TaqMan probe real-time fluorescent quantitative PCR (Polymerase Chain Reaction) kit and method for mycoplasma capricolum subsp.capripneumoniae

Abstract

The invention relates to the technical field of pathogenic bacterium detection, in particular to a TaqMan probe real-time fluorescent quantitative PCR (polymerase chain reaction) kit and method for mycoplasma capricolum subsp.capripneumoniae. The specific gene of the Mccp is successfully identified by performing comparative genomics analysis on the disclosed genomes of 26 mycoplasma capricolum subspecies capripneumonia and 235 other mycoplasmas for the first time. A TaqMan probe real-time fluorescent quantitative PCR (Polymerase Chain Reaction) detection kit special for Mccp detection is designed by taking the gene as a detection target. The efficient detection method for Mccp is established, and the technical problem that the detection effect of an existing detection technology is not ideal is solved. According to the scheme, the diagnosis speed and accuracy of the contagious goat pleuropneumonia are improved, reliable technical support is provided for early discovery, timely treatment and emergency immunization, economic losses can be effectively reduced, healthy development of the sheep raising industry is guaranteed, and important scientific significance and economic benefits are achieved.

Description

Technical Field

[0001] The invention relates to the technical field of pathogenic bacteria detection, and in particular to a TaqMan probe real-time fluorescence quantitative PCR kit and a method for Mycoplasma caprae pneumoniae subspecies. Background Art

[0002] Contagious caprine pleuropneumonia (CCPP) is a disease that must be reported in the World Organization for Animal Health (WOAH) list. It has been newly added as a Class II animal disease in the latest "List of Class I, II and III Animal Diseases" released in 2022. The morbidity and mortality rates of CCPP can reach up to 100% and 80%, respectively. The disease has caused serious economic losses in Asia, Africa and the Middle East. It mainly infects goats, but sheep can also be infected. Survey data in recent years show that it has also caused serious harm to wild animals such as Nubian antelopes, wild goats, ibex, Laristan argali, Arabian oryx and Tibetan antelope. According to the course of the disease, it can be divided into chronic, acute and subacute. The typical clinical symptoms of acute and subacute CCPP include fever, dyspnea and cough, and the pathological and anatomical characteristics are unilateral severe pleural effusion and fibrinous pleuropneumonia in the chest cavity.

[0003] The pathogen of the disease is Mycoplasma capricolum subspecies capripneumoniae (Mccp). However, due to the harsh growth conditions of Mccp, slow growth, long isolation time and high failure rate, it is easy to miss the best treatment time. In addition, other mycoplasmas such as Mycoplasma ovipneumoniae (Movi) are often present in the diseased material. Its fast growth rate will mask the growth of Mccp and easily lead to misdiagnosis. Therefore, it is difficult to achieve accurate diagnosis by relying solely on conventional bacterial isolation and culture. Secondly, biochemical identification and serological detection methods can also be used for the diagnosis of CCPP, but these methods are highly subjective and prone to false positives or false negatives, which affect the test results. Finally, Mccp belongs to the Mycoplasma mycoides cluster, which also includes M.mycoidesssp.Capri (Mmc), Mycoplasma capricolum subsp.Capricolum (Mcc) and Mycoplasmamycoides subsp.Mycoides (Mmm). These four mycoplasmas are highly similar in phenotype and genomic characteristics. The current national standard for the diagnosis of goat contagious pleuropneumonia in my country uses PCR as the nucleic acid detection method, and the detection target gene is arcD, which is widely present in the Mycoplasma mycoides cluster. The detection of arcD has extremely high requirements for primers, and the PCR sensitivity is low, which is easy to miss. Therefore, it is necessary to establish a specific, sensitive and rapid method for detecting Mccp, which can provide an effective technical means for the comprehensive prevention and control and purification of goat contagious pleuropneumonia, and has important significance and economic value. Summary of the invention

[0004] The present invention aims to provide a TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum pneumoniae subspecies, so as to solve the technical problem that the detection effect of the identification method of Mycoplasma capricolum pneumoniae subspecies in the prior art is not ideal.

[0005] In order to achieve the above object, the present invention adopts the following technical scheme:

[0006] The TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capricolum, wherein the target gene used for detection is the gene shown in SEQ ID NO.3.

[0007] Furthermore, a TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum pneumoniae subspecies is provided, which comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.9 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.10; and a probe having a nucleotide sequence as shown in SEQ ID NO.8, wherein a fluorescent group is connected to the 5' end of the probe and a fluorescent quenching group is connected to the 3' end.

[0008] Furthermore, the fluorescent group is carboxyfluorescein; and the fluorescence quenching group is a black hole quenching group.

