Litopenaeus vannamei Lvpsma5 gene hypoxia resistance character related SNP molecular marker and application thereof

Abstract

The invention discloses a litopenaeus vannamei Lvpsma5 gene hypoxia resistance character related SNP (Single Nucleotide Polymorphism) molecular marker, the SNP molecular marker is located at the 904th site from the 5'end of a nucleotide sequence shown as SEQ ID NO: 1 of the litopenaeus vannamei Lvpsma5 gene, and the basic group of the SNP molecular marker is T or C; the invention also discloses a primer and a kit for amplifying the SNP molecular marker, a method for detecting the low-oxygen-resistant character of the litopenaeus vannamei, a reagent for detecting the SNP molecular marker, and application of the primer, the kit or the method in identifying or breeding the low-oxygen-resistant character of the litopenaeus vannamei variety. The hypoxia resistance character of an individual with the genotype of TC genotype of the SNP molecular marker is obviously higher than that of an individual with the genotype of TT; the molecular marker can be used for molecular marker-assisted breeding and genetic improvement of the litopenaeus vannamei, the hypoxia resistance of the litopenaeus vannamei is improved, and the culture benefit is increased.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a SNP molecular marker related to the hypoxia resistance trait of a Lvpsma5 gene of a vannamei shrimp and an application thereof. Background Art

[0002] Litopenaeus vannamei belongs to the order Decapoda, family Penaeidae, genus Penaeus. It is a shallow-water crustacean native to tropical and subtropical waters and is widely distributed in countries along the Pacific coast. It is deeply loved by consumers because of its delicious meat, rich in protein and various trace elements, and high nutritional value, and has important economic value. However, Litopenaeus vannamei is relatively sensitive to environmental changes, especially its ability to adapt to low oxygen conditions, which seriously limits the sustainable development of aquaculture. Therefore, it is urgent to carry out molecular genetic breeding research to analyze the genetic mechanisms related to important economic traits.

[0003] In recent years, although the academic community has conducted certain research on the artificial breeding, population genetics, genomics, hypoxia and salinity adaptability of Penaeus vannamei, there are still few reports on the development and application of molecular markers related to hypoxia tolerance. Molecular marker-assisted selection breeding technology selects breeding materials through DNA molecular markers to improve important economic traits of species. Single nucleotide polymorphisms (SNPs), as the third-generation molecular markers, have been widely used in the field of animal and plant molecular breeding research due to their high polymorphism, genetic stability and easy detection. It has opened up a new path for crustacean breeding and demonstrated its unique superiority.

[0004] Due to the incomplete assembly of the early reference genome of Penaeus vannamei, it is very difficult to develop SNP markers related to the low dissolved oxygen tolerance of Penaeus vannamei. At the same time, due to factors such as the low accuracy of first-generation sequencing and the high cost of second-generation genome sequencing, there are fewer individuals in the experimental population that can be effectively tested, resulting in the developed SNP markers being unstable. Therefore, there is an urgent need to further screen SNP markers to identify genetic markers that are more closely related to low oxygen tolerance.

[0005] Therefore, the present invention aims to develop a SNP molecular marker significantly associated with the hypoxia tolerance trait on the Litopenaeus vannamei Proteasome subunit alpha type-5 (Lvpsma5) gene of Litopenaeus vannamei, so as to improve its environmental adaptability and aquaculture efficiency, increase its economic value and ecological value, and provide a new perspective for understanding the adaptation mechanism of crustaceans to hypoxic environments; through molecular marker-assisted selection breeding technology, the hypoxia tolerance trait of Litopenaeus vannamei can be more efficiently improved, thereby improving the overall benefits and sustainable development capabilities of the aquaculture industry. Summary of the invention

[0006] The purpose of the present invention is to provide a SNP molecular marker related to the hypoxia tolerance trait of the Lvpsma5 gene of Litopenaeus vannamei, a primer for amplifying the SNP molecular marker and a kit for detecting the SNP molecular marker.

