGTTCATTTCAGGCCTCTCTTCGTTCCAGGCACTTTATCACGCACCACATGTCCTATATAAATTTATTCGTGACTTTTATTGTCCAAAACTGGATTTCGCTCTTGCTGGATCCATTTG。

[0098] 4. Germany

[0099] >CAVLJG010001675.1_546923-546923:._us:300_ds:300

[0100] CAVLJG010001675.1_546923_T_G

[0101] TTCTTGCATTTTGCAAAAAGACTCATGATTAATCGAAATGAAATTTTTGTGTTATGCTGATGCAGACTGATCTGG

[0102] AAACAGTGCGGTGTGGCAGCGTTGTAATTATTTAGAATGATTGATGACCGGGTGACACAAGAATGAAGTTGGATTGT

[0103] TTTTTTCGGGAAGTGAAAAATGATGTTTAGGTTTAAGTATTCATAATCGCTGCGCCTGTTTAATTAAGAGCTAGGTGATTAGTTCGTGTTTTTCCCCTCTGAACTTTTGGTCCTCCAAATGAAAAAGACCGCAGTTTTATTTTCGCTT[T / G]GCCGCAAAATTGGACAGAAGAATCACTCTTTTCGCAACACCGAGATTTTATGGTAGATCCAAAATCCAACAGAATGATAAAGGCAGGAATATTGACTTAGCTAGGTTTAAGATAAAATTTGCAATTATAAAAGAATGTGTCTGTACAGACAGTAAAATTCAACTTCAAATTCTTATAAACCAATCTTGAGCTTGAAGATGCCTTTCTATGGTATAAAAAATTCGTAACGTATGTCCTAAAAGTTTTGACACAAAGTATTTATCTGATTTTTTTAAATGAAGAAATTTATTCAAACACTAA。

[0104] 5. Congo

[0105] >CAVLJG010000005.1_92046044-92046044:._us:400_ds:400

[0106] CAVLJG010000005.1_92046044_A_C

[0107] GTACTGGAGATGGTTACCATTGTGGCTGAAACATATACGTTAAAGAAGAATTCCAAATATATGTAATTTCATTGG

[0108] CCAGACAAACGTGCGGGATTATCAATATGAAAACCTAAGGAAAAGTTTCAGATGTTACATTACCCTGAATCATACTC

[0109] GTATATCAATTATAAAACTAAAATTATTCAAAAAACAGGATACCTACTCCCTGACTTTGACATATGACTGACATGTT

[0110] TCTGTTGATTTCAGCATATTAATTTTCTCTCCTCCGACTATTGTTTTGAATAGATAAATAAGAAACATTTCTCTGCA

[0111] GATATCAAATTATTACTCAGCAATTAATAAGAATTATAAAATATTACTATTTTTTTCTTTAAAAGTATTTAACCCAAATCCCACATCATGAACA[A / C]CACTGGAGAAGAAAAAACAGGTATACATCAGAAAGTTGTTTCTTAATACATTCTA GCCATGTATCGATTTTTATTAAAATTTTTAAGAGTAATATAGATATTATAAAAAGGTTTTCAAAACTTTATCCTCATGGTTCTAAAATACTTGAACTGATGAAACACCCTGTATATTATCCATGTCTAGTCCCTAGTCAAACTTTCACGTCAATAATATCTGATGTTTTTTCTGTGATGGTGCAAGAATTATAGTTTATATTTAACTAGTTAGCCCTTTTACACACAAGACGATTACTCCGAAAATTATGGTCATAATTCTGCTGAAAATTTGCATGGAAAAAATATTGAAGATTTTGTCTACAACCAGTATGACACAAGCAAACAAAATTTCCCAGTAATTCAT。

