Kit for rapidly detecting mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method, application and method

Abstract

The invention discloses a kit, application and method for rapidly detecting mycoplasma gallisepticum based on an ERA-CRISPR / Cas12a one-step method, and the visual detection kit for the mycoplasma gallisepticum is characterized in that based on a new nucleic acid detection target hmpG1 of the mycoplasma gallisepticum, a to-be-detected sample is split by a splitting buffer to release genome DNA (deoxyribonucleic acid), then ERA-CRISPR / Cas12a one-pot reaction is carried out in a constant-temperature water bath kettle or a metal bath, and finally, the ERA-CRISPR / Cas12a one-pot reaction is carried out to detect the mycoplasma gallisepticum through the ERA-CRISPR / Cas12a one-pot reaction. Under the mediation of a crRNA guide sequence, after Lb Cas12a enzyme is combined with crRNA and target DNA to form a ternary complex, the trans-shear activity of cas12a can be activated, an ssDNA fluorescent probe in a reaction system can be arbitrarily cut to release a fluorescent group on the probe, and then an ultraviolet lamp is used for detecting a fluorescent signal or a colloidal gold test strip is used for detecting whether FAM and Biotin groups are cut off or not for result judgment. According to the ERA-CRISPR / cas12a one-pot method technology for rapidly detecting the mycoplasma gallisepticum, the DNA target of the mycoplasma gallisepticum is specifically recognized and cut through ERA amplification and CRISPR / cas12a, the specificity is high, the detection sensitivity is as low as 1.73 pg / mu L, and the ERA-CRISPR / cas12a one-pot method technology can be used for rapidly detecting the mycoplasma gallisepticum in a clinical sample on site.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a kit, application and method for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method. Background Art

[0002] Mycoplasma galliscepticum (MG), also known as Mycoplasma galliscepticum or Mycoplasma gallisepticum, is the most pathogenic and economically damaging avian mycoplasma in poultry. The disease it causes is usually called chronic respiratory disease. MG infection causes chronic respiratory symptoms, accompanied by mucosal catarrhal inflammation, and can also lead to severe air sac inflammation. Clinically, MG is often mixed with pathogenic microorganisms such as MS, Newcastle disease virus (NDV), infectious bronchitis virus (IBV), Haemophilus paragallinarum or Escherichia coli to cause severe respiratory diseases. The clinical manifestations are coughing, runny nose, tears, dyspnea or open mouth breathing. In severe cases, moist rales can be heard. MG infection can lead to a decrease in egg production and egg quality in laying hens, a decrease in the hatchability of breeding eggs, slow growth and development of broilers, and low feed utilization. MG can also be vertically transmitted to the next generation of chicks through breeding eggs.

[0003] At present, the detection standards for Mycoplasma gallisepticum are based on serological detection, pathogen detection and PCR detection (such as NYT553-2002 Avian Mycoplasma Disease Diagnosis Technology, NYT553-2015 Avian Mycoplasma PCR Detection Method, OIE "Diagnostic Test and Vaccine Standard Manual - Avian Mycoplasma", etc.). For serological and conventional pathogen detection methods, the process involved is very cumbersome and time-consuming, and cannot meet the requirements of disease prevention and control of rapid on-site detection of Mycoplasma gallisepticum, timely control of transmission routes and elimination of pollution sources. The PCR method has relatively low sensitivity, requires a PCR instrument, and needs to be carried out in the laboratory, and the detection time is relatively long. Isothermal amplification technologies, such as LAMP and RPA (or ERA with independent intellectual property rights in China), have the advantages of high detection sensitivity, short detection time, and no need for expensive instruments and equipment. A constant temperature water bath or a constant temperature metal bath is sufficient, which is very suitable for rapid on-site detection, but its high sensitivity also brings non-specific amplification, especially LAMP technology. The CRIPSR / cas12a system is based on the targeted recognition and cutting ability of the cas12a protein. The Cas12a family is a class of nucleases mediated by a single crRNA, which can specifically recognize and cut double-stranded DNA targets with PAM sequences. After cas12a forms a ternary complex with crRNA and target double-stranded DNA, it activates the "trans-cleavage activity" against ssDNA in the reaction system, and can non-specifically cut the reporter ssDNA in the system. However, when it is used alone for molecular diagnosis, a high amount of target DNA is required. Combining the ERA isothermal amplification technology with the CRIPSR / cas12a technology overcomes the shortcomings of these two methods, and retains the advantages of the ERA technology, such as high sensitivity, short detection time, and no need for expensive instruments, and has the advantages of the CRIPSR / cas12a technology, such as good specificity.