[0007] The present invention also aims to provide a method for detecting the hypoxia tolerance trait of Penaeus vannamei.

[0008] The last object of the present invention is to provide a reagent for detecting the SNP molecular marker, and the use of the primer, kit or method in identifying or breeding varieties of Penaeus vannamei with hypoxia tolerance traits.

[0009] The above first object of the present invention can be achieved by the following technical scheme: a SNP molecular marker related to the hypoxia tolerance trait of the Lvpsma5 gene of the vannamei shrimp, the SNP molecular marker is located at the 904th position from the 5' end of the nucleotide sequence of the Lvpsma5 gene of the vannamei shrimp as shown in SEQ ID NO: 1, and its base is T or C.

[0010] The research group of the inventor of the present application carried out whole genome sequencing of a large population of Penaeus vannamei, and compared the obtained sequencing data with the reference genome of Penaeus vannamei (NCBI: GCF 042767895.1) assembled by the third-generation sequencing technology, and used GATK (-type Unified Genotyper) software to identify and filter SNPs to obtain a usable SNP data set; based on the parental genotype detection results of the reference genome, polymorphic markers between parents and offspring genotyping were developed, and the chi-square test was used to filter the skewed segregation markers, and the Joinmap 4.0 software was used to construct a genetic map for the high-quality genetic markers obtained after screening; the Interval Mapping method of the R package qtl was used to locate QTLs, and the molecular markers on the genetic map were linked to the hypoxia tolerance trait. It was located that the Lvpsma5 gene of Penaeus vannamei was related to hypoxia tolerance, and there was a SNP marker in the intron region of the Lvpsma5 gene.

[0011] The SNP molecular marker described in the present invention is significantly correlated with the survival rate of Penaeus vannamei under hypoxia stress.

[0012] The present invention takes the SNP site of the Lvpsma5 gene of Penaeus vannamei as the research target, and finds that a SNP site (g.904T>C) located in the intron region of the Lvpsma5 gene is significantly correlated with the hypoxia tolerance trait of Penaeus vannamei, so the SNP molecular marker is screened and obtained.

[0013] The present invention has been further verified by small group experiments and large group tests, and found that in the identification of the SNP sites of the Lvpsma5 gene of the vannamei shrimp:

[0014] g.904T>C, the hypoxia tolerance of TC genotype individuals was significantly higher than that of TT genotype individuals;

[0015] The SNP sites located in the intronic region of the Lvpsma5 gene of Penaeus vannamei showed significant differences in the hypoxia tolerance traits of each genotype (P<0.05).

[0016] That is, the hypoxia tolerance trait of the TC genotype individuals of the Lvpsma5 gene of the present invention as the 904th SNP molecular marker shown in SEQ ID NO: 1 is significantly higher than that of the TT genotype individuals.

[0017] The hypoxia tolerance trait is the ability to survive in an environment with relatively low dissolved oxygen, for example, the dissolved oxygen concentration is within the range from the suffocation point dissolved oxygen concentration (about 0.4 mg / L) to the normal dissolved oxygen concentration (about 7 mg / L).

[0018] The present invention also provides a primer for amplifying the SNP molecular marker, the primer comprising a forward primer Lvpsma5-F and a reverse primer Lvpsma5-R, the nucleotide sequence of the forward primer Lvpsma5-F is shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer Lvpsma5-R is shown in SEQ ID NO: 3.

[0019] Specifically, the nucleotide sequences of the forward primer Lvpsma5-F and the reverse primer Lvpsma5-R are as follows:

[0020] Forward primer Lvpsma5-F: 5'-cttctctggggtgactgctg-3' (as shown in SEQ ID NO: 2);

[0021] Reverse primer Lvpsma5-R: 5'-aaccttgccattcgctttgg-3' (as shown in SEQ ID NO: 3).