[0112] 6. Guizhou

[0113] >CAVLJG010000007.1_48615734-48615734:._us:300_ds:300

[0114] CAVLJG010000007.1_48615734_G_A

[0115] TGCTTCAAAATTTTAGTCTGTTCAGCGCTTCAATGATGTGGAAGATTGCATTTATAAAACCATGGTTATACAAAA

[0116] TCTTGAGTTTCTTATTTTGAGAAAAATACGCATTTTTTGACGCACCTTATCTTTAATTTTGAATACATCGCTCAATT

[0117] TAGAAACCACCTTTAACATGAAGGACATTACCGAGTCCTAATTCTTTTGGAGATAGATCTACATGAAGCAATTTCTGCTTGTTCTAGAACATTACATTTCCATGAATTTTCTAAACCTTTGCAGGTGCAGCTTAAAACGTTCATTAAT[G / A]TGATTCCCTACCAGGACTGCCGTAACGTCAATAAAGTAATTTGTTTAAAGAGAAACATAATGCAGTAATGGATCTAAACATGTATGTCTAATGGAATGTCGACCCCTGACTTTCGGTGCAGTTGTTATCCATCTGATAAATGTGGCATATCTTTGTACAAAAGCAGGTTAGGCCCTCAGCCACAATCGGGACGATTTTGCCAGTTTCCAGGTGAACTACTATTTTGTCATGACGGGCGTAGCTAAGCTTTCGTAAAATCGTAAAGATATTGTGAAAGCGTCGGATATCTTGGTTATTCGT。

[0118] 7. Cameroon

[0119] >CAVLJG010000003.1_110012864-110012864:._us:500_ds:500CAVLJG010000003.1_110012864_T_A

[0120] AAAAGGCCATTACCGTCAACGGGAAACGTTATCGCGGCATGTTAACAGAGTTTTTGTGGCCACAAATGGATCGTA

[0121] TTGGTGCCGACGATCTTTGGTTTCATCAATACGGAGCAACGGCTCACACATCTCGCGAAACAATCGCATTATTGCAC

[0122] ACGAAATTTCAAGACCGCATAATTTCACGAAATTCCGATGTCAGTTGGCCCCCGAGATCGTGCGATTTAACATCTCT

[0123] TGACTATTTTCTTTGTGGATTTCTGAAAGGAAAAGTGTATGCGAATGGTCCTCGGACAATTCAAGACCTAAAGCGCA

[0124] ATATTCGGACTAAAATTGCGGCCATAGACCCGATTATTCTGGGGAAAGTCATTGAAAATTTTGATGTTCGGATGTTG

[0125] GCCTGTAAACGAAGCCGCGATGGTCACATGACTGATGTTATTTTTCATTCATAAATGGCATAAACCAACCTTCATTTATCAATAAAAAAATTCGATTTCACCTCGTAAAAATCGGGT[T / A]GATTTTTCAAATAGAAAAAAAAGTAATAGATG TCGCATCCTGAATTATCTGAGAACTTAGAAGTACCTATTGTAAATTGCATCATCAATGAACGGCACATCACCTTGACTACATTCTACGATTCATGATATCCCGCATCAGATTATTTCATATTTCGACAAAATCTGGAGTCTGACTCAATAGTTATTCTCCTTTTCCCATAACATACTGGTACCACCCAGTCGAGTGGGTTTGGCAGAATGGCAGATGATTTACAATGGATTGTTGCACTTTATAATTAAAATGATAGCGATTATAGGAGTGCAATGCCTTCGGACTGATTGTATAAAGAAAGCCGTTGGAGAGAAAAATTGGCAGCGCATTGAGCATTAGGTGTGTCTGATATATGCACCAGTGGCATCGAAGTGGTTTTGTGAAACTCAAATTGAGTAATGAAGACCGGTCACCCTTTATAGGTTTTTCGTAACATCGGAGATATTGAGGTTATAAGACTAACATGA。