[0009] Further, it is used to form a reaction system; the reaction system includes 0.3-0.5 μL forward primer, 0.3-0.5 μL reverse primer, 0.6-1 μL probe, 1-3 μL template DNA, 0.4 μL internal reference dye, 10 μL premix, and water is used to make up the reaction system to 20 μL;

[0010] Preferably, the premix is ​​a quantitative premix for the probe method; more preferably, the premix is ​​2× PrimeDirect Probe RT-qPCR Mix, with UNG from Takara Biotech (Dalian) Co., Ltd.;

[0011] Preferably, the internal reference dye is 50×ROX Reference Dye;

[0012] Preferably, the nucleotide concentrations of the forward primer, reverse primer, and probe are 0.2 μM, 0.2 μM, and 0.2 μM, respectively;

[0013] Preferably, the water is double distilled water or sterile enzyme-free water.

[0014] Furthermore, the reaction system includes 0.4 μL forward primer, 0.4 μL reverse primer, 0.8 μL probe, 2 μL template DNA, 0.4 μL internal reference dye, 10 μL premix, and the reaction system is filled to 20 μL with water.

[0015] Furthermore, the working procedure of the reaction system is: first, keep at 25°C for 10 minutes; then, pre-denature at 94.5-95.5°C for 25-35 seconds; next, denature at 95°C for 5 seconds, and then extend at 60°C for 31 seconds; denaturation and extension are performed for 40 cycles.

[0016] Furthermore, the pre-denaturation method is: pre-denaturation at 95° C. for 30 seconds.

[0017] Furthermore, the detection limit of the TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum pneumoniae subspecies was 3.27×10 1copies / μL, or 4.3×10 -7 ng / μL.

[0018] Furthermore, the TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricoposterior pneumonia subspecies also includes a plurality of standard plasmid samples prepared using standard plasmids to form a concentration gradient; the standard plasmid is a plasmid formed by integrating a gene with a sequence of SEQ ID NO.3 into a T vector;

[0019] The standard plasmid sample is used to establish a standard curve, and the standard curve is used to calculate the copy number of the gene with the sequence of SEQ ID NO.3 in the sample to be tested according to the Ct value of the sample to be tested.

[0020] Furthermore, the ordinate of the standard curve is the CT value of TaqMan probe real-time fluorescence quantitative PCR, and the abscissa is the logarithmic value of the standard plasmid copy number.

[0021] In summary, the principle and beneficial effects of this technical solution are:

[0022] For the detection of Mycoplasma capricolum subsp. capripneumoniae (Mccp), the current technology mainly relies on the PCR detection method established by the target gene arcD. Although this method has played an important role in the initial screening, this gene is widely present in the mycoplasma cluster. Once the nucleic acid mutation occurs, the detection method based on this gene may not be able to completely distinguish Mccp from other closely related species. In addition, the PCR detection technology has low sensitivity, resulting in a low positive rate. However, for a long time, due to the high similarity of the genome of Mycoplasma capricolum subsp. capripneumoniae with other pathogens, researchers have not found other target genes that can replace the target gene arcD for the detection of Mycoplasma capricolum subsp. capripneumoniae.

[0023] In order to overcome the above limitations, it is urgent to explore new detection targets to improve the overall detection effect. In this context, the inventors conducted a comparative genomics analysis of the genomes of 26 published Mycoplasma capricoposterior pneumonia (Mccp) and 235 other related mycoplasmas for the first time, screened and verified through rigorous experiments, and successfully identified the gene shown in SEQ ID NO.3 as a specific gene unique to Mccp. This newly discovered pseudoprotein gene only exists in Mccp, and the gene sequence is highly conserved, which provides a solid foundation for the development of highly specific diagnostic tools. In addition, the application of the gene shown in SEQID NO.3 in the specific detection of Mccp is reported for the first time in this scheme.

[0024] Based on the new discovery of this specific gene, the inventors further designed a TaqMan probe real-time fluorescence quantitative PCR detection kit specifically for Mccp detection. This kit uses advanced TaqMan probe technology, which not only provides higher specificity and sensitivity than the traditional dye method, but also ensures fast and accurate result output. Specifically:

[0025] Enhanced specificity: The unique design of TaqMan probe enables it to accurately recognize the target DNA sequence, greatly reducing the possibility of nonspecific amplification.

[0026] Improved sensitivity: By optimizing the design of primers and probes and combining them with efficient hot-start Taq DNA polymerase, the kit can maintain good detection performance even at extremely low concentrations.

[0027] Quantification capability: Real-time fluorescence quantitative PCR technology allows absolute quantitative analysis of Mccp DNA in samples, which is particularly important for assessing the extent of infection and monitoring the effectiveness of treatment.

[0028] This technical solution has established an efficient detection method specifically for Mccp, providing strong technical support for the prevention and control of goat infectious pleuropneumonia. This innovation not only helps to improve the speed and accuracy of disease diagnosis, but also promotes vaccine development and epidemiological surveys. In addition, it provides reliable technical support through early detection, timely intervention treatment and emergency immunization, which can effectively reduce economic losses and ensure the healthy development of the sheep industry, and has important scientific significance and practical application value.