[0004] The selection of specific DNA targets is the key to establishing a reliable method for detecting Mycoplasma gallisepticum nucleic acid DNA. The Mycoplasma gallisepticum detection target hmpG1 involved in the present invention is a new diagnostic marker screened by the present invention, and the gene only exists in Mycoplasma gallisepticum.

[0005] Based on the above reasons, the present invention combines ERA isothermal amplification technology with CRIPSR / cas12a technology based on the newly screened and identified target hmpG1, and establishes a one-pot ERA-CRISPR / cas12a technology, which can be used for rapid and accurate on-site detection of Mycoplasma gallisepticum in clinical samples, and can report the detection results visually by detecting the fluorescent signal of the reaction or using a test strip. Compared with the existing methods for detecting Mycoplasma gallisepticum, it has the advantages of high sensitivity, strong specificity, rapidity, no need for expensive instruments, and can be used for on-site rapid detection. Summary of the invention

[0006] In view of this, the present invention provides a kit, application and method for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method.

[0007] In order to solve the above technical problems, the present invention adopts the following technical solutions:

[0008] A kit for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method, including sample lysis buffer, reaction buffer, ERA primers, crRNA guide sequence, Cas12a enzyme, ssDNA fluorescent probe and colloidal gold test strip;

[0009] The nucleotide sequence of the ERA primer is:

[0010] F:5'-TTTTATTAGCATAATCTCCACCTGAGCATGA-3',

[0011] R:5'-GTAAGATATAACCAAGCCCTTTTAGTGAATC-3';

[0012] The crRNA guide sequence is:

[0013] 5'-UAAUUUCUACUAAGUGUAGAUCAAUUGUUUAUUUGAACCCAAUC-3'.

[0014] Preferably, the ssDNA fluorescent probe is a single-stranded nucleotide sequence labeled with FAM or FITC at the 5' end and BHQ1 or Biotin at the 3' end.

[0015] Preferably, the nucleotide sequence of the ssDNA fluorescent probe is ssDNA-FQ: 5'-FAM-TTTTTT-BHQ1-3' or 5'-FITC-TTTTTT-BHQ1-3', and ssDNA-FB: 5'-FAM-TTTTTT-BIO-3' or 5'-FITC-TTTTTT-BIO-3'.

[0016] Preferably, it also comprises a positive control plasmid carrying a Mycoplasma gallisepticum-specific target DNA, and a negative control Escherichia coli DH5a genomic DNA.

[0017] Application of a one-step rapid detection kit for Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a in the visual detection of Mycoplasma gallisepticum.

[0018] The method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method comprises the following steps:

[0019] S1. Place the sample cotton swab in a lysis buffer to release the mycoplasma genomic DNA in the sample to be tested;

[0020] S2. Add the above-lysed mycoplasma genomic DNA and the reaction system into a new reaction tube, and then place the reaction tube in a constant temperature water bath or a constant temperature metal bath for reaction, so that the ERA isothermal amplification and CRISPR cleavage reaction are carried out simultaneously in the same reaction system, with ERA amplification and CRISPR cleavage at the same time;

[0021] S3. When using the ssDNA-FQ fluorescent probe, after the reaction is completed in a constant temperature water bath or a constant temperature metal bath, use a handheld ultraviolet lamp to detect the fluorescent signal, and determine the test result based on the presence or absence of the fluorescent signal; when using the ssDNA-FB fluorescent probe, after the reaction is completed in a constant temperature water bath or a constant temperature metal bath, insert the test strip into the reaction tube, and determine the result by observing whether a band appears at the test line on the test strip within 5-10 minutes.