[0126] 8, Uganda

[0127] >CAVLJG010000008.1_23872448-23872448:._us:400_ds:400

[0128] CAVLJG010000008.1_23872448_G_T

[0129] TTCATCTCTTATATTTTTTTGGACGTTCAAATACGAGGTTGGTTATCTCCAGCTAAAATGCGTTAATCAATTATC

[0130] GTATCTATTTGTCGGTGCACAGCGATAAGCAATGAGAAAAAAATTAAAGGTGGCTCACCGACCCGCATTCCAGGAGT

[0131] AACGGAGCACTAGTTCAAAACAATTGGACATGTACCTTGCCCAAATTAAAAATAATGCAATAACTCCTGAACCGCGA

[0132] TGGCGCCATTTTCCAGCCGGCATATATCACTGGCCGAAATTAGGTATCAGACGTTAATGAAAGCTTAGCCTTGGAAA

[0133] TCCCGGCCTAAGCCTAGGGGAGGGGGTATTATGCAAGTGGGGTCCAGAATGCCGGGATATGCGATTGTTATGTGTTGATCAAGAAAGCAGGGAG[G / T]GCCGTTACGCGGGTAATTGTGGGGTGGCTATTGCTTTTTTAACCAAATACCCGGG GTGATAATGGCCCCTGATTACGTCTCGACCCCCGAACAGATTAATTCCTACGGCGGCGTCGCGTTGGCTGGATATTGCCTGCTGCTCCTGTTCGTTGATGCTCTTTTATTTTTACGGGGCCAAAGAGGGATCTGATGGAAATTATCTAATAATTTTCACGCTTCGAAGTTCTTACCGGATATTACTGGGGCTGGCAGAAGGTCCCGTTTTGACTTACCCGACCAAATGCAATGGGGTAACATCAACCTAGTCAAATTTGTTTTTATAGTAGCTCAAATAGATTGTTTACATCCAGTTTTCAAGGATAAAACAGTTTATCATCGTTTTTTACTCCCCACGTTCACT。

[0134] 9, Yunnan

[0135] >CAVLJG010000002.1_20116048-20116048:._us:400_ds:400

[0136] CAVLJG010000002.1_20116048_C_A

[0137] TATGCGAGTGCCGCTGAAGAGGGAGAGTTAACTCCAGAATTAGTGATGTTAATGAAAAAACTCTGGGCAGACCCA

[0138] GGTGTGCAGCTATGTTTTTCACGTTCCAGAGAATATCAATTGAATGATTCTGCAGCATACTACCTGAATCCTTAGAC

[0139] AGGATTTCGAAGCCTAATTATGTGCCTTCACAACAAGATGTACTTAGGACACGGGTGAAAACAACTGGGATAGTTGA

[0140] AACAAACTTTTCCTTCAAAAACTTACATTTCAAGTAAGTTGATGTCAGAGCAGATCGTAATGAATTTAATAATGGAT

[0141] TATTGAATTATTTCTTTGCAGGATGTTTGATGTTGGCGGGCAAAGATCAGAAAGGAAAAAATGGATACACTGTTTTGAAGGTGTCACAGCAAT[C / A]ATTTTCTGTGTTGCACTATCAGGTAAAATATTCATTACTATTTATCTAATAATTGG AACAAAAAAGATAACTCATCGAAAAATTGATTGATAGTTTTGTCGTCTGAGATCCTCGGGTCAGTCCTCAAATCAATCTGACATCGGATTTGGAATCTACACACCAAATTTACCCGTAAAATGAGTTTTTACCCACATCACAGGTACTAGAAATTGTTTATGACAACTTGCCTTGCAAAATTCACGTATAGGTTTTTCCATAGCAACAAGCCGATGAAAATCGGTACAGTTAGATAATTTAGGACGCTGCATCCAAATATGATGATCAACGGATTTTAAGGTGTCGTTTGGTCAAATTTTGGGCAGAAACTTAGTCGCCCAAGATCATTTGTCAGCCCCAGTCT。