[0029] In summary, this technical solution provides a specific, sensitive and rapid TaqMan probe real-time fluorescence quantitative PCR detection method for the accurate identification and monitoring of Mccp, providing an important detection tool for the comprehensive prevention and control and purification of goat contagious pleuropneumonia, and also showing significant social and economic benefits. In the future, with the development of more research and technological advances, we expect this method to be applied in a wider range of fields and make greater contributions to the detection and purification of goat contagious pleuropneumonia worldwide. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the specific verification of the Mccp pseudoprotein genes Group_2294, Group_1429 and Group_1437 in Example 1 (M: Marker; 1. Mycobacterium paratuberculosis; 2. Mycoplasma capricolum subspecies capripneumoniae; 3. Mycoplasma ovipneumoniae; 4. Cryptobacterium pyogenes; 5. Moraxella bovis; 6. Mannheimia hemolytica; 7. Pasteurella multocida; 8. Escherichia coli).

[0031] Figure 2This is the specific verification of the Mccp pseudoprotein genes Group_2372 and Group_1529 in Example 1 (M: Marker; 1: Mycoplasma capricolum subspecies capricolum; 2: Mycoplasma ovipneumoniae; 3: Mycobacterium paratuberculosis; 4: Mannheimia hemolytica; 5: Pasteurella multocida; 6: Acronella fowleri; 7: Escherichia coli; 8: Streptococcus ovis; 9: Staphylococcus aureus; 10. Blank).

[0032] Figure 3 This is the result of the Group_1529 genome sequence alignment analysis in Example 1.

[0033] Figure 4 This is the Mccp-Group_1529 gene gel recovery and identification result of Example 2 (M: Marker; 1 and 2 are both Mccp-Group_1529 genes).

[0034] Figure 5 This is a photo of the Mccp-Group_1529 plasmid positive clone in Example 2.

[0035] Figure 6 This is the identification result of Mccp-Group_1529 positive clone in Example 2.

[0036] Figure 7 is the standard plasmid amplification curve of Example 4 (1 is 3.27×10 8 Copies; 2 is 3.27×10 7 Copies; 3 is 3.27×10 6 Copies; 4 is 3.27×10 5 Copies; 5 is .27×10 4 Copies; 6 is 3.27×10 3 Copies; 7 is 3.27×10 2 Copies).

[0037] Figure 8 This is the standard curve of Example 4.

[0038] Fig. 9 It is the specific detection result of the common PCR of Mycoplasma capricolum pneumoniae subspecies of Example 5 (M: Marker; 1-5: Mycoplasma ovis, Mycoplasma capricolum subspecies, Mycoplasma mycoides subspecies capricolum, Mycoplasma bovis, Mycoplasma hyopneumoniae genome; 6-15: Mannheimia hemolytica, Pasteurella multocida, Cryptobacterium pyogenes, Escherichia coli, Staphylococcus aureus, Streptococcus ovis, Streptococcus equi, Moraxella bovis, Corynebacterium pseudotuberculosis, Mycobacterium paratuberculosis genome; 16: C87001 genome).

[0039] Fig.10 The specific detection results of the TaqMan probe real-time fluorescence quantitative PCR of Mycoplasma capricolum pneumoniae subspecies in Example 5 (1-5: Mycoplasma ovis, Mycoplasma capricolum subspecies, Mycoplasma mycoides subspecies capricolum, Mycoplasma bovis, Mycoplasma hyopneumoniae genomes; 6-15: Mannheimia hemolytica, Pasteurella multocida, Cryptobacterium pyogenes, Escherichia coli, Staphylococcus aureus, Streptococcus ovis, Streptococcus equi, Moraxella bovis, Corynebacterium pseudotuberculosis, Mycobacterium paratuberculosis genomes; 16: C87001 genome).

[0040] Fig.11 The detection result of the sensitivity detection of mycoplasma capricolum pneumoniae subspecies TaqMan probe for positive plasmid in Example 6 (1: 3.27×10 8 Copies / μL; 2: 3.27×10 7 Copies / μL; 3: 3.27×10 6 Copies / μL; 4: 3.27×10 5 Copies / μL; 5: 3.27×10 4 Copies / μL; 6: 3.27×10 3 Copies / μL; 7: 3.27×10 2 Copies / μL; 8: 3.27×10 1 Copies / μL).

[0041] Fig.12 The results of the sensitivity test of the TaqMan probe of Mycoplasma capricolum pneumoniae in Example 6 for the C87001 genome (1: 4.3 ng / μL; 2: 4.3×10 -1 ng / μL; 3: 4.3×10 -2 ng / μL; 4: 4.3×10 -3 ng / μL; 5: 4.3×10 -4 ng / μL; 6: 4.3×10 -5 ng / μL; 7: 4.3×10 -6 ng / μL; 8: 4.3×10 -7 ng / μL).