[0022] The present invention also provides a kit for detecting the SNP molecular marker, and the kit comprises the primer.

[0023] The above second object of the present invention can be achieved by the following technical scheme: A method for detecting hypoxia tolerance of Litopenaeus vannamei, comprising the following steps:

[0024] (S1) Detection of genomic DNA from muscle tissue of Penaeus vannamei;

[0025] (S2) using the primers, performing PCR amplification on the genomic DNA of the muscle tissue of the shrimp Penaeus vannamei described in step (S1) to obtain an amplified product;

[0026] (S3) sequencing the amplified product of step (S2), and determining the genotype of the SNP molecular marker based on the sequencing result;

[0027] (S4) Determining the hypoxia tolerance trait of Penaeus vannamei by using the genotype of the SNP molecular marker in step (S3).

[0028] In the above-mentioned method for detecting the hypoxia tolerance trait of Penaeus vannamei:

[0029] Preferably, the PCR reaction system used in the PCR amplification in step (S2) is 40 μL, comprising: PCRSuperMix 20μL, 10mM forward primer and reverse primer 2μL each, 40ng / μL DNA template 2μL, balance ddH2O.

[0030] Preferably, during PCR amplification in step (S2), the PCR reaction program used is 35 cycles in total, with pre-denaturation at 95°C for 5 minutes before the cycle, each cycle including denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds, and extension at 72°C for 10 minutes after the cycle ends.

[0031] Preferably, in step (S4), the individuals whose genotype of the SNP molecular marker is TC genotype (g.904T>C) have significantly higher hypoxia tolerance than those of individuals with TT genotype.

[0032] The method for detecting the hypoxia tolerance trait of Penaeus vannamei provided by the invention detects the SNP molecular marker genotype of Penaeus vannamei and determines the hypoxia tolerance of Penaeus vannamei according to the detection result of the hypoxia tolerance trait.

[0033] The last object of the present invention can be achieved by the following technical solution: application of the reagent for detecting the SNP molecular marker, the primer, the kit or the method in identifying or breeding varieties of Penaeus vannamei with hypoxia tolerance traits.

[0034] In general, the present invention discloses a SNP molecular marker related to the hypoxia resistance trait of the Lvpsma5 gene of Penaeus vannamei and an application thereof. The present invention screens the hypoxia resistance trait of Penaeus vannamei, finds a SNP site significantly related to the hypoxia resistance trait of Penaeus vannamei on the Lvpsma5 gene, and designs a pair of primers for amplifying the SNP site. The SNP site disclosed by the present invention is significantly correlated with the survival rate of Penaeus vannamei under hypoxia stress, and the hypoxia resistance ability of individuals with TC genotypes in the SNP site is significantly stronger than that of individuals with other genotypes. The SNP site can be used for molecular marker-assisted breeding and genetic improvement of Penaeus vannamei, thereby improving the hypoxia resistance ability of Penaeus vannamei and increasing the breeding efficiency.

[0035] The beneficial effects of the present invention are as follows:

[0036] (1) The present invention takes the SNP site of the Lvpsma5 gene of Penaeus vannamei as the research target and finds that a SNP site (g.904T>C) located in the intron region of the Lvpsma5 gene is significantly correlated with the hypoxia tolerance trait of Penaeus vannamei;

[0037] (2) The hypoxia tolerance trait of the TC genotype individuals of g.904T>C in the present invention was significantly higher than that of the TT genotype individuals (P<0.05);

[0038] (3) The SNP loci disclosed in the present invention are significantly correlated with the survival rate of Penaeus vannamei under hypoxia stress. The individuals with TC genotype in the SNP loci have significantly stronger hypoxia tolerance than individuals with other genotypes. The SNP loci can be used for molecular marker-assisted breeding and genetic improvement of Penaeus vannamei, thereby improving the hypoxia tolerance of Penaeus vannamei and increasing the breeding efficiency.