[0022] Preferably, in step S2, the reaction system is: 1.0 μM of each F / R primer, 10 μL of solvent, 1.0 μL of activator, 2.5 μL of 10×Reaction buffer, 400 nM LbCas12a enzyme, 250 nM crRNA, 100 nM ssDNA, 2.0 μL of DNA template, ddH2O is supplemented to 25 μL, mixed and reacted at 37°C for 40 minutes.

[0023] Preferably, in step S2, the reaction tube is placed in a 37° C. water bath or metal bath for 40 minutes, and the result is observed under a handheld ultraviolet lamp; or a test strip is inserted into the reaction tube, and the test result can be observed with the naked eye within 10 minutes.

[0024] Compared with the prior art, the present invention has achieved the following technical effects:

[0025] The kit for visually detecting Mycoplasma gallisepticum of the present invention first performs ERA amplification on the sample to be tested, and then guides the CRISPR / Cas12a system to recognize, bind and cut the target double-stranded DNA of the ERA amplification product under the mediation of the crRNA guide sequence, and activates the non-specific nuclease function, and then arbitrarily cuts the ssDNA fluorescent probe in the system to obtain the sheared product, and finally determines the result by detecting the sheared fluorescent group or the fluorescent signal emitted by it.

[0026] The ERA-CRISPR / Cas12a technology for detecting Mycoplasma gallisepticum of the present invention can detect Mycoplasma gallisepticum by dual specificity through ERA amplification and crRNA recognition, with strong specificity and sensitivity as low as 1.73pg / μL, and can detect whether chickens are infected with Mycoplasma gallisepticum earlier for prevention and control. The kit in the present invention has the characteristics of not requiring expensive instruments and equipment, low cost, convenient operation, less time consumption, high sensitivity and strong specificity, and the detection reaction is carried out in a constant temperature water bath or a constant temperature metal bath, which can effectively break away from the dependence on large laboratory instruments. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 This is a flow chart of the present invention for visual detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a system;

[0028] Figure 2 This is a graph showing the specificity experimental results of the ERA detection of Mycoplasma gallisepticum of the present invention;

[0029] Figure 3 This is a crRNA screening diagram of the Mycoplasma gallisepticum hmpG1 gene of the present invention;

[0030] Figure 4 This is a sensitivity test result diagram of the ERA-CRISPR / Cas12a one-step method for detecting Mycoplasma gallisepticum of the present invention;

[0031] Figure 5 This is a specific analysis result diagram of the ERA-CRISPR / Cas12a one-step method for detecting Mycoplasma gallisepticum of the present invention;

[0032] Figure 6 The positive control results of the ERA-CRISPR / Cas12a one-step method for detecting Mycoplasma gallisepticum of the present invention are shown in (A) the results are observed under ultraviolet light; (B) the detection results are displayed using a test strip for color development. DETAILED DESCRIPTION

[0033] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0034] The present invention discloses a kit for rapid detection of Mycoplasma gallisepticum based on the one-step method of ERA-CRISPR / Cas12a, comprising a sample lysis buffer, a reaction buffer, an ERA primer, a crRNA guide sequence, a Cas12a enzyme, a ssDNA fluorescent probe and a colloidal gold test strip;

[0035] The nucleotide sequence of the ERA primer is:

[0036] F:5'-TTTTATTAGCATAATCTCCACCTGAGCATGA-3',

[0037] R:5'-GTAAGATATAACCAAGCCCTTTTAGTGAATC-3';

[0038] The crRNA guide sequence is:

[0039] 5'-UAAUUUCUACUAAGUGUAGAUCAAUUGUUUAUUUGAACCCAAUC-3'.

[0040] The ssDNA fluorescent probe is a single-stranded nucleotide sequence labeled with FAM or FITC at the 5' end and BHQ1 or Biotin at the 3' end.

[0041] The nucleotide sequences of the ssDNA fluorescent probes are ssDNA-FQ: 5'-FAM-TTTTTT-BHQ1-3' or 5'-FITC-TTTTTT-BHQ1-3', and ssDNA-FB: 5'-FAM-TTTTTT-BIO-3' or 5'-FITC-TTTTTT-BIO-3'.

[0042] Also included are a positive control plasmid carrying a target DNA specific for Mycoplasma gallisepticum, and a negative control, E. coli DH5a genomic DNA.