[0042] Fig.13 The results of the PCR sensitivity test of Mycoplasma capricoposterior pneumoniae for positive plasmids in Example 6 (M: Marker; 1: 3.27×10 8 Copies / μL; 2: 3.27×10 7 Copies / μL; 3: 3.27×10 6Copies / μL; 4: 3.27×10 5 Copies / μL; 5: 3.27×10 4 Copies / μL; 6: 3.27×10 3 Copies / μL; 7: 3.27×10 2 Copies / μL; 8: 3.27×10 1 Copies / μL).

[0043] Fig.14 This is the detection result of the Mycoplasma capricolum subspecies capricolumneumoniae TaqMan probe real-time fluorescence quantitative PCR for clinical samples in Example 8. DETAILED DESCRIPTION

[0044] The present invention is further described in detail below in conjunction with examples, but the embodiments of the present invention are not limited thereto. Unless otherwise specified, the technical means used in the following examples and experimental examples are conventional means well known to those skilled in the art, and the materials, reagents, etc. used can be obtained from commercial sources.

[0045] Example 1: Screening and specificity verification of detection target genes

[0046] All the whole genome sequences of Mycoplasma caprico-pneumoniae (Mccp), Mycoplasma ovis pneumoniae (Movi), Mycoplasma caprico-pneumoniae (Mcc), Mycoplasma caprico-pneumoniae (Mmc) and Mycoplasma caprico-pneumoniae (Mmm) were obtained from the database, and a total of 26 strains of Mccp, 169 strains of Movi, 7 strains of Mcc, 43 strains of Mmc and 16 strains of Mmm were obtained. After bioinformatics analysis, it was found that there were 30 pseudoprotein genes that existed only in Mccp. We further analyzed and screened the 30 pseudoprotein genes and found that only one pseudoprotein gene as a candidate detection target could meet the detection requirements. Five of the pseudoprotein genes (candidate detection targets) are used as examples for specific explanation. These five pseudoprotein genes are group_2372, group_2294, group_1529, group_1437, and group_1429. Primers were designed for the genes in a conventional manner, and specific primers for the five pseudoprotein genes were used to perform PCR tests (using genomic DNA of different pathogens to be tested as templates to detect whether there was gene amplification in these pathogens). The results are as follows: Figure 1 and Figure 2 As shown, it was preliminarily shown that group_1529 had good gene specificity and could be used for further experiments.

[0047] The gene sequence of group_2372 can be found in SEQ ID NO.1: ATGAATAAAACAGGTAATGTTGATCAT ATTATTAATCCACATAACCCGAATGAAATTTTATTTTTAGGATATGAGAGAGACACAAATCTTAAAGATGGATATAAGTTAAAAAAAATACCAAATAATGTAAATAAGGCTCCTACATATTTACCTAAATTTATTACAAGCTTAGAGAAATCCTTTCAATTTAATAGTAACGAAAAAATTAGAGGCATTGAAAAATGA;

[0048] The gene sequence of group_2294 can be found in SEQ ID NO.2: ATGGATTTTAAAAATAGAGATATTATG GGATATGGGGTTGTGCCAATTCATATAAACGATATTCTAAAAACTCCAAAAGATGAAATTAAACTAATCATTACTGGACAAAATCAAAAATACAATACTTATAATAACAATATTTTAATTCCAACATATGATAATAACTATCCTTTTGTTTGTAAAGCAACATTATGTTATTTTGTAGACTGTTCGCGTCAACAAGGTGTAGATTATACTAATACTGAACTAAGTATTAAATTTGGACGAATTAAAAAAGATAAAAATAACAAACTGCAAATCATAGATATAAACAAAAATAACCAAGATACAGATAAATTAATTTATGAAAGAGAAGCTAGAGATTGA;

[0049] The gene sequence of group_1529 is shown in SEQ ID NO.3: TTGAAAGTTTATATAGAGGATAATAAG TTTAAATATTTTGATCATCTAACATTAGCTGAACAAAATGATAAAAACAAAAACTTAGTAGTTGATGAAAATGGAACTTTAAATAAGATAAAAATATCTTTTTTTGATATGCAAACTATTTTTAGTCCTAAAAAAGTTTTAAAAGATGAAGTTGTAGACAAATATGATGAAACTAATACTCAATTATTACAAGTTGGCTATAAATTGGAAACCCCATTAAAAAGTATAAAAATGAAGCAAGCTAATAAAAAAATAAAAAAAGTTCCTAAACATCTGCCATTAAAAATTAATTCATTAGACAATGCTTTTAGGTATATAGAAGCAGCATCTGTTGATAATTTAGATAAATGA;

[0050] The gene sequence of group_1437 is shown in SEQ ID NO.4: ATGATAAAAGTAAAATTTTTTTTATCA CACACAAATTCTTCTGTGAACAATTTGAAAAAAAGAATTGATTCTTTAAATTCAAAATTCATGACAATCACAAAATATATAAACACTAAAGGATTAGAATGTGATATTTTATTTATAGATGAATGTGGTGTTGTAAATGACAGTGATATGAAAAAAGTTCTTGAAAATAATAATTCAGAATTATTAGTATTAGTGGGTGATATTTTTCAAATTGAATCGATAGGATTTGGAAGATGGTTTAGTTACTCTAAAGAGGTTATGCCTAAAAAAGCAATAAATGAGTTAAAAGAACAATATAGAACTGATAATCGATCTTTGCAAAAGTTATGA;