[0039] (4) In the genetic breeding of Penaeus vannamei with hypoxia tolerance as the breeding indicator, individuals with g.904T>C locus as TC can be preferentially selected as breeding parents, which has important guiding significance for the selection of new varieties of Penaeus vannamei with excellent hypoxia tolerance traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a sequencing peak diagram of sequencing the PCR amplification product using the Lvpsma5-F primer in Example 2, and the position of the g.904T>C site is shown in the figure. DETAILED DESCRIPTION

[0041] The technical scheme of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments, but it is necessary to point out that the following embodiments are only used to describe the content of the invention and do not constitute a limitation on the scope of protection of the present invention. The reagents or materials used in the examples, unless otherwise specified, are all from commercial channels. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0042] Example 1

[0043] In this embodiment, a genetic map is constructed using data obtained from whole genome resequencing, and RQTL (R / qtl) positioning analysis is performed using genetic markers in the map and the hypoxia tolerance phenotype data of Penaeus vannamei. A SNP site on the Lvpsma5 gene is identified in the QTL region. The site is located at the 904th position from the 5' end of the Lvpsma5 gene of Penaeus vannamei (as shown in SEQ ID NO: 1), and the base is T or C (g.904T>C). The method for screening the SNP site includes the following steps:

[0044] (1) Obtaining Penaeus vannamei populations

[0045] The experiment was conducted at Guangdong Guoxing Aquatic Products Science and Technology Co., Ltd. in China. Before the experiment began, sexually mature male and female individuals of the vannamei shrimp variety "Xinghai No. 1" with good traits were selected as parents, and a semi-directional mating method was used to construct an F1 full-sib family. Under this condition, artificial insemination was used to collect the spermatophores of male shrimp and transfer them to the mating device of mature female breeding shrimp to achieve the required mating. The fertilized female shrimp laid eggs and hatched in isolated pools to obtain the first generation (F1) individuals for family tracking. The offspring were initially raised in a nursery pond for 15 days, and then raised in an outdoor 3.0m×3.0m×1.2m pond for 45 days, with a temperature of 29.0±1.0℃, a pH of 8.0±0.2, a dissolved oxygen of 6.5±0.5mg / L, and a salinity of 22‰.

[0046] (2) Hypoxia stress treatment of Penaeus vannamei

[0047] Nitrogen was injected into the water to reduce the dissolved oxygen content and maintain the dissolved oxygen level at 0.4 mg / L (dissolved oxygen concentration at the suffocation point) to achieve a hypoxic environment. 450 shrimps were randomly selected for hypoxia stress treatment. The time from the start of hypoxia treatment to the time when the shrimp stopped swimming, lost balance and did not respond to touch was used as the phenotypic trait data of hypoxia tolerance. According to the length of the recorded experimental shrimp phenotypic time, 200 individual muscle tissues were randomly collected from the time when the shrimp stopped swimming, lost balance and did not respond to touch to the last shrimp for genomic DNA extraction.

[0048] (3) Whole genome resequencing

[0049] The genomic DNA was extracted from the muscle tissue of the individual obtained in step (2) and its parents, and then a whole genome sequencing library was constructed. The obtained library was sequenced on the BGISEQ-500 high-throughput sequencing platform.

[0050] (4) Genetic map construction

[0051] The obtained sequencing data were aligned with the reference genome of Penaeus vannamei assembled using the third-generation sequencing technology (NCBI: GCF042767895.1), and the software GATK (-type Unified Genotyper) was used for SNP identification and quality control to obtain a usable SNP data set; based on the parental genotype detection results of the reference genome, polymorphic markers between parents and offspring genotyping were developed, and the chi-square test was used to filter out skewed segregation markers. The Joinmap 4.0 software was used to construct a genetic map for the high-quality genetic markers obtained after screening.