[0043] Application of a one-step rapid detection kit for Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a in the visual detection of Mycoplasma gallisepticum.

[0044] The method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method comprises the following steps:

[0045] S1. Place the sample cotton swab in a lysis buffer to release the mycoplasma genomic DNA in the sample to be tested;

[0046] S2. Add the above-lysed mycoplasma genomic DNA and the reaction system into a new reaction tube, and then place the reaction tube in a constant temperature water bath or a constant temperature metal bath for reaction, so that the ERA isothermal amplification and CRISPR cleavage reaction are carried out simultaneously in the same reaction system, with ERA amplification and CRISPR cleavage at the same time;

[0047] S3. When using the ssDNA-FQ fluorescent probe, after the reaction is completed in a constant temperature water bath or a constant temperature metal bath, use a handheld ultraviolet lamp to detect the fluorescent signal, and determine the test result based on the presence or absence of the fluorescent signal; when using the ssDNA-FB fluorescent probe, after the reaction is completed in a constant temperature water bath or a constant temperature metal bath, insert the test strip into the reaction tube, and determine the result by observing whether a band appears at the test line on the test strip within 5-10 minutes.

[0048] In step S2, the reaction system is: 1.0 μM each of F / R primers, 10 μL of solvent, 1.0 μL of activator, 2.5 μL of 10×Reaction buffer, 400 nM LbCas12a enzyme, 250 nM crRNA, 100 nM ssDNA, 2.0 μL of DNA template, ddH2O is added to 25 μL, mixed and reacted at 37°C for 40 minutes.

[0049] In step S2, the reaction tube is set to simultaneously perform constant temperature reaction and fluorescence signal detection; or react in a 37°C water bath or metal bath for 40 minutes, and then observe the results under a handheld ultraviolet lamp; or insert a test strip into the reaction tube and observe the test results with the naked eye within 10 minutes.

[0050] Results of the ERA primer screening experiment for Mycoplasma gallisepticum: Figure 2 shown.

[0051] Mycoplasma gallisepticum hmpG1 gene crRNA screening: Figure 3 shown.

[0052] Sensitivity test results of ERA-CRISPR / Cas12a one-step detection of Mycoplasma gallisepticum: Figure 4 As shown, A is the fluorescence signal detected on the real-time fluorescence PCR instrument; B is the observation result under ultraviolet light. The concentration of the extracted Mycoplasma gallisepticum genome was measured to be 173 ng / μL. 3 , 10 4 , 10 5 A total of three different concentrations of genomic DNA extracted from Mycoplasma gallisepticum were used as detection templates and detected using the ERA-CRISPR / Cas12a one-step method. The experimental results showed that the minimum detection limit of Mycoplasma gallisepticum based on the hmpG1 target gene ERA-CRISPR one-step method was 1.73pg / μL.

[0053] Plasmids carrying M. gallisepticum-specific target DNA and E. coli DH5a genomic DNA as negative controls.

[0054] The present invention provides a method for visually detecting Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a system, the process is as follows: Figure 1 As shown, the sample to be tested is first lysed with lysis buffer to release genomic DNA, then all the reaction systems are added to a new EP tube, and then the ERA-CRISPR / Cas12a one-pot reaction is carried out in a constant temperature water bath or a constant temperature metal bath. The system recognizes, binds and cuts the target double-stranded DNA of the ERA amplification product, and activates the non-specific nuclease function. Finally, a handheld UV lamp or colloidal gold test strip is used to develop the color and report the test results.

[0055] Embodiment 1:

[0056] ERA primer design, screening and amplification system determination:

[0057] The DNA sequence (5’-ttgatgagaagcttaaatattcttacgaaaacgtgagattatggaactgcaatcacagaattcggtgcaaattttgttttggcgtttttaatcatgtttgttttcatgattattcgtagtaaaaagatcgaaaacaaattagtcatcagttcattttttgtttttgtcgtttttattagcataatctccacctgagcatgagcaagagttttaatgaactcatttccaattgtttatttgaacccaatcaatgtaatatttgatgcaattgtgcagatggttaatttacaaaactctagtactagtcatttaaccgattcactaaaagggcttggttatatcttaccaatgcagttagttggaattttgagtggttttgtttgcttttatatcttttatatcttgataacaaaaagtaaacaaacatatatcaaagcagttgcttttaatcagatcttatttaaaaccgataatcaaaaaacggtttattttgcttttaaagattttatttttatcttaatttatacagcagttatttcgatgattagtttgataaatcctgtcgcttcaggattaagacgaatcgactatctaatagttagtatgatcgttttattcgtaatcatttatttatcatcgttttttgaattctatacgtttgatatcttattgtcgtttgcttttgcaatcttttcaacattctttttattaattgaccagaatagcgacaaacaaacgattaaaactgagctaaaaaacacctgattgcattttttaatttcattaattattaccttggtaattgcaatagttcttgcaatcatcgtttatcaaatttttatccaaggacaacaccgtgttacaatctaa-3’) of the hmpG1 gene (locus tag: HFMG94VAA_3141) in the genome of Mycoplasma gallisepticum strain VA94_7994-1-7P (CP003506.1) was used to assist in the design of a series of primer pairs that meet the ERA primer design principles by PrimerExplorerV5 software,Synthesized by Beijing Qingke Biotechnology (PAGE purification); after a series of preliminary tests and screening. The primer screening results are as follows:

[0058] F:5'-TTTTATTAGCATAATCTCCACCTGAGCATGA-3',

[0059] B:5'-GTAAGATATAACCAAGCCCTTTTAGTGAATC-3';

[0060] The size of the amplified fragment was 176 bp;

[0061] After determining the best primer set, the reaction system including primer concentration, amplification temperature, and amplification time was optimized.

[0062] The optimized ERA amplification system was as follows: 10 μL of solvent, 1.0 μL of activator, 1.5 μL of F (10 μM), 1.5 μL of R (10 μM), 2.0 μL of sample DNA, and ddH2O to 25.0 μL.

[0063] Embodiment 2:

[0064] crRNA screening:

[0065] Based on the 176 bp DNA sequence amplified by ERA, six possible Cas12a cleavage PAM sites (5'-TTN-3') and their 3' end 20-23 bp fragments were selected as targets for potential crRNA guide sequences. A plasmid carrying a T7 promoter and a Cas12a DRDNA fragment (constructed in the applicant's laboratory) was used as a template and HiScribe TM RNA was obtained by reverse transcription using the T7 Rapid and Efficient RNA Synthesis Kit (NEB) and then Each crRNA was purified using an RNA purification kit (NEB).

[0066] The designed crRNAs were verified and screened using the ERA-CRIPSR / Cas12a one-step method. The crRNA sequences that can be used in the ERA-CRIPSR / Cas12a one-step detection system are:

[0067] 5'-UAAUUUCUACUAAGUGUAGAUCAAUUGUUUAUUUGAACCCAAUC-3'.

[0068] Embodiment 3:

[0069] Specificity and sensitivity determination of the ERA-CRISPR / Cas12a method:

[0070] 1. Methods

[0071] (1) Based on the previously optimized ERA reaction system based on the hmpG1 target gene, the reaction temperature, Cas12a and crRNA concentrations of ERA-CRISPR / Cas12a for detecting Mycoplasma gallisepticum were further optimized, as well as the stability of the reaction detected by collecting fluorescence signals or colorimetric analysis of test strips.

[0072] (2) The extracted genomic DNA of Mycoplasma gallisepticum, Mycoplasma synoviae, Haemophilus paragallinarum, avian pathogenic Escherichia coli, Salmonella, Staphylococcus aureus and Riemerella anatipestifer were used as templates, and the specificity of the detection system was analyzed by the ERA-CRISPR / Cas12a one-step method. When the fluorescent probe used was ssDNA-FQ, a fluorescent quantitative PCR instrument was used to select the FAM fluorescent channel to collect the fluorescent signal. The reaction temperature was set to 37°C, and the fluorescent signal was measured once every 1 min, for a total of 40 times for 40 min, and then the test result was determined by the fluorescent signal curve; or after the reaction was completed, the measured PCR tube was placed under ultraviolet light for observation. The positive reaction tube should show a green fluorescent reaction, while the negative reaction tube and the blank control group should not show obvious changes;

[0073] (3) The concentration of the extracted Mycoplasma gallisepticum genome was measured to be 173 ng / μL, and the genomic DNA extracted from Mycoplasma gallisepticum at three different concentrations of 103, 104, and 105 was used as the detection template. The sensitivity of the ERA-CRISPR / Cas12a one-step detection system was then determined.

