Litopenaeus vannamei Lvrpp14 gene hypoxia resistance character related SNP molecular marker and application thereof

Abstract

The invention discloses a litopenaeus vannamei Lvrpp14 gene hypoxia resistance character related SNP molecular marker and application thereof, the SNP molecular marker is located at the 543rd site from the 5'end of a nucleotide sequence shown as SEQ ID NO: 1 of the Lvrpp14 gene, and the basic group of the SNP molecular marker is G or A. The invention further provides a primer and a kit for amplifying the molecular marker, a method for detecting the low-oxygen-resistant character of the litopenaeus vannamei, a reagent for detecting the SNP molecular marker, and application of the primer, the kit or the method in identifying or breeding low-oxygen-resistant character litopenaeus vannamei varieties. The g.543Ggt can be preferentially selected in the genetic breeding research process of the litopenaeus vannamei taking the hypoxia-resistant character as a breeding index; an individual with the A site being GA is used as a breeding parent, which has important guiding significance for breeding of a new variety of the litopenaeus vannamei with the excellent hypoxia-resistant character.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a SNP molecular marker related to hypoxia tolerance traits of a Lvrpp14 gene of Litopenaeus vannamei and an application thereof. Background Art

[0002] The vannamei shrimp (Litopenaeus vannamei) belongs to the genus Penaeus of the family Penaeidae in the order Decapoda. It mainly inhabits shallow tropical and subtropical seas and is widely distributed in many countries along the Pacific coast. It is favored by consumers for its delicious meat, high protein, rich trace elements and unsaturated fatty acids. It has extremely high nutritional and economic value. However, the sensitivity of vannamei shrimp to environmental changes, especially its poor adaptability to low-oxygen environments, has seriously restricted the sustainable development of its aquaculture industry. Therefore, it is urgent to carry out molecular genetic breeding research to analyze the genetic mechanism of important economic traits.

[0003] Although certain research results have been achieved in the fields of hypoxia tolerance, salinity adaptability, population genetics, artificial breeding and genomics of Penaeus vannamei, there is still a lack of research on the development and application of molecular markers, especially molecular markers related to hypoxia tolerance. Molecular marker-assisted selection breeding technology uses DNA molecular markers to screen breeding materials to improve important economic traits of species. Single nucleotide polymorphisms (SNPs), as the third-generation molecular markers, have been widely used in animal and plant molecular breeding research due to their high genetic diversity, stable genetic characteristics and convenient detection process, providing a new way for the genetic improvement of crustaceans and showing unique advantages.

[0004] However, the early assembly of the reference genome of Penaeus vannamei was not complete enough, which made it very difficult to develop SNP markers related to the low dissolved oxygen tolerance of Penaeus vannamei. At the same time, due to factors such as the low accuracy of first-generation sequencing and the high cost of second-generation genome sequencing, there were fewer individuals in the experimental population that could be effectively tested, resulting in the developed SNP markers being unstable. Therefore, there is an urgent need to further screen SNP markers that are closely related to low oxygen tolerance in order to identify and develop more stable genetic markers.

[0005] Therefore, the present invention aims to develop a SNP molecular marker significantly associated with the hypoxia tolerance trait on the Litopenaeus vannamei Lvrpp14 (Litopenaeus vannamei Ribonuclease p protein subunit p14, Lvrpp14) gene, so as to improve its aquaculture efficiency and environmental adaptability, increase its economic value and ecological value, and provide a new perspective for understanding the adaptation mechanism of crustaceans to hypoxic environments; through molecular marker-assisted selection breeding technology, the hypoxia tolerance trait of Litopenaeus vannamei can be more efficiently improved, thereby improving the overall benefits and sustainable development capabilities of the aquaculture industry. Summary of the invention

[0006] The purpose of the present invention is to provide a SNP molecular marker related to the hypoxia tolerance trait of the Lvrpp14 gene of Penaeus vannamei, a primer for amplifying the SNP molecular marker and a kit for detecting the SNP molecular marker.

[0007] The present invention also aims to provide a method for detecting the hypoxia tolerance trait of Penaeus vannamei.

[0008] The last object of the present invention is to provide a reagent for detecting the SNP molecular marker, and the primer, kit or detection method for use in identifying or breeding varieties of Penaeus vannamei with hypoxia-tolerant traits.