[0051]

[0052] Although genomic analysis and comparison of the whole genomes of mycoplasmas of similar species have been performed, it has been preliminarily determined that the gene sequences of group_2294, group_1437, and group_1429 are unique to Mycoplasma caprico-pneumoniae (Mccp). However, when verifying the specificity in actual experiments, it was found that the theoretical species-specific genes discovered through bioinformatics research may actually have similar gene sequences in other respiratory pathogenic bacteria. Although theoretical analysis has shown that the gene sequences of group_2294, group_1437, and group_1429 will not appear in pathogens other than Mccp, PCR results show that these three genes have non-specific amplification bands in other pathogens. In particular, according to the PCR results, the group_2294 gene may be widely present in various pathogens, and the group_1437 and group_1429 genes may exist simultaneously in Mycoplasma ovis pneumoniae and Mycoplasma caprico-pneumoniae.

[0053] In addition, through theoretical research in bioinformatics, group_2372 exists in the Mycoplasma capricolumneumoniae subspecies and is its unique gene. However, in practice, the efficiency of amplifying this gene by PCR is low (the electrophoresis signal is very weak), so it is not suitable as a detection target. It is very likely that the potential candidate detection target genes discovered through bioinformatics research are ultimately not suitable as detection targets after experimental research (actual experiments have found that the candidate gene is not unique to the target species, or the gene amplification efficiency is low). Fortunately, this scheme conducted comparative genomic analysis on 26 published genomes of Mycoplasma capricolumneumoniae subspecies (Mccp) and 235 genomes of other related mycoplasmas, and finally discovered the group_1529 gene, achieving unexpected technical effects. In addition, it should be noted that for Figure 2 The electrophoresis results show that the PCR system (specific types and amounts of reaction premix, template, etc., the same amount of primers, and the use of specific primers for these two genes) and reaction procedures of group_2372 and group_1529 genes are consistent; during the electrophoresis process, PCR products were loaded and the loading amount was consistent. Figure 2 The intensity of the electrophoresis bands can reflect the difference in amplification efficiency between group_2372 and group_1529 genes. Although group_2372 gene is a Mccp-specific gene, its amplification efficiency is not ideal and is not suitable for amplification and detection by PCR.

[0054] In summary, after whole genome comparison of multiple pathogens, multiple candidate detection targets were found. Further research on these detection targets revealed that only the group_1529 gene was specific to M. capricolum subspecies capricolum and was easy to detect. It can be seen that using the group_1529 gene as a detection target for M. capricolum subspecies capricolum has achieved unexpected technical effects in distinguishing M. capricolum subspecies capricolum from other pathogens.

[0055] In addition, further Blast analysis and comparison of group_1529 genes were performed, and the results showed that the coverage and homology of group_1529 and the Mccp genome in the database reached 100%, which was highly conservative and specific, and there were no other similar genes, such as Figure 3 As shown. Combined with the specificity results, we finally chose the group_1529 pseudoprotein gene as the target gene for the detection of Mycoplasma capricoposterior pneumonia subspecies. The pseudomonoprotein gene of the new detection target is a conservative gene that was discovered and identified for the first time and only exists in MCCP. It has strong specificity and is ideal for the detection of target bacteria (with two major characteristics: stability and conservatism). That is, the group_1529 gene is unique to Mccp and its sequence is stable and conserved between different Mccp individuals. This ensures that Mccp can be distinguished from other pathogens by detecting the group_1529 gene, and stable detection can be achieved for all Mccp to avoid false positives or false negatives. If the target gene is not specific, non-Mccp will be misdetected as Mccp; if the target gene is not conservative, the sequence of the gene in different Mccp individuals is very different, and Mccp will be misdetected as non-Mccp.

[0056] Example 2: Construction of standard plasmid for group_1529 pseudoprotein gene

[0057] (1) Amplification of target fragment

[0058] The hypothetical protein Group_1529 of Mycoplasma pneumoniae subspecies (Mccp) designed for screening and primers were used to perform PCR amplification on the target fragment. The PCR reaction solution preparation system is shown in Table 1, and the target fragment amplification reaction procedure is shown in Table 2.

[0059] The sequence of the upstream primer of Group_1529 is shown in SEQ ID NO.6: TTGAAAGTTTATATAGAGGA TAA;

[0060] The sequence of the downstream primer of Group_1529 is shown in SEQ ID NO.7: ATCAACAGATGCTGCTTCTAT.