[0052] (5) Association analysis between genetic markers and hypoxia tolerance traits

[0053] The Interval Mapping method of the R package qtl was used to locate QTLs, and linkage analysis was performed between the SNP molecular markers on the genetic map and the hypoxia tolerance trait, thereby confirming the SNP molecular markers on the genes in the region related to the trait.

[0054] The results showed that the Lvpsma5 gene of Penaeus vannamei was related to its hypoxia tolerance trait, and there was a SNP molecular marker in the intron region of the Lvpsma5 gene. The SNP marker was located at the 904th position from the 5' end of the Lvpsma5 gene of Penaeus vannamei (as shown in SEQ ID NO: 1), and the base was T or C (g.904T>C). It can be used as a molecular marker for screening hypoxia-tolerant parents of Penaeus vannamei to assist in breeding.

[0055] The nucleotide sequence of the Lvpsma5 gene of Penaeus vannamei (as shown in SEQ ID NO: 1) is as follows:

[0056]

[0057]

[0058] Note: The underline represents the complementary sequence of the forward primer and the reverse primer, and the bold italics represent the SNP molecular markers.

[0059] Example 2

[0060] The present invention also designs primers for the SNP sites obtained in Example 1 to perform PCR amplification and obtain the genotype of the hypoxia-resistant Penaeus vannamei by sequencing, and then screens and obtains the hypoxia-resistant Penaeus vannamei. The specific implementation method is as follows:

[0061] (S1) Acquisition of Penaeus vannamei population

[0062] The same method as in Example 1 was used to obtain a population of Penaeus vannamei, and 80 individuals were randomly selected for hypoxia stress treatment.

[0063] (S2) Hypoxia stress treatment of Litopenaeus vannamei

[0064] Nitrogen was injected into the water to reduce the dissolved oxygen content and maintain the dissolved oxygen level at 0.4 mg / L (dissolved oxygen concentration at the suffocation point) to achieve a hypoxic environment. The time from the start of hypoxia treatment to the time when the shrimp stopped swimming, lost balance and did not respond to touch was used as the phenotypic trait data of hypoxia tolerance. According to the length of the recorded experimental shrimp phenotypic time, muscle tissues of 80 individuals were randomly collected from the time when the shrimp stopped swimming, lost balance and did not respond to touch to the last shrimp for genomic DNA extraction.

[0065] (S3) Extracting DNA of Penaeus vannamei to be tested

[0066] Muscle tissues of 80 individuals were collected and genomic DNA of the samples was extracted according to the CTAB method. The specific steps are as follows:

[0067] (1) Remove individuals that have stopped swimming, lost balance, and do not respond to touch; for subsequent DNA extraction, cut the muscle of each individual and freeze the muscle samples in liquid nitrogen;

[0068] (2) DNA was isolated from the sample using the CTAB technique. The sample was appropriately ground under liquid nitrogen conditions, and approximately 0.1 g of the liquid was transferred to a pre-cooled centrifuge tube, followed by the addition of CTAB and β-mercaptoethanol solution;

[0069] (3) Place the mixed sample in a 65°C water bath for approximately 1 hour, ensuring that it is evenly stirred in the water bath, and then transfer the sample to a centrifuge and centrifuge at 12,000 rpm for 10 min;

[0070] (4) Add a mixture of phenol, chloroform, and isopropanol, mix well, and centrifuge at 12,000 rpm for 10 min. Transfer the upper aqueous phase to a new centrifuge tube;

[0071] (5) Add a mixture of chloroform and isopropanol, mix well, and centrifuge at 12,000 rpm for 10 min. Transfer the upper aqueous phase to a new centrifuge tube;

[0072] (6) Precipitate and wash the sample with isopropanol and anhydrous ethanol, centrifuge, and discard the supernatant;

[0073] (7) Repeat the above steps once, centrifuge briefly, remove ethanol, dry, add appropriate amount of ddH2O, and store at -20°C;

[0074] (8) Finally, the integrity of the DNA samples was detected by 1% agarose gel electrophoresis, and the concentration and purity were detected by NanoDrop2000 micro-spectrophotometer.