[0009] The above-mentioned first object of the present invention can be achieved by the following technical scheme: a SNP molecular marker related to the hypoxia tolerance trait of the Lvrpp14 gene of the vannamei shrimp, wherein the SNP molecular marker is located at the 543rd position from the 5' end of the nucleotide sequence of the Lvrpp14 gene of the vannamei shrimp as shown in SEQ ID NO: 1, and its base is G or A.

[0010] The research group of the inventor of the present application has carried out whole genome sequencing of a large population of Penaeus vannamei, and compared the obtained sequencing data with the reference genome of Penaeus vannamei (NCBI: GCF 042767895.1) assembled by the third-generation sequencing technology, and used GATK (-type Unified Genotyper) software to identify and filter SNPs to obtain a usable SNP data set; based on the parental genotype detection results of the reference genome, polymorphic markers between parents and offspring genotyping were developed, and the chi-square test was used to filter the skewed segregation markers, and the Joinmap 4.0 software was used to construct a genetic map for the high-quality genetic markers obtained after screening; the Interval Mapping method of the R package qtl was used to locate QTLs, and the molecular markers on the genetic map were linked to the hypoxia resistance trait. It was located that the Lvrpp14 gene of Penaeus vannamei was related to hypoxia resistance, and there was a SNP marker in the intron region of the Lvrpp14 gene.

[0011] The SNP molecular marker described in the present invention is significantly correlated with the survival rate of Penaeus vannamei under hypoxia stress.

[0012] The present invention takes the SNP site of the Lvrpp14 gene of Penaeus vannamei as the research target, and finds that a SNP site (g.543G>A) located in the intron region of the Lvrpp14 gene is significantly correlated with the hypoxia tolerance trait of Penaeus vannamei, so the SNP molecular marker is screened and obtained.

[0013] The present invention has been further verified by small group experiments and large group tests, and found that in the identification of the SNP site of the Lvrpp14 gene of the vannamei shrimp:

[0014] g.543G>A individuals with GA genotype showed significantly higher hypoxia tolerance than those with GG genotype;

[0015] The SNP sites located in the intronic region of the Lvrpp14 gene of Penaeus vannamei showed significant differences in the hypoxia tolerance traits of each genotype (P<0.05).

[0016] That is, the hypoxia tolerance trait of the GA genotype individuals of the 543rd SNP molecular marker of the Lvrpp14 gene of the present invention as shown in SEQ ID NO: 1 is significantly higher than that of the GG genotype individuals.

[0017] The hypoxia tolerance trait is the ability to survive in an environment with relatively low dissolved oxygen, for example, the dissolved oxygen concentration is within the range from the suffocation point dissolved oxygen concentration (about 0.4 mg / L) to the normal dissolved oxygen concentration (about 7 mg / L).

[0018] The present invention also provides a primer for amplifying the SNP molecular marker, the primer comprising a forward primer Lvrpp14-F and a reverse primer Lvrpp14-R, the nucleotide sequence of the forward primer Lvrpp14-F is shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer Lvrpp14-R is shown in SEQ ID NO: 3.

[0019] Specifically, the nucleotide sequences of the forward primer Lvrpp14-F and the reverse primer Lvrpp14-R are as follows:

[0020] Forward primer Lvrpp14-F: 5'-tcaaccgtggattgcgagt-3' (as shown in SEQ ID NO: 2);

[0021] Reverse primer Lvrpp14-R: 5′-gcacggaaacacccttaacc-3′ (as shown in SEQ ID NO: 3).

[0022] The present invention also provides a kit for detecting the SNP molecular marker, and the kit comprises the primer.

[0023] The above second object of the present invention can be achieved by the following technical scheme: A method for detecting hypoxia tolerance of Litopenaeus vannamei, comprising the following steps:

[0024] (S1) extracting genomic DNA from muscle tissue of Penaeus vannamei;

[0025] (S2) using the primers to perform PCR amplification on the genomic DNA of the muscle tissue of the shrimp Penaeus vannamei described in step (S1) to obtain an amplified product;

[0026] (S3) sequencing the amplified product of step (S2), and determining the genotype of the SNP molecular marker based on the sequencing result;

[0027] (S4) Determining the hypoxia tolerance trait of Penaeus vannamei by using the genotype of the SNP molecular marker in step (S3).