[0142] 10. Chile

[0143] >CAVLJG010000001.1_76234-76234:._us:400_ds:400CAVLJG010000001.1_76234_T_A

[0144] TCTCGTATACACTGAATATACTTACTGTTTGGAAAGCCAAGCATAATGTTCAAACGCCAATTCCTGAAACCCTAT

[0145] CCTGCTTCTGAATCGATCGATGTGAGATTTAAACGTTGAAATAGCATCCCTCGCTAGATTTAGAAGAAACAGAAGCC

[0146] GGCATATTTTGTAGTTGATGAAACCGGCAATGGTGCCGGATCTCGAGCGAGTTCGTGTCCACTATTCGTATTTCTAAC

[0147] AGGTTTTCATATGCGTGGTTGTAGTGCCTGAAAATATGCATCATCACCTGCGCGCCAAGTCGACGTAAACATGAACA

[0148] CAATTCATGAAGAAATCCGTGGATTACTATAATTGTTTTTTTTTGTTAATATCTTAATTGATCTTCTAAATTAATTAGTCATTGTTGGACTTCT[T / A]AATTTCCAAAATTCGATGGTTCCACAGAATTTTCAAAATTTATAAATCGATATTT TTCAAGATTATTGAACTGTCATCGGCAAAAAATAGCAGCTAAAATGATCCAAAGATTTAAAATTTACAAATTTATTAAAGATTTAAAAAATCGGAATTTCCAAATCCTCAGTTTACCAAATTTAAAATTCCAGAAAAGACTTCATAATTTGACCTTTCCAAATTTTCCAAGT GCAAATTTTGGGGCGCATTTAACTATAATTATTAATTTTCATAACATAATTTTGTAAATAGCAACTAAAAAAATAATCTTGCAACTTTTTTGTTATTATCTTAATTTTTATATTGATCTTATTACAAATTAATTAGTCATACTTGATTGTTGGACTTTCCATTGCAGTAACA.

[0149] This yielded a set of SNP molecular markers for tracing the origin of bean weevil populations in 10 countries and regions. The population origin, sample size, and SNP genotypes used in the screening are shown in Table 1.

[0150] Table 1. Number of samples and source SNP information for 10 geographical populations of the common bean weevil.

[0151] Geographical origin of populations Population ID Number of samples Reference base Mutant bases genotype Germany GER01 6 G T 1 / 1 Guizhou GZ01 30 A G 1 / 1 Ethiopia ETH02 8 G A 1 / 1 Angola AGO 4 G A 1 / 1 Yunnan YN02 30 A C 1 / 1 Chile CHI 2 A T 1 / 1 Cameroon CMR01 3 A T 1 / 1 Burundi BI02 4 G A 1 / 1 Congo CG 9 C A 1 / 1 Uganda UGA 7 C T 1 / 1

[0152] List of SNP source marker sites and their detection primers for the common bean weevil population established in this invention 2.

[0153] Table 2 Primer sequences for SNP combination site detection in the geographical population tracing of common bean.

[0154]

[0155] Based on the source tracing detection sites (Table 1) and their detection primers (Table 2), genomic DNA was extracted from single bean weevils that may cover samples covered by this invention. The target detection sequences of the bean weevil population samples were amplified (PCR) using the source tracing detection primers (Table 2) provided by this invention. The ab1 sequencing file was opened with SnapGene to locate the flanking sequences of the SNPs. The target region was determined on the sequencing peak diagram based on the flanking sequences of the SNPs (typically 10 bp). The source of the sample could be determined based on the SNP type.

[0156] The specific steps are as follows:

[0157] Sample taking

[0158] The samples must be insect bodies or tissues with undegraded DNA and free from pathogen infection.

[0159] Genomic DNA extraction

[0160] Use a commercial kit suitable for micro-sample extraction (such as QIAGEN's DNeasy Blood and Tissue Kit (50) or other equivalent kits), and refer to the instructions for use for extraction methods. For micro-insect sampling, single-headed insects are generally preferred. Before eluting the DNA purified by the separation column, try to remove organic solvents such as alcohol, and test the DNA concentration and quality of the eluted solution.

[0161] SNP source site sequence amplification

[0162] Based on the population samples to be tested, the SNP sites were amplified using the source primers in Table 2.

[0163] Amplification system and conditions

[0164] The amplification system is prepared in 25 μL as an example (Table 3). If the DNA template concentration is less than 10 ng / μL, the amount of template should be increased appropriately.