[0075] (S4) PCR amplification of target fragment

[0076] For the SNP site 904T>C of the Lvpsma5 gene of Penaeus vannamei, primers were designed from the nucleotide sequence of the Lvpsma5 gene of Penaeus vannamei (as shown in SEQ ID NO: 1) using the software Primer Premier 5. The primers included a forward primer Lvpsma5-F and a reverse primer Lvpsma5-R, which are as follows: forward primer Lvpsma5-F: 5'-cttctctggggtgactgctg-3' (as shown in SEQ ID NO: 2); reverse primer Lvpsma5-R: 5'-aaccttgccattcgctttgg-3' (as shown in SEQ ID NO: 3).

[0077] Using the muscle tissue DNA of Penaeus vannamei extracted in step (S3) as a template, the target fragment (696 bp) was amplified by PCR using the following reaction system and reaction procedure: the PCR reaction system was 40 μL, wherein: PCR Super Mix 20 μL, 10 mM forward primer and reverse primer 2 μL each, 40 ng / μL DNA template 2 μL, ddH2O 14 μL. The PCR reaction program was 35 cycles in total, with 94°C pre-denaturation for 5 min before the cycle, each cycle including 94°C denaturation for 30 sec, 60°C annealing for 30 sec, 72°C extension for 30 sec, and 72°C extension for 10 min after the cycle.

[0078] The target fragment (shown in SEQ ID NO: 4) was amplified by PCR using specific primers as follows:

[0079] cttctctggggtgactgctgcgacctccacatttgtgccgctgaccttctcctccatgacctgcttcaacacagtcagggcaacctttaaggcctcctgtagagtcattgactgaaaagattgagaggaaaaacaaactgaggttagaaaacaatgacaaatttccagatgttcctatactaatagaaacttcccatga taatgataaagtgaactcctctaacatagtatatcaccagtaactatgtaatgccttgggacaaaactacaaaacccactttagttatatacaataaaacaatacatctaaattagtgattgaagtaatttttagatatgaataacatctcag[t(g.904T>C)]ggcaaaaaatagc agttaccttgtggtaggattcttggagggactgctgtgcaccctcagagccagagcctatggcctttgcaccgaactctaggaaggtgccagaggggtccatgtgatacagatgtgagcctgtcttatcaataccagcaaataacatagccacac caaatggacgactctgtggaaatataaaaagaaatttgggaatgtgttatcaatgctatttgcattaacaccaaaaagaaggcagtgaattaataaatacataaccattaaaattcaaaatcattaccattgctggaccatcatcatcagaatca ccaaagcgaatggcaaggtt (shown in SEQ ID NO: 4).

[0080] The underline indicates the location of the forward primer and the reverse primer (forward sequence, which is the base sequence of Lvpsma5-R after reverse complementation), and the square brackets indicate the SNP sites to be detected.

[0081] (S5) Sequencing of PCR amplification products to determine the genotype of the SNP site

[0082] The PCR amplification products of 80 individuals of the above-mentioned Penaeus vannamei were sequenced by direct sequencing (Sanger sequencing) at Shanghai Biotechnology Co., Ltd., and the sequencing peak graph was used for genotyping analysis using Snapgene software. If a double peak appears at the SNP site, it is a heterozygous genotype, and a single peak is a homozygous genotype, thereby determining the g.904T>C genotype.

[0083] Figure 1 The haplotype of the 904th locus of the Lvpsma5 gene in this embodiment is the TC peak graph (g.904T>C).