[0061] Table 1: Target fragment amplification reaction system

[0062]

[0063]

[0064] Table 2: Target fragment amplification reaction program (template DNA denaturation, annealing, extension cycle for 35 times)

[0065] Reaction steps Temperature Time Pre-denaturation 94℃,2min Template DNA denaturation 98℃，10s annealing 50℃，30s extend 72℃，30s Final extension 72℃,10min

[0066] (2) Recovery and purification of target fragment

[0067] The amplified PCR products were subjected to agarose gel electrophoresis. First, 50×TAE was diluted to 1×TAE with sterile enzyme-free water. 40 ml of 1×TAE and 0.4 g of Agarose agarose powder were melted and mixed in a microwave oven. Then, 4 μl of M5 Gelred plus nucleic acid dye (10000×) was added to prepare a 1% agarose gel block. 10 μl of 6×Loading Buffer was added to the PCR product of each sample after amplification. Trans2K DNA Marker and PCR products were added to the spotting wells. Electrophoresis was performed at 100 V for 23 min. UV imaging showed that the amplification result was the desired target fragment. The fragment was recovered and purified using a DNA gel recovery kit. For specific purification steps, see the instructions for the TIANGEN DNA gel recovery kit. For details of the electrophoresis results, see Figure 4 .

[0068] (3) Ligation and transformation of pMD-19T vector

[0069] The target fragment was connected to the pMD-19T Vector high-efficiency cloning PCR product (TA Cloning) dedicated vector. The reaction system was set up as shown in Table 3. The reaction solution was gently mixed and incubated at 16°C for 30 minutes.

[0070] Table 3: pMD-19T vector ligation reaction system

[0071] Reagents Volume (μL) pMD-19T vector 1 Buffer 5 Template DNA 4

[0072] (4) Transformation of the target fragment into competent cells

[0073] Add the entire amount of ligation product (10 μL) to 100 μL E. coli competent cells, mix gently and place on ice for 30 minutes. Transfer to a 42°C water bath for 45 seconds, then quickly transfer to ice for 1 minute. Add 890 μL SOC medium and culture at 37°C with shaking for 60 minutes. Take 100 μL of the transformation solution and apply it to L-agar plate medium containing Amp and culture at 37°C overnight. Select white colonies and verify by PCR.

[0074] (5) Single clone selection and bacterial culture PCR identification

[0075] In a clean bench, add 7.5 ml of LB liquid culture medium containing antibiotics to the shaking tube, take out the Amp plate, pick up white single colonies with a sterile pipette tip and put them into a 15 ml shaking tube. Pick 4 single clones from each plate and label them. The negative control is a single clone without picking. Cultivate at 37°C, 220 rpm / h for 12-16 hours. When the bacterial solution is not clear, collect the bacterial solution in the clean bench for identification. Mccp-Group_1529 plasmid positive clones refer to Figure 5 The bacterial solution PCR identification reaction system is shown in Table 4. The reaction procedure is: pre-denaturation at 95°C for 3 min; template DNA denaturation at 95°C for 30 s; annealing at 50°C for 30 s; extension at 72°C for 40 s; 35 cycles; final extension at 72°C for 5 min. The bacterial solution identification PCR product was subjected to electrophoresis. The results are shown in Figure 6 shown.

[0076] Table 4: Bacterial liquid PCR identification reaction system

[0077] Reagents Volume (μL) Forward Primer 0.5 Reverse primer 0.5 Template DNA 1.5 Sterile enzyme-free water 10 <![CDATA[Premix Taq TM ]]> 12.5

[0078] (6) Plasmid extraction and concentration determination

[0079] The PMD-19T-Group_1529 positive clone was expanded and cultured in Amp+LB broth. After overnight culture, the plasmid was extracted. For specific operation steps, please refer to the instructions of the Kangwei Century Endotoxin-free Plasmid Extraction Kit; the extracted plasmid solution was eluted into a centrifuge tube and stored at -20°C. Some samples were taken out and the concentration was measured using an ultra-micro spectrophotometer. The plasmid concentration was measured at 126.6ng / μL. The number of DNA copies contained in the unit volume of plasmid was calculated. DNA copy number = plasmid concentration (ng / L) × 10 -9 / (660×standard plasmid base number)×Avogadro constant.

[0080] The standard plasmid carrying the target gene Group_1529 was obtained by the above method.

[0081] Example 3: Probe Synthesis

[0082] Probes and primers were designed according to the Group_1529 gene sequence, as shown in Table 5. Among them, query_P1 was purified by HPLC, and query_L1 and query_R1 were purified by PAGE.