[0165] Table 3. PCR reaction system mixtures and dosages for COI sequences.

[0166] Reagents used Dosage / μL ddH2O 18.7 10×LA enzyme buffer 2.5 dNTP (2.5 mmol / L) 2.0 Upstream primer (20 mmol / L) 0.3 Downstream primer (20 mmol / L) 0.3 DNA template 1.0 LATaq DNA polymerase 0.2

[0167] The PCR reaction conditions were as follows: PCR reaction conditions were: pre-denaturation at 94℃ for 4 min before cycling; denaturation at 94℃ for 30 s, annealing at 50℃~58℃ (depending on the specific primers) for 30 s, extension at 72℃ for 45 s, 36 cycles, and a final extension at 72℃ for 10 min. The system temperature was then lowered to 12℃ to end the PCR amplification.

[0168] Sequencing of amplified products and determination of SNP sites

[0169] The amplified products are usually sent to a sequencing company for sequencing. The origin of the trace population is determined by checking the matching of the target site with the reference bases of the trace population based on the sequencing peak diagram.

[0170] List 4 shows the verification results of SNP source loci for 10 bean weevil populations. The verification loci identification map is based on a population in Germany. Figure 1 .

[0171] Table 4. Validation results of SNP detection sites for the origin of the bean weevil population.

[0172]

[0173] Based on the amplification peak diagram of SNP source loci obtained from the German population using primers GER-6923-F / GER-6923-R, and referring to Table 3 for specific population source loci genotypes, the origin of the tested population was determined. The source SNP genotype for the target population in Germany was GG, while the genotypes for other populations in Ethiopia, Angola, Burundi, Congo, Guizhou, Cameroon, Rwanda, Uganda, Yunnan, and Chile were all TT. Figure 1 ).

[0174] Based on the SNP amplification peak diagram of the source loci obtained from the Yunnan population using primers 6048-F / 6048-R, and referring to Table 3 for specific population source loci genotypes, the origin of the tested population was determined. The source SNP genotype of the target population in Yunnan was AA, while the genotypes of other populations in Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, and Chile were all CC or AC. Figure 2 ).

[0175] Based on the amplification peak diagram of SNP source loci obtained from the Guizhou population using primers GZ-5734-F / GZ-5734-R, and referring to Table 3 for specific population source loci genotypes, the origin of the tested population was determined. The source SNP genotype for the target population in Guizhou was AA, while the genotypes for other populations in Ethiopia, Angola, Burundi, Germany, Congo, Cameroon, Uganda, Yunnan, and Chile were all GG. Figure 3 ).

[0176] Based on the amplification peak diagram of SNP tracing loci obtained from the Ethiopian population using primers 9353-F / 9353-R, and referring to Table 3 for specific population tracing loci genotypes, the origin of the tested population was determined. The tracing SNP genotype of the target population, Ethiopia, was GG, while the genotypes of other populations, including Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan, and Chile, were all AA (…). Figure 4 ).

[0177] Based on the amplification peak diagram of SNP source loci obtained from the Angolan population using primers 0510-F / 0510a-R, and referring to Table 3 for specific population source loci genotypes, the origin of the tested population was determined. The source SNP genotype for the target population, Angola, was GG, while the genotypes for other populations, including Ethiopia, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan, and Chile, were all AA. Figure 5 ).

[0178] Based on the amplification peak diagram of SNP source loci obtained from the Burundi population using primers 9808-F / 9808-R, and referring to Table 3 for specific population source loci genotypes, the origin of the tested population was determined. The source SNP genotype for the target population, Burundi, was GG, while the genotypes for other populations, including Ethiopia, Angola, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan, and Chile, were all AA. Figure 6 ).

[0179] Based on the amplification peak diagram of SNP source loci obtained from primers 6044-F / 6044-R for the Congo population, the genotypes of specific population source loci in Table 3 were used to determine the origin of the target population. The source SNP genotype for the target population in Congo was CC, while the genotypes for other populations in Ethiopia, Angola, Burundi, Germany, Guizhou, Cameroon, Uganda, Yunnan, and Chile were all AA. Figure 7 ).