[0084] (S6) Correlation analysis between SNP genotype and hypoxia tolerance of Litopenaeus vannamei

[0085] The one-way ANOVA in the general linear model of SPSS26 was used to conduct correlation analysis between the genotypes of the above SNP loci and the quantitative traits of hypoxia tolerance. For SNP loci with significant differences, the Ducan method was used for multiple comparison analysis. The analysis results are as follows:

[0086] Table 1 Correlation between SNP loci of Lvpsma5 gene and hypoxia tolerance in Litopenaeus vannamei

[0087]

[0088] Among them, the P value is the result of one-way analysis of variance in the general linear model; the superscript letters in the hypoxia tolerance time represent the results of Ducan's multiple comparison analysis among genotypes, different letters indicate significant differences, and the same letters indicate insignificant differences.

[0089] The results in Table 1 show that there are significant differences between the three genotypes and the hypoxia tolerance trait in the SNP site (g.904T>C) of the Lvpsma5 gene of Penaeus vannamei (P=0.024<0.05), which is statistically significant, indicating that the SNP site is a SNP site significantly associated with hypoxia tolerance; among them, the vannamei shrimp individuals with genotype TC have the longest hypoxia tolerance survival time (i.e. TC is the dominant genotype), and the individuals with genotype TT have the shortest survival time (i.e. TT is the inferior genotype), and there is a significant difference between the two; This shows that in the process of cultivating a population of Penaeus vannamei with hypoxia tolerance, individuals with SNP genotype TC are preferentially selected as parents of Penaeus vannamei for breeding hypoxia tolerance traits.

[0090] Example 3

[0091] The experiment was conducted at Guangdong Guoxing Aquatic Products Technology Co., Ltd., China. 196 60-day-old Litopenaeus vannamei from Zhanjiang, Guangdong were randomly selected and subjected to hypoxia stress treatment using the same method as in Example 1 or 2 for large-scale group verification.

[0092] The genomic DNA of the muscles of 196 Penaeus vannamei shrimps were extracted, and the genomic DNA of the muscles of Penaeus vannamei shrimps was amplified by PCR using the primers described in Example 2. The PCR amplification system and procedure were the same as those in Example 2 to obtain PCR amplification products. The PCR amplification products were sequenced, and the genotypes of the SNP molecular markers were determined based on the sequencing results. The hypoxia tolerance of the Penaeus vannamei shrimp to be tested was determined by the genotype.

[0093] The analysis results are shown in Table 2 below:

[0094] Table 2 Correlation between SNP loci of Lvpsma5 gene and hypoxia tolerance in Litopenaeus vannamei

[0095]

[0096]

[0097] Among them, the P value is the result of one-way analysis of variance in the general linear model; the superscript letters in the hypoxia tolerance time represent the results of Ducan's multiple comparison analysis among genotypes, different letters indicate significant differences, and the same letters indicate insignificant differences.

[0098] The results in Table 2 show that in the large-scale population verification test, TC is still the dominant genotype at the SNP site (g.904T>C) on the Lvpsma5 gene of Penaeus vannamei, and there is a significant difference between this SNP site and the hypoxia tolerance trait (P=0.041<0.05), which is statistically significant.

[0099] Therefore, the above-mentioned SNP molecular markers can be applied to the screening of low-oxygen-resistant Penaeus vannamei populations. Individuals with the genotype TC of the SNP site (g.904T>C) on the Lvpsma5 gene of Penaeus vannamei can be used as breeding objects to cultivate low-oxygen-resistant Penaeus vannamei populations.

[0100] The present invention further studies and finds that the proteasome 20S subunit alpha 5 (Proteasome subunit alpha type-5, Lvpsma5) gene of Penaeus vannamei, as a member of the proteasome 20S subunit, can participate in regulating the transport of oxygen and the adaptation of cells to the hypoxic environment through its protein degradation function under hypoxic conditions, and affect the expression of genes related to cell material metabolism and transport; therefore, the function of the Lvpsma5 gene is closely related to the adaptability of Penaeus vannamei to the hypoxic environment, and is a key factor in improving the breeding efficiency and adaptability of Penaeus vannamei.