[0028] In the above-mentioned method for detecting the hypoxia tolerance trait of Penaeus vannamei:

[0029] Preferably, the PCR reaction system used in the PCR amplification in step (S2) is 40 μL, comprising: PCRSuperMix 20μL, 10mM forward primer and reverse primer 2μL each, 40ng / μL DNA template 2μL, ddH2O 14μL.

[0030] Preferably, during PCR amplification in step (S2), the PCR reaction program used is 35 cycles in total, with pre-denaturation at 95°C for 5 minutes before the cycle, each cycle including denaturation at 95°C for 30 seconds, annealing at 59.5°C for 30 seconds, and extension at 72°C for 30 seconds, and extension at 72°C for 10 minutes after the cycle ends.

[0031] Preferably, in step (S4), the individuals whose genotype of the SNP molecular marker is GA genotype (g.543G>A) have significantly higher hypoxia resistance than those of individuals with GG genotype.

[0032] The method for detecting the hypoxia tolerance trait of Penaeus vannamei provided by the invention detects the SNP molecular marker genotype of Penaeus vannamei and determines the hypoxia tolerance of Penaeus vannamei according to the detection result of the hypoxia tolerance trait.

[0033] The last object of the present invention can be achieved by the following technical solution: application of the reagent for detecting the SNP molecular marker, the primer, the kit or the method in identifying or breeding varieties of Penaeus vannamei with hypoxia tolerance traits.

[0034] In general, the present invention discloses a SNP molecular marker related to the hypoxia resistance trait of the Lvrpp14 gene of Penaeus vannamei and an application thereof. The present invention screens the hypoxia resistance trait of Penaeus vannamei, finds a SNP site significantly related to the hypoxia resistance trait of Penaeus vannamei on the Lvrpp14 gene, and designs a pair of primers for amplifying the SNP site. The SNP site disclosed by the present invention is significantly correlated with the survival rate of Penaeus vannamei under hypoxia stress, and the hypoxia resistance ability of individuals with GA genotype in the SNP site is significantly stronger than that of individuals with other genotypes. The SNP site can be used for molecular marker-assisted breeding and genetic improvement of Penaeus vannamei, thereby improving the hypoxia resistance ability of Penaeus vannamei and increasing the breeding efficiency.

[0035] The beneficial effects of the present invention are as follows:

[0036] (1) The present invention takes the SNP site of the Lvrpp14 gene of Penaeus vannamei as the research target and finds that a SNP site (g.543G>A) located in the intron region of the Lvrpp14 gene is significantly correlated with the hypoxia tolerance trait of Penaeus vannamei;

[0037] (2) In the present invention, the hypoxia tolerance trait of the GA genotype individuals with g.543G>A was significantly higher than that of the GG genotype individuals (P<0.05);

[0038] (3) The SNP loci disclosed in the present invention are significantly correlated with the survival rate of Penaeus vannamei under hypoxia stress. The individuals with the GA genotype in the SNP loci have significantly stronger hypoxia tolerance than individuals with other genotypes. The SNP loci can be used for molecular marker-assisted breeding and genetic improvement of Penaeus vannamei, thereby improving the hypoxia tolerance of Penaeus vannamei and increasing the breeding efficiency.

[0039] (4) In the genetic breeding of Penaeus vannamei with hypoxia tolerance as the breeding indicator, individuals with g.543G>A locus as GA can be preferentially selected as breeding parents, which has important guiding significance for the selection of new varieties of Penaeus vannamei with excellent hypoxia tolerance traits. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 This is a sequencing peak diagram of sequencing the PCR amplification product using the Lvrpp14-F primer in Example 2, and the position of the g.543G>A site is shown in the figure. DETAILED DESCRIPTION

[0041] The technical scheme of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments, but it is necessary to point out that the following embodiments are only used to describe the content of the invention and do not constitute a limitation on the scope of protection of the present invention. The reagents or materials used in the examples, unless otherwise specified, are all from commercial channels. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0042] Example 1

[0043] In this embodiment, a genetic map is constructed using data obtained from whole genome resequencing, and RQTL (R / qtl) positioning analysis is performed using genetic markers in the map and the hypoxia tolerance phenotype data of Penaeus vannamei. A SNP site on the Lvrpp14 gene is identified in the QTL region. The site is located at the 543rd position from the 5' end of the Lvrpp14 gene of Penaeus vannamei (as shown in SEQ ID NO: 1), and the base is G or A (g.543G>A). The method for screening the SNP site includes the following steps:

[0044] (1) Obtaining Penaeus vannamei populations

[0045] The experiment was conducted at Guangdong Guoxing Aquatic Products Science and Technology Co., Ltd. in China. Before the experiment began, sexually mature male and female individuals of the vannamei shrimp variety "Xinghai No. 1" with good traits were selected as parents, and a semi-directional mating method was used to construct an F1 full-sib family. Under this condition, artificial insemination was used to collect the spermatophores of male shrimp and transfer them to the mating device of mature female breeding shrimp to achieve the required mating. The fertilized female shrimp laid eggs and hatched in isolated pools to obtain the first generation (F1) individuals for family tracking. The offspring were initially raised in a nursery pond for 15 days, and then raised in an outdoor 3.0m×3.0m×1.2m pond for 45 days, with a temperature of 29.0±1.0℃, a pH of 8.0±0.2, a dissolved oxygen of 6.5±0.5mg / L, and a salinity of 22‰.

[0046] (2) Hypoxia stress treatment of Penaeus vannamei

[0047] Nitrogen was injected into the water to reduce the dissolved oxygen content and maintain the dissolved oxygen level at 0.4 mg / L (dissolved oxygen concentration at the suffocation point) to achieve a hypoxic environment. 450 shrimps were randomly selected for hypoxia stress treatment. The time from the start of hypoxia treatment to the time when the shrimp stopped swimming, lost body balance and did not respond to touch was used as the phenotypic trait data of hypoxia tolerance. According to the length of the recorded experimental shrimp phenotypic time, muscle tissues of 200 shrimps were randomly collected from the time when the shrimp stopped swimming, lost body balance and did not respond to touch to the last shrimp for genomic DNA extraction.

[0048] (3) Whole genome resequencing

[0049] The muscle tissues of the 200 individuals and their parents obtained in step (2) were cut, and the genomic DNA of the samples was extracted using the CTAB method. Then, a whole genome sequencing library was constructed, and the obtained library was sequenced on the BGISEQ-500 high-throughput sequencing platform.

[0050] (4) Genetic map construction

[0051] The obtained sequencing data were aligned with the reference genome of Penaeus vannamei assembled using the third-generation sequencing technology (NCBI: GCF042767895.1), and the software GATK (-type Unified Genotyper) was used for SNP identification and quality control to obtain a usable SNP data set; based on the parental genotype detection results of the reference genome, polymorphic markers between parents and offspring genotyping were developed, and the chi-square test was used to filter out skewed segregation markers. The Joinmap 4.0 software was used to construct a genetic map for the high-quality genetic markers obtained after screening.

[0052] (5) Association analysis between genetic markers and hypoxia tolerance traits

[0053] The Interval Mapping method of the R package qtl was used to locate QTLs, and linkage analysis was performed between the SNP molecular markers on the genetic map and the hypoxia tolerance trait, thereby confirming the SNP molecular markers on the genes in the region related to the trait.

[0054] The results showed that the Lvrpp14 gene of Penaeus vannamei was related to its hypoxia tolerance trait, and there was a SNP molecular marker in the intron region of the Lvrpp14 gene. The SNP marker was located at the 543rd position from the 5' end of the Lvrpp14 gene of Penaeus vannamei (as shown in SEQ ID NO: 1), and the base was G or A (g.543G>A), which can be used as a molecular marker for screening hypoxia-tolerant parents of Penaeus vannamei to assist in breeding.

[0055] The nucleotide sequence of the Lvrpp14 gene of Penaeus vannamei (as shown in SEQ ID NO: 1) is as follows:

[0056]

[0057]

[0058]

[0059] Note: The underlined words in the text are complementary primers of the forward primer and the reverse primer, and the bold italic words are SNP sites.

[0060] Example 2

[0061] In this example, primers were designed for the SNP sites obtained in Example 1 to perform PCR amplification and sequencing to obtain the genotype of the hypoxia-resistant Penaeus vannamei, and then the hypoxia-resistant Penaeus vannamei was screened and obtained. The specific implementation method is as follows:

[0062] (S1) Acquisition and hypoxia treatment of Litopenaeus vannamei population

[0063] The same method as in Example 1 was used to obtain a population of Penaeus vannamei, and 80 individuals were randomly selected for a 0.4 mg / L (asphyxia point dissolved oxygen concentration) hypoxia stress treatment.