[0180] Based on the SNP amplification peak diagram of the Cameroonian population using primers 2864-F / 2864-R, and referring to Table 3 for specific population genotypes, the origin of the tested population was determined. The genotype of the source SNP in the target population of Cameroon was AT, while the genotypes of other populations from Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Uganda, Yunnan, and Chile were all TT. Figure 8 ).

[0181] Based on the SNP amplification peak diagram of the Ugandan population using primers 2448-F / 2448-R, and referring to Table 3 for specific population genotypes, the origin of the tested population was determined. The genotype of the source SNP in the target population of Uganda was TT, while the genotypes of other populations from Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Yunnan, and Chile were all GG. Figure 9 ).

[0182] Based on the amplification peak diagram of SNP source loci obtained from the Chilean population using primers 6234-F / 6234-R, and referring to Table 3 for specific population source loci genotypes, the origin of the tested population was determined. The source SNP genotype for the target population in Chile was AA, while the genotypes for other populations in Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, and Yunnan were all TT. Figure 10 ).

[0183] The SNP loci for tracing the population of the common bean weevil in this invention are obtained by screening for genomic sequence variation sites. Its technical advantage lies in the richer selection of candidate SNP screening sites for population tracing, and the more stable and reliable sites that can be selected, which can effectively ensure the quality of the test results.

[0184] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Anyone skilled in the art can make various modifications and alterations without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be defined by the claims.

Claims

1. A detection primer for detecting a bean weevil population traceable SNP molecular marker, characterized in that, It comprises one or more of the following primers: The detection primer of the traceable SNP site molecular marker for the German population is GER-6923F / GER-6923R, the forward primer sequence is TTAGAATGATTGATGACCGGGTG, and the reverse primer sequence is ACCATAGAAAGGCATCTTCAAGC; The detection primer of the traceable SNP site molecular marker for the Guizhou population is GZ-5734F / GZ-5734R, the forward primer sequence is AACATGAAGGACATTACCGAGTC, and the reverse primer sequence is TAACCAAGATATCCGACGCTTTC; The detection primer of the traceable SNP site molecular marker for the Ethiopian population is 9353F / 9353R, the forward primer sequence is CTTCTCCCACTCCCAGTCTC, and the reverse primer sequence is GACAAATCCGTGGTGGGAAC; The detection primer of the traceable SNP site molecular marker for the Angola population is 0510F / 0510a-R, the forward primer sequence is TATCCCCACTAGGTCGTTGAAG, and the reverse primer sequence is AGTGCATCACTTGGTCATAACG; The detection primer of the traceable SNP site molecular marker for the Yunnan population is 6048F / 6048R, the forward primer sequence is ACACGGGTGAAAACAACTGG, and the reverse primer sequence is TCATCGGCTTGTTGCTATGG; The detection primer of the traceable SNP site molecular marker for the Chile population is 6234F / 6234R, the forward primer sequence is GCCAATTCCTGAAACCCTATCC, and the reverse primer sequence is TTAAATGCGCCCCAAAATTTGC; The detection primer of the traceable SNP site molecular marker for the Cameroon population is 2864F / 2864R, the forward primer sequence is TGTTGGCCTGTAAACGAAGC, and the reverse primer sequence is ACCTAATGCTCAATGCGCTG; The detection primer of the traceable SNP site molecular marker for the Uganda population is 2448F / 2448R, the forward primer sequence is TCTATTTGTCGGTGCACAGC, and the reverse primer sequence is ATCAGATCCCTCTTTGGCCC; The detection primer of the traceable SNP site molecular marker for the Burundi population is 9808F / 9808R, the forward primer sequence is TAAGCTTGTAGCCCCATCCC, and the reverse primer sequence is AGATGCACTGTGTAATCGGC; The detection primer of the traceable SNP site molecular marker for the Congo population is 6044F / 6044R, the forward primer sequence is AACAGGATACCTACTCCCTGAC, and the reverse primer sequence is ATCGTCTTGTGTGTAAAAGGGC.