[0083] Table 5: Sequence information of probe primers (FAM is carboxyfluorescein group, BHQ1 is fluorescence quenching group)

[0084] name Sequence (5' to 3') serial number query_P1 6-FAM-5'AAAGTTCCTAAACATCTGCCA-3'-BHQ1 SEQ ID NO.8 query_L1 AGTTGGCTATAAATTGGAAACCC SEQ ID NO.9 query_R1 ACAGATGCTGCTTCTATATACCT SEQ ID NO.10

[0085] Example 4: Establishment of TaqMan real-time fluorescence quantitative PCR standard curve for Mycoplasma pneumoniae subspecies in goats

[0086] The standard plasmid was diluted to 3.27 × 10 8 copies / μL-3.27×10 2 The dilution gradient was 7 copies / μL. The diluted plasmid was used as a template. Real-time fluorescence quantitative PCR was performed according to the PCR reaction system and amplification program shown in Tables 6 and 7. The amplification curve is shown in Figure 7 As shown. With the logarithmic value of the plasmid copy number Log(X) as the x-axis and the Ct value as the y-axis, a standard curve is established, as shown in Figure 8 As shown. The regression equation is y = -3.2977x + 38.883, and the correlation coefficient is R 2 =0.9973, E=102%. This indicates that the gradient dilution shows a good linear relationship, and the amplification efficiency is as high as 102%. The Ct value is specifically the number of cycles corresponding to when the fluorescence signal intensity exceeds the set background threshold during the PCR amplification process.

[0087] Table 6: TaqMan real-time fluorescence quantitative PCR reaction system (this protocol uses a quantitative premix (probe method), specifically the "PrimeDirect Probe RT-qPCR Mix, with UNG (2×)" product of Takara Biotechnology (Dalian) Co., Ltd.; "ROX Reference Dye (50×)" is the internal reference dye prepared by the kit)

[0088] Reagents Preferred volume (μL) Available range (μL) Forward primer (query_L1, final concentration 0.2 μM) 0.4 0.3-0.5 Reverse primer (query_R1, final concentration 0.2 μM) 0.4 0.3-0.5 Probe (query_P1, final concentration 0.2 μM) 0.8 0.6-1 ROX Reference Dye(50×) 0.4 0.4 Template DNA 2 1-3 Sterile enzyme-free water 6 Fill up to 20 Probe qPCR Mix, with UNG (2×) 10 10 Total 20 20

[0089] Table 7: TaqMan real-time fluorescence quantitative PCR reaction program (template DNA denaturation, extension cycle for 40 times)

[0090]

[0091]

[0092] Example 5: Specific detection of Mycoplasma pneumoniae subspecies in goats by TaqMan real-time fluorescence quantitative PCR

[0093] Using standard plasmid pMD-19T-Group_1529 as a positive control and double distilled water as a blank control, five mycoplasmas, including Mycoplasma ovis, Mycoplasma capricolum, Mycoplasma mycoides subspecies capricolum, Mycoplasma bovis, and Mycoplasma hyopneumoniae, and genomic DNA of ten common sheep pathogens, including Mannheimia hemolytica, Pasteurella multocida, Cryptobacterium pyogenes, Escherichia coli, Staphylococcus aureus, Streptococcus ovis, Streptococcus equi, Moraxella bovis, Corynebacterium pseudotuberculosis, and Mycobacterium paratuberculosis, were used as templates to perform conventional PCR and TaqMan probe real-time fluorescence quantitative PCR amplification (for amplification system and program, see Tables 6 and 7) to detect the specificity of primers and probes. The test results are detailed in Fig. 9 and Fig.10 The experimental results show that the primers and probes of this scheme have good specificity in both ordinary PCR and TaqMan probe real-time fluorescence quantitative PCR, and can only detect Mycoplasma capricolum pneumoniae subspecies, and do not produce positive signals for other pathogens.

[0094] Example 6: Comparative analysis of the sensitivity of TaqMan real-time fluorescence quantitative PCR of Mycoplasma pneumoniae subspecies in goats. A 10-fold diluted standard plasmid (3.27×10 8 copies / μL-3.27×10 1 copies / μL) and C87001 genome (4.3ng / μL-4.3×10 -7 ng / μL) as template, and the sensitivity of primers and probes was tested. The results showed that the sensitivity of TaqMan probe real-time fluorescence quantitative PCR for detecting positive plasmids was 3.27×10 1 copies / μL( Fig.11 TaqMan probe real-time fluorescence quantitative PCR detected C87001 genome up to 4.3×10 -7 ng / μL( Fig.12 The sensitivity of conventional PCR detection was found to be 3.27×10 5 copies / μL( Fig.13 shown).

[0095] Example 7: Repeatability Analysis of TaqMan Real-time Fluorescence Quantitative PCR for Mycoplasma pneumoniae Subspecies in Caprine

[0096] Plasmid standards (3.27×10 6 copies / μL-3.27×10 3The real-time fluorescence quantitative PCR reaction was performed with 3 biological replicates for each dilution standard plasmid to analyze the intra-group differences; the same conditions were used to perform 3 independent replicates to analyze the inter-group differences. The coefficient of variation was calculated according to the formula "coefficient of variation (CV) = standard deviation (SD) / mean (X)". The experimental results are shown in Table 8.