[0064] (S2) Extracting DNA of Penaeus vannamei to be tested

[0065] Muscle tissues of 80 shrimps were collected and genomic DNA of the samples was extracted according to the CTAB method. The specific steps are as follows:

[0066] (1) Remove the individuals that have stopped swimming, lost balance, and do not respond to touch; for subsequent DNA extraction, cut the muscle of each shrimp and freeze the muscle samples in liquid nitrogen;

[0067] (2) DNA was isolated from the sample using the CTAB technique. The sample was appropriately ground under liquid nitrogen conditions, and approximately 0.1 g of the liquid was transferred to a pre-cooled centrifuge tube, followed by the addition of CTAB and β-mercaptoethanol solution;

[0068] (3) Place the mixed sample in a 65°C water bath for approximately 1 hour, ensuring that it is evenly stirred in the water bath, and then transfer the sample to a centrifuge and centrifuge at 12,000 rpm for 10 min;

[0069] (4) Add a mixture of phenol, chloroform, and isopropanol, mix well, and centrifuge at 12,000 rpm for 10 min. Transfer the upper aqueous phase to a new centrifuge tube;

[0070] (5) Add a mixture of chloroform and isopropanol, mix well, and centrifuge at 12,000 rpm for 10 min. Transfer the upper aqueous phase to a new centrifuge tube;

[0071] (6) Precipitate and wash the sample with isopropanol and anhydrous ethanol, centrifuge, and discard the supernatant;

[0072] (7) Repeat the above steps once, centrifuge briefly, remove ethanol, dry, add appropriate amount of ddH2O, and store at -20°C;

[0073] (8) Finally, the integrity of the DNA samples was detected by 1% agarose gel electrophoresis, and the concentration and purity were detected by NanoDrop2000 micro-spectrophotometer.

[0074] (S3) PCR amplification of target fragment

[0075] For the SNP site 543G>A of the Lvrpp14 gene of Penaeus vannamei, primers were designed from the nucleotide sequence of the Lvrpp14 gene of Penaeus vannamei (as shown in SEQ ID NO: 1) using the software Primer Premier 5. The primers included a forward primer Lvrpp14-F and a reverse primer Lvrpp14-R, which were as follows: forward primer Lvrpp14-F: 5'-tcaaccgtggattgcgagt-3' (as shown in SEQ ID NO: 2); reverse primer Lvrpp14-R: 5'-gcacggaaacacccttaacc-3' (as shown in SEQ ID NO: 3);

[0076] Using the muscle tissue DNA of Penaeus vannamei extracted in step (S3) as a template, the target fragment (892 bp) was amplified by PCR using the following reaction system and reaction procedure. The PCR reaction system was 40 μL, wherein: PCR Super Mix 20 μL, 10 mM forward primer and reverse primer 2 μL each, 40 ng / μL DNA template 2 μL, ddH2O 14 μL; PCR reaction program for a total of 35 cycles, 94 ° C pre-denaturation 5 min before the cycle, each cycle includes 94 ° C denaturation 30 sec, 59.5 ° C annealing 30 sec, 72 ° C extension 30 sec, after the cycle end extension 10 min at 72 ° C;

[0077] The target fragment (shown in SEQ ID NO: 4) was amplified by PCR using specific primers as follows:

[0078] tcaaccgtggattgcgagt[g(g.543G>A)]atatacctagaat cagtcattttatagttcaatggaggcggctgcacccctgcgacctcctcatggcggctgcaacccccaacccccgccagggaaaacaaggaattttacatgaattcatggcaggagagagcattggacatacttggcaatgctgctcctgcatggca atcataggctcttttctgtaaggaatacttgctttcctgagtaggggttcggtgtcgcaggacagtatagtgactgatattgtgtatatttacattttaccatgattttcatttcattttctcatgccctccccagctatcaaggccaagaatgtggg ggttaagggtgtttccgtgc (shown in SEQ ID NO: 4);

[0079] The underline indicates the location of the forward primer and the reverse primer (forward sequence, which is the base sequence of Lvrpp14-R after reverse complementation), and the square brackets indicate the SNP sites to be detected.