2. The detection primer of claim 1 in the application of bean weevil geographical population tracing detection, the bean weevil geographical population is selected from Guizhou, Ethiopia, Yunnan, Burundi, Cameroon, Congo, Uganda, Angola, Germany and Chile.

3. A bean weevil population source detection method of a bean weevil geographical population source SNP molecular marker, characterized in that, The method comprises the following steps: Single-end extraction of genomic DNA from bean weevil samples, amplification with the detection primer of claim 1; sequencing or amplification peak map according to the amplification product, and determining the source of the test population by referring to the specific geographical population tracing site genotype; The specific determination criteria are as follows: According to the SNP tracing site amplification peak map obtained by amplification with primers GER-6923F / GER-6923R, the tracing SNP genotype of the Germany population is GG, and the genotypes of Ethiopia, Angola, Burundi, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all TT; According to the SNP tracing site amplification peak map obtained by amplification with primers 6048F / 6048R, the tracing SNP genotype of the Yunnan population is AA, and the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda and Chile are all CC or AC; According to the SNP tracing site amplification peak map obtained by amplification with primers GZ-5734F / GZ-5734R, the tracing SNP genotype of the Guizhou population is AA, and the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Cameroon, Uganda, Yunnan and Chile are all GG; According to the SNP tracing site amplification peak map obtained by amplification with primers 9353F / 9353R, the tracing SNP genotype of the Ethiopia population is GG, and the genotypes of Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP tracing site amplification peak map obtained by amplification with primers 0510F / 0510a-R, the tracing SNP genotype of the Angola population is GG, and the genotypes of Ethiopia, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP tracing site amplification peak map obtained by amplification with primers 9808F / 9808R, the tracing SNP genotype of the Burundi population is GG, and the genotypes of Ethiopia, Angola, Germany, Congo, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP tracing site amplification peak map obtained by amplification with primers 6044F / 6044R, the tracing SNP genotype of the Congo population is CC, and the genotypes of Ethiopia, Angola, Burundi, Germany, Guizhou, Cameroon, Uganda, Yunnan and Chile are all AA; According to the SNP tracing site amplification peak map obtained by amplification with primers 2864F / 2864R, the tracing SNP genotype of the Cameroon population is AT, and the genotypes of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Uganda, Yunnan and Chile are all TT; According to the amplification peak map of the SNP tracing locus amplified by the primers 2448F / 2448R, the genotype of the tracing SNP of the Uganda population is TT, and the genotype of the populations of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Yunnan and Chile is GG; According to the amplification peak map of the SNP tracing locus amplified by the primers 6234F / 6234R, the genotype of the tracing SNP of the Chile population is AA, and the genotype of the populations of Ethiopia, Angola, Burundi, Germany, Congo, Guizhou, Cameroon, Uganda and Yunnan is TT; The geographical population of the bean weevil is the population of Guizhou, Ethiopia, Yunnan, Burundi, Cameroon, Congo, Uganda, Angola, Germany or Chile.

4. The bean weevil geographic population source detection method of claim 3, wherein, The method for extracting the single-head genomic DNA of the bean weevil sample is performed by using a kit suitable for the extraction of a trace sample.

5. The bean weevil geographic population source detection method of claim 4, wherein, The amplification condition is as follows: pre-denaturation at 94℃ for 4 min, denaturation at 94℃ for 30 s, annealing at 50-58℃ for 30 s, extension at 72℃ for 45 s, 36 cycles, final extension at 72℃ for 10 min, and the system temperature is reduced to 12℃, and the PCR amplification is ended.

6. The bean weevil geographic population source detection method of claim 5, wherein, The amplification system is prepared in an amount of 25 μL, if the concentration of the genomic DNA template is adjusted to be not less than 0.4 ng / μL, and the amount of the upstream primer and the downstream primer is 0.24 mmol / L respectively.

Citation Information

Patent Citations

  • Molecular marker sequence and detection method of callosobruchus maculatus

    CN105200127A