[0097] Table 8: Real-time fluorescence quantitative PCR repeatability test results of Mycoplasma capricolum subspecies capricolum subspecies TaqMan probe (in the table, x is the mean value, S is the standard deviation, and CV is the coefficient of variation)

[0098]

[0099]

[0100] Example 8: Detection of clinical samples

[0101] In order to evaluate the practicality of the TaqMan probe real-time fluorescence quantitative PCR method established in this study for clinical sample detection, the genomic DNA of goat nasal swabs collected in Chongqing in 2024 was used as a template, and the constructed standard plasmid (pMD-19T-Group_1529) was used as a positive control. TaqMan probe real-time fluorescence quantitative PCR detection was performed according to the above-mentioned reaction system and reaction procedure. At the same time, the results were compared with the ordinary PCR results established in this laboratory to understand the prevalence of CCPP in Chongqing. The results showed that 10 positive samples were detected using the TaqMan probe method among 257 nasal swabs in three districts and counties of Chongqing, with a positive rate of 3.89%. For experimental results, see Fig.14 and Table 9.

[0102] Table 9: Comparison of the results of Mccp TaqMan probe real-time fluorescence quantitative PCR, conventional PCR and isolation culture on clinical samples

[0103]

[0104] The above is only an embodiment of the present invention, and the common knowledge such as the known specific technical solutions and / or characteristics in the solution is not described in detail here. It should be pointed out that for those skilled in the art, without departing from the technical solution of the present invention, several modifications and improvements can be made, which should also be regarded as the protection scope of the present invention, and these will not affect the effect of the implementation of the present invention and the practicality of the patent. The scope of protection required by this application shall be based on the content of its claims, and the specific implementation methods and other records in the specification can be used to interpret the content of the claims.

Claims

1. A TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capricolum, characterized in that: The target gene used for detection is the gene shown in SEQ ID NO.

3.

2. The TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capric pneumonia according to claim 1, characterized in that: It includes a forward primer with a nucleotide sequence as shown in SEQ ID NO.9 and a reverse primer with a nucleotide sequence as shown in SEQ ID NO.10; and a probe with a nucleotide sequence as shown in SEQ ID NO.8, wherein the 5' end of the probe is connected to a fluorescent group and the 3' end is connected to a fluorescent quenching group.

3. The TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capric pneumonia according to claim 2, characterized in that: The fluorescent group is carboxyfluorescein; the fluorescent quenching group is a black hole quenching group.

4. The TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capric pneumonia according to claim 2, characterized in that: It is used to form a reaction system; the reaction system includes 0.3-0.5 μL forward primer, 0.3-0.5 μL reverse primer, 0.6-1 μL probe, 1-3 μL template DNA, 0.4 μL internal reference dye, 10 μL premix, and water is used to make up the reaction system to 20 μL; Preferably, the premix is ​​a quantitative premix for the probe method; more preferably, the premix is ​​2× PrimeDirect Probe RT-qPCR Mix, with UNG from Takara Biotech (Dalian) Co., Ltd.; Preferably, the internal reference dye is 50×ROX Reference Dye; Preferably, the nucleotide concentrations of the forward primer, reverse primer, and probe are 0.2 μM, 0.2 μM, and 0.2 μM, respectively; Preferably, the water is double distilled water or sterile enzyme-free water.

5. The TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capric pneumonia according to claim 4, characterized in that: The reaction system includes 0.4 μL of forward primer, 0.4 μL of reverse primer, 0.8 μL of probe, 2 μL of template DNA, 0.4 μL of internal reference dye, and 10 μL of premixed solution, and the reaction system is filled to 20 μL with water.

6. The TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capric pneumonia according to claim 2, characterized in that: The working procedure of the reaction system is: first, keep at 25°C for 10 minutes; then, pre-denature at 94.5-95.5°C for 25-35 seconds; next, denature at 95°C for 5 seconds, and then extend at 60°C for 31 seconds; denaturation and extension are performed for 40 cycles.

7. The TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capripneumoniae according to claim 6, characterized in that: The pre-denaturation method is: pre-denaturation at 95°C for 30s.

8. The TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capripneumoniae according to any one of claims 1 to 7, characterized in that: The detection limit is 3.27×10 1 copies / μL, or 4.3×10 -7 ng / μL.

9. The TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capripneumoniae according to any one of claims 1 to 7, characterized in that: Also included are a plurality of standard plasmid samples prepared using a standard plasmid to form a concentration gradient; the standard plasmid is a plasmid formed by integrating a gene with a sequence of SEQ ID NO.3 into a T vector; The standard plasmid sample is used to establish a standard curve, and the standard curve is used to calculate the copy number of the gene with the sequence of SEQ ID NO.3 in the sample to be tested according to the Ct value of the sample to be tested.

10. The TaqMan probe real-time fluorescence quantitative PCR kit for Mycoplasma capricolum subspecies capripneumoniae according to claim 9, characterized in that: The ordinate of the standard curve is the CT value of TaqMan probe real-time fluorescence quantitative PCR, and the abscissa is the logarithmic value of the standard plasmid copy number.

Images