[0080] (S4) Sequencing of PCR amplification products to determine the genotype of the SNP site

[0081] The PCR amplification products of 80 individuals of the above-mentioned Penaeus vannamei were sequenced by direct sequencing (Sangerc sequencing) at Shanghai Biotech, and the peak graph of the sequencing was analyzed for genotyping using Snapgene software. If a double peak appears at the SNP site, it is a heterozygous genotype, and a single peak is a homozygous genotype, thus determining the g.543G>A genotype. The results are as follows Figure 1 shown.

[0082] (S5) Correlation analysis between SNP locus genotype and hypoxia tolerance of Litopenaeus vannamei

[0083] The one-way ANOVA in the general linear model of SPSS26 was used to conduct correlation analysis between the genotype of the SNP locus and the quantitative trait of hypoxia tolerance. For the SNP loci with significant differences, the Ducan method was used for multiple comparison analysis. The analysis results are as follows:

[0084] Table 1 Correlation between SNP loci of Lvrpp14 gene and hypoxia tolerance in Litopenaeus vannamei

[0085]

[0086] Among them, the P value is the result of one-way analysis of variance in the general linear model; the superscript letters in the hypoxia tolerance time represent the results of Ducan's multiple comparison analysis among genotypes, different letters indicate significant differences, and the same letters indicate insignificant differences.

[0087] The results in Table 1 show that there are significant differences between the three genotypes of the SNP site (g.543G>A) on the Lvrpp14 gene of Penaeus vannamei and the hypoxia tolerance trait (P=0.040<0.05), which is statistically significant, indicating that the SNP site is a SNP site significantly associated with hypoxia tolerance; among them, the vannamei shrimp individuals with genotype GA have the longest hypoxia tolerance survival time (i.e. GA is the dominant genotype), and the individuals with genotype GG have the shortest survival time (i.e. GG is the inferior genotype), and there is a significant difference between the two; This shows that in the process of cultivating a population of Penaeus vannamei with hypoxia tolerance, individuals with SNP genotype GA are preferentially selected as parents of Penaeus vannamei with hypoxia tolerance.

[0088] Example 3

[0089] The experiment was conducted at Guangdong Guoxing Aquatic Products Technology Co., Ltd., China. 196 60-day-old Litopenaeus vannamei from Zhanjiang, Guangdong were randomly selected and subjected to hypoxia stress treatment using the same method as in Example 1 or 2 for large-scale group verification.

[0090] The genomic DNA of the muscles of 196 Penaeus vannamei shrimps was extracted, and the genomic DNA of the muscles of Penaeus vannamei was amplified by PCR using the primers described in Example 2. The PCR amplification system and procedure were the same as those in Example 2 to obtain PCR amplification products. The PCR amplification products were sequenced, and the genotypes of the SNP molecular markers were determined based on the sequencing results. The hypoxia tolerance of the Penaeus vannamei shrimp to be tested was determined by the genotypes.

[0091] The analysis results are shown in Table 2 below:

[0092] Table 2 Correlation between SNP loci of Lvrpp14 gene and hypoxia tolerance in Litopenaeus vannamei

[0093]

[0094]

[0095] Among them, the P value is the result of one-way analysis of variance in the general linear model; the superscript letters in the hypoxia tolerance time represent the results of Ducan's multiple comparison analysis among genotypes, different letters indicate significant differences, and the same letters indicate insignificant differences.

[0096] The results in Table 2 show that in the large-scale population verification test, GA is still the dominant genotype at the SNP site (g.543G>A) on the Lvrpp14 gene of Penaeus vannamei, and there is a significant difference between this SNP site and the hypoxia tolerance trait (P=0.008<0.05), which is statistically significant.

[0097] Therefore, the above-mentioned SNP molecular markers can be applied to the screening of low-oxygen-resistant Penaeus vannamei populations. Individuals with a genotype of GA at the SNP site (g.543G>A) on the Lvrpp14 gene of Penaeus vannamei can be used as breeding objects to cultivate low-oxygen-resistant Penaeus vannamei populations.

[0098] The present invention has further studied and found that the protein subunit encoded by the ribonuclease pprotein subunit p14 (rpp14) gene of the vannamei shrimp has 3' to 5' exoribonuclease activity, which is crucial for the maturation process of tRNA. tRNA is one of the earliest response molecules to various environmental stresses such as heat shock, hypoxia or nutrient deprivation. It protects cells from peroxide damage by shutting down the entire protein translation process and limiting oxidative phosphorylation through various regulatory mechanisms, and plays an important role under hypoxic conditions. Therefore, the rpp14 gene is crucial for the vannamei shrimp to protect cells from hypoxic stress under hypoxic conditions.