[0074] 2. Results

[0075] 1. Specificity analysis of the detection system:

[0076] The extracted genomic DNA of Mycoplasma gallisepticum, Mycoplasma synoviae, Haemophilus paragallinarum, avian pathogenic Escherichia coli, Salmonella, Staphylococcus aureus and Riemerella anatipestifer were used as detection templates to analyze the specificity of the established ERA-CRISPR / Cas12a one-step detection method for Mycoplasma gallisepticum. The results showed that only when the genomic DNA of Mycoplasma gallisepticum was used as the detection template, an amplification curve appeared in the real-time fluorescence detection, and no obvious fluorescence signal appeared when the genomic DNA of the other six bacteria was used as a template. The reaction tube was placed under ultraviolet light for observation. Only the reaction tube with the genomic DNA of Mycoplasma gallisepticum as a template showed obvious green fluorescence, and no fluorescence reaction appeared in other groups. Therefore, the established ERA-CRISPR / Cas12a one-step detection system for Mycoplasma gallisepticum has good specificity, such as Figure 5 As shown, A is the fluorescence signal curve on the real-time fluorescence PCR instrument; B is the observation result under 365nm ultraviolet light.

[0077] Embodiment 4:

[0078] A kit for visual detection of Mycoplasma gallisepticum:

[0079] A kit for visually detecting Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a integrated detection system, comprising all reagents such as sample lysis buffer, reaction buffer, ERA primers, crRNA guide sequence, ssDNA fluorescent probe, dNTPs, a plasmid carrying Mycoplasma gallisepticum-specific target DNA as a positive control, and Escherichia coli DH5a genomic DNA as a negative control.

[0080] ERA Primers:

[0081] F:5'-TTTTATTAGCATAATCTCCACCTGAGCATGA-3',

[0082] R:5'-GTAAGATATAACCAAGCCCTTTTAGTGAATC-3';

[0083] crRNA guide sequence:

[0084] 5'-UAAUUUCUACUAAGUGUAGAUCAAUUGUUUAUUUGAACCCAAUC-3';

[0085] ssDNA fluorescent probe:

[0086] 5'-FAM-TTTTTT-BHQ1-3', this fluorescent probe is used to detect the presence of Mycoplasma gallisepticum in the target system under the excitation of blue-green light or with the naked eye.

[0087] The method for visually detecting Mycoplasma gallisepticum using a kit comprises the following steps:

[0088] (1) Place the sample cotton swab in a lysis buffer to release the mycoplasma genomic DNA in the sample to be tested;

[0089] (2) Add the above-mentioned lysed mycoplasma genomic DNA and reaction system (including reaction buffer, ERA primers, LbCas12a enzyme, crRNA and ssDNA fluorescent probes and dNTPs, etc.) to a new reaction tube, and then place the reaction tube in a constant temperature water bath or a constant temperature metal bath for reaction, so that ERA isothermal amplification and CRISPR cleavage reaction are carried out simultaneously in one reaction system;

[0090] (3) When using the ssDNA-FQ fluorescent probe, place the reaction tube in a 37°C water bath for 40 minutes, and then observe the results under a handheld ultraviolet lamp. If the reaction product has no fluorescence brightness under ultraviolet light or no brightness when observed with the naked eye, it means that Mycoplasma gallisepticum is not detected in the sample to be tested; if the reaction product has fluorescence brightness under ultraviolet light or has brightness when observed with the naked eye, it means that Mycoplasma gallisepticum is detected in the sample to be tested.