[0101] Furthermore, when the SNP molecular marker described in the present invention is used in the breeding process of the hypoxia-resistant trait of Penaeus vannamei, specifically in the breeding process of Penaeus vannamei, the genomic DNA of the tested Penaeus vannamei is extracted, and the primers designed by the present invention are used to perform PCR amplification on the genomic DNA of the tested Penaeus vannamei to obtain PCR amplification products, and the PCR amplification products are sequenced. Based on the sequencing results, the genotype of the SNP site is detected for the candidate population of Penaeus vannamei breeding, and then combined with the genotypes of other sites related to growth traits, disease resistance, and stress resistance, individuals with the SNP genotype of TC described in the present invention are preferentially selected as the parents of Penaeus vannamei for breeding hypoxia-resistant traits.

[0102] Therefore, the reagent for detecting the SNP molecular marker, the primer or the kit can be used in the identification of the hypoxia trait of Penaeus vannamei and in selective breeding.

[0103] In addition, the use of the reagent for detecting the SNP molecular marker, the primer and the kit in evaluating the hypoxia tolerance of Penaeus vannamei also falls within the protection scope of the present invention.

[0104] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. A person skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention, and any improvement and deformation based on the concept of the present invention shall fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.

Claims

1. A SNP molecular marker associated with hypoxia tolerance of the Lvpsma5 gene of Penaeus vannamei, characterized in that: The SNP molecular marker is located at the 904th position from the 5' end of the nucleotide sequence of the Lvpsma5 gene of Litopenaeus vannamei as shown in SEQ ID NO: 1, and its base is T or C.

2. A primer for amplifying the SNP molecular marker according to claim 1, characterized in that: The primers include a forward primer Lvpsma5-F and a reverse primer Lvpsma5-R. The nucleotide sequence of the forward primer Lvpsma5-F is shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer Lvpsma5-R is shown in SEQ ID NO:

3.

3. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The kit comprises the primers according to claim 2.

4. A method for detecting hypoxia tolerance of Penaeus vannamei, characterized in that: The following steps are involved: (S1) extracting genomic DNA from muscle tissue of Penaeus vannamei; (S2) using the primers described in claim 2, performing PCR amplification on the genomic DNA of the muscle tissue of the shrimp Penaeus vannamei described in step (S1) to obtain an amplified product; (S3) sequencing the amplified product of step (S2), and determining the genotype of the SNP molecular marker based on the sequencing result; (S4) Determining the hypoxia tolerance trait of Penaeus vannamei by using the genotype of the SNP molecular marker described in step (S3).

5. The method for detecting hypoxia tolerance of Penaeus vannamei according to claim 4, characterized in that: The PCR reaction system used in step (S2) for PCR amplification is 40 μL, including: PCR SuperMix 20μL, 10mM forward primer and reverse primer 2μL each, 40ng / μL DNA template 2μL, balance ddH2O.

6. The method for detecting hypoxia tolerance of Penaeus vannamei according to claim 4, characterized in that: During PCR amplification in step (S2), the PCR reaction program used is 35 cycles in total, with pre-denaturation at 95°C for 5 minutes before the cycle, each cycle including denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, and extension at 72°C for 30 seconds, and extension at 72°C for 10 minutes after the cycle is completed.

7. The method for detecting hypoxia tolerance of Penaeus vannamei according to claim 4, characterized in that: In step (S4), the individuals whose genotype of the SNP molecular marker is TC genotype have significantly higher hypoxia tolerance than those whose genotype is TT genotype.

8. Use of a reagent for detecting the SNP molecular marker according to claim 1, a primer according to claim 2, or a kit according to claim 3 in identifying or breeding varieties of Penaeus vannamei with hypoxia tolerance traits.

9. Use of the detection method according to any one of claims 4 to 7 in identifying or breeding varieties of Penaeus vannamei with hypoxia tolerance traits.

Images