[0099] Furthermore, when the SNP molecular marker described in the present invention is used in the breeding process of the hypoxia tolerance trait of Penaeus vannamei, specifically in the breeding process of Penaeus vannamei, by extracting the genomic DNA of the tested Penaeus vannamei, using the primers designed by the present invention, the genomic DNA of the tested Penaeus vannamei is PCR amplified to obtain a PCR amplification product, and the PCR amplification product is sequenced. Based on the sequencing result, the genotype of the SNP site is detected for the candidate population of Penaeus vannamei breeding, and then combined with the genotypes of other sites related to growth traits, disease resistance, and stress resistance, individuals with the SNP genotype of GA described in the present invention are preferentially selected as the parents of Penaeus vannamei for breeding hypoxia tolerance traits.

[0100] Therefore, the reagent for detecting the SNP sub-marker, the primer or the kit can be used in the identification of the hypoxia trait of Litopenaeus vannamei and in selective breeding.

[0101] In addition, the use of the reagent for detecting the SNP molecular marker, the primer or the kit in evaluating the hypoxia tolerance of Penaeus vannamei also falls within the protection scope of the present invention.

[0102] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. A person skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention, and any improvement and deformation based on the concept of the present invention shall fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.

Claims

1. A SNP molecular marker associated with hypoxia tolerance of the Lvrpp14 gene of Penaeus vannamei, characterized in that: The SNP molecular marker is located at the 543rd position from the 5' end of the nucleotide sequence of the Lvrpp14 gene of Penaeus vannamei as shown in SEQ ID NO: 1, and its base is G or A.

2. A primer for amplifying the SNP molecular marker according to claim 1, characterized in that: The primers include a forward primer Lvrpp14-F and a reverse primer Lvrpp14-R. The nucleotide sequence of the forward primer Lvrpp14-F is shown in SEQ ID NO: 2, and the nucleotide sequence of the reverse primer Lvrpp14-R is shown in SEQ ID NO:

3.

3. A kit for detecting the SNP molecular marker according to claim 1, characterized in that: The kit comprises the primers according to claim 2.

4. A method for detecting hypoxia tolerance of Penaeus vannamei, characterized in that: The following steps are involved: (S1) extracting genomic DNA from muscle tissue of Penaeus vannamei; (S2) using the primers described in claim 2, performing PCR amplification on the genomic DNA of the muscle tissue of the shrimp Penaeus vannamei described in step (S1) to obtain an amplified product; (S3) sequencing the amplified product of step (S2), and determining the genotype of the SNP molecular marker based on the sequencing result; (S4) Determining the hypoxia tolerance trait of Penaeus vannamei by using the genotype of the SNP molecular marker described in step (S3).

5. The method for detecting hypoxia tolerance of Penaeus vannamei according to claim 4, characterized in that: The PCR reaction system used in step (S2) for PCR amplification is 40 μL, including: PCR SuperMix 20μL, 10mM forward primer and reverse primer 2μL each, 40ng / μL DNA template 2μL, ddH2O 14μL.

6. The method for detecting hypoxia tolerance of Penaeus vannamei according to claim 4, characterized in that: During PCR amplification in step (S2), the PCR reaction program used is 35 cycles in total, with pre-denaturation at 94°C for 5 minutes before the cycle, each cycle including denaturation at 94°C for 30 seconds, annealing at 59.5°C for 30 seconds, and extension at 72°C for 30 seconds, and extension at 72°C for 10 minutes after the cycle is completed.

7. The method for detecting hypoxia tolerance of Penaeus vannamei according to claim 4, characterized in that: In step (S4), the individuals whose genotype of the SNP molecular marker is GA genotype have significantly higher hypoxia tolerance than those whose genotype is GG genotype.

8. Use of a reagent for detecting the SNP molecular marker of claim 1, a primer of claim 2 or a kit of claim 3 in identifying or breeding varieties of Litopenaeus vannamei with hypoxia tolerance traits.

9. Use of the detection method according to any one of claims 4 to 7 in identifying or breeding varieties of Penaeus vannamei with hypoxia tolerance traits.

Images