[0091] When using the ssDNA-FB fluorescent probe, during on-site testing, after the reaction tube is placed in a 37-degree water bath or metal bath for 40 minutes, the test strip is inserted into the reaction system. Within 5-10 minutes, the result is determined based on whether the required bands appear at the test line and control line on the test strip: if bands appear at both the test line and the control line, or only at the test line, the test result is positive; if only at the control line, the test result is negative; if there are no bands at both the test line and the control line, the test reaction is invalid and needs to be repeated. The test results of the positive control are shown as follows: Figure 6 As shown, (A) observe the results under ultraviolet light; (B) use test strips to display the test results.

[0092] The above description is only a preferred embodiment of the present invention and does not limit the technical scope of the present invention. Therefore, any slight modification, equivalent change and modification made to the above embodiment according to the technical essence of the present invention, and other detection techniques or detection kits of Mycoplasma gallisepticum based on the new nucleic acid detection marker hmpG1 of the present invention, all belong to the scope of protection of the present invention.

Claims

1. A kit for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method, characterized in that: Includes sample lysis buffer, reaction buffer, ERA primer, crRNA guide sequence, Cas12a enzyme, ssDNA fluorescent probe and colloidal gold test strip; The nucleotide sequence of the ERA primer is: F:5'-TTTTATTAGCATAATCTCCACCTGAGCATGA-3', R:5'-GTAAGATATAACCAAGCCCTTTTAGTGAATC-3'; The crRNA guide sequence is: 5'-UAAUUUCUACUAAGUGUAGAUCAAUUGUUUAUUUGAACCCAAUC-3'.

2. The kit for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method according to claim 1, characterized in that The ssDNA fluorescent probe is a single-stranded nucleotide sequence with FAM or FITC labeled at the 5' end and BHQ1 or Biotin labeled at the 3' end.

3. The kit for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method according to claim 1, characterized in that The nucleotide sequence of the ssDNA fluorescent probe is ssDNA-FQ: 5'-FAM-TTTTTT-BHQ1-3' or 5'-FITC-TTTTTT-BHQ1-3', and ssDNA-FB: 5'-FAM-TTTTTT-BIO-3' or 5'-FITC-TTTTTT-BIO-3'.

4. The kit for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method according to claim 1, characterized in that Also included are a positive control plasmid carrying a target DNA specific for Mycoplasma gallisepticum, and a negative control, E. coli DH5a genomic DNA.

5. Use of a kit for rapid detection of Mycoplasma gallisepticum based on the ERA-CRISPR / Cas12a one-step method according to any one of claims 1 to 4 in visual detection of Mycoplasma gallisepticum.

6. A method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method, characterized in that: The steps include: S1. Place the sample cotton swab in a lysis buffer to release the mycoplasma genomic DNA in the sample to be tested; S2. Add the above-lysed mycoplasma genomic DNA and the reaction system into a new reaction tube, and then place the reaction tube in a constant temperature water bath or a constant temperature metal bath for reaction, so that the ERA isothermal amplification and CRISPR cleavage reaction are carried out simultaneously in the same reaction system, with ERA amplification and CRISPR cleavage at the same time; S3. When using the ssDNA-FQ fluorescent probe, after the reaction is completed in a constant temperature water bath or a constant temperature metal bath, use a handheld ultraviolet lamp to detect the fluorescent signal, and determine the test result based on the presence or absence of the fluorescent signal; when using the ssDNA-FB fluorescent probe, after the reaction is completed in a constant temperature water bath or a constant temperature metal bath, insert the test strip into the reaction tube, and determine the result by observing whether a band appears at the test line on the test strip within 5-10 minutes.

7. The method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method according to claim 6, characterized in that In the step S2, the reaction system is: 1.0 μM of each F / R primer, 10 μL of solvent, 1.0 μL of activator, 2.5 μL of 10×Reaction buffer, 400 nM LbCas12a enzyme, 250 nM crRNA, 100 nM ssDNA, 2.0 μL of DNA template, ddH2O is added to 25 μL, mixed and reacted at 37°C for 40 minutes.

8. The method for rapid detection of Mycoplasma gallisepticum based on ERA-CRISPR / Cas12a one-step method according to claim 6, characterized in that In step S2, the reaction tube is placed in a 37° C. water bath or metal bath for 40 minutes, and the result is observed under a handheld ultraviolet lamp; or a test strip is inserted into the reaction tube, and the test result can be observed with the naked eye within 10 minutes.

Images