Trichoderma auritum GUWM22 and application thereof

By isolating and identifying T. ummelli GUWM22, this strain has a significant inhibitory effect on a variety of plant pathogens, especially on anthrax, which solves the problems of chemical pesticide pollution and drug resistance in the prior art and provides an environmentally friendly and efficient biocontrol method.

CN120192855AActive Publication Date: 2025-06-24GUIZHOU UNIV

Patent Information

Application Number
CN202510342059.7
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-21
Publication Date
2025-06-24
Estimated Expiration
2045-03-21

AI Technical Summary

Technical Problem

The prior art relies on chemical pesticides when preventing and treating plant diseases, resulting in increased environmental pollution and pathogenic resistance, and lacks effective green prevention and control methods.

Method used

A strain of T. ummelli GUWM22 was isolated and identified. This strain had a significant inhibitory effect on a variety of plant pathogens, especially the inhibitory rate of the anthrax of pepper can reach up to 89.52%.

Benefits of technology

Trichoderma Umeng GUWM22 provides a new strain resource. Through its spore suspension or bacterial agent, it can effectively prevent and treat anthrax of peppers, achieving environmentally friendly and efficient biocontrol effects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120192855A_ABST
    Figure CN120192855A_ABST
Patent Text Reader

Abstract

The invention discloses a Trichoderma auritum GUWM22 strain and application thereof, and belongs to the field of microorganisms. The preservation number of the trichoderma auritum GUWM22 is CCTCC (China Center for Type Culture Collection) NO: M20242639, the preservation date is November 26, 2024, the preservation unit is China Center for Type Culture Collection, and the preservation address is Wuhan University, Wuhan, China. Experiments prove that the GUWM22 has a very strong inhibition effect on six pathogenic bacteria (phytophthora nicotianae, phytophthora capsici, botryosphaeria dothidea, alternaria alternata, phomopsis and colletotrichum capsici), the bacteriostasis rate reaches 78% or above, in addition, the GUWM22 also has a good prevention and treatment effect on anthracnose of picked peppers (line peppers), the prevention effect is 82.11%, and it can be seen that the GUWM22 can be used for preventing and treating anthracnose of the picked peppers (line peppers). The Trichoderma aureum GUWM22 is a new biocontrol Trichoderma strain with good potential. The invention provides a new strain resource and an environment-friendly and efficient biocontrol approach for effective prevention and treatment of pepper anthracnose.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and particularly to a Trichoderma wumengense GUWM22 and its application. Background Art

[0002] The occurrence of plant diseases causes a large amount of economic losses every year. At present, the main control method for plant diseases still relies on chemical control. However, the continuous and massive use of chemical pesticides has caused serious "3R" problems, namely, the enhanced resistance of pathogenic bacteria, pesticide residues in the soil or environment, and the resurgence of pathogenic microorganisms. This not only threatens human health but also causes serious harm to the environment and non-target organisms.

[0003] Biological control is one of the important technologies for the green prevention and control of crops. Biological control screens and utilizes beneficial microorganisms and prepares biological agents to prevent and control the occurrence of plant diseases and pests, thereby achieving the purpose of disease control. It is a new idea and method for the green prevention and control of diseases and pests. Microbial products are safe, sustainable, broad-spectrum, and green. The mechanisms by which microbial agents play their roles include antibiotic action, competitive action, hyperparasitism, and induction of systemic resistance in plants. Microbial agents can also promote plant growth and increase crop yields. The use of microbial fertilizers can reduce the application amount of chemical fertilizers and pesticides by 30% - 60%, increase crop yields by 5% - 40% depending on the crops, and increase the resistance of plants to diseases and pests, fundamentally reducing the use of chemical pesticides.

[0004] At present, various microbial agents have been reported and applied in production at home and abroad, including Bacillus subtilis, Trichoderma harzianum, Purpureocillium lilacinum, Bacillus megaterium, etc. The global market for biopesticides is also on the rise, and microbial agents in China also have a huge market. In order to carry out the research and development of multifunctional microbial agents, screening and obtaining beneficial microorganisms from different environments provide important microbial sources for product research and development. Wumeng Prairie is one of the highest and largest karst plateau grasslands in the southwestern region, with a unique ecological environment. Biocontrol bacteria in a unique environment must possess special adaptation mechanisms to adapt to extreme environments. Compared with biocontrol bacteria isolated from other non-stress environments such as farmland systems, they may have stronger adaptability. The unique ecological environment in the karst plateau region will provide a platform for the research, development, and application of biocontrol bacteria resources adapted to the plateau environment. Summary of the Invention

[0005] The purpose of the present invention is to provide a Trichoderma wumengense GUWM22 and its application to solve the problems existing in the above-mentioned prior art. The inhibition rate of Trichoderma wumengense GUWM2 against Colletotrichum capsici can reach up to 89.52%. The control effect on postharvest anthracnose of chili (linear chili) is 82.11%, providing a new strain resource and an environmentally friendly and efficient biocontrol approach for the effective control of chili anthracnose.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a strain of Trichoderma wumeng GUWM22, and the preservation number of the Trichoderma wumeng GUWM22 is CCTCC NO: M20242639, the preservation date is November 26, 2024, the preservation unit is the China Center for Type Culture Collection, and the preservation address is Wuhan University, Wuhan, China.

[0008] The present invention also provides the use of the Trichoderma wumeng GUWM22 or its spores in inhibiting pathogenic bacteria.

[0009] The present invention also provides the use of the Trichoderma wumeng GUWM22 or its spores in preparing a microbial agent for inhibiting pathogenic bacteria.

[0010] Optionally, the pathogenic bacteria include Phytophthora nicotianae, Phytophthora capsici, Botryosphaeria dothidea, Alternaria alternata, Phomopsis sp, and Colletotrichum truncatum.

[0011] The present invention also provides the use of the Trichoderma wumeng GUWM22 or its spores in preventing and / or treating Colletotrichum capsici of chili peppers.

[0012] The present invention also provides the use of the Trichoderma wumeng GUWM22 or its spores in preparing a microbial agent for preventing and / or treating Colletotrichum capsici of chili peppers.

[0013] The present invention also provides a microbial agent for preventing and / or treating Colletotrichum capsici of chili peppers, comprising the Trichoderma wumeng GUWM22 or its spores.

[0014] The present invention also provides a method for preventing and treating Colletotrichum capsici of chili peppers, comprising the step of inoculating chili pepper fruits with a spore suspension of the Trichoderma wumeng GUWM22.

[0015] Optionally, the pathogenic bacteria of the Colletotrichum capsici of chili peppers include Colletotrichum truncatum.

[0016] The present invention discloses the following technical effects:

[0017] A new Trichoderma strain was isolated from Wumeng Prairie in Guizhou Province. Based on morphological and multi-gene phylogenetic identification, this strain is a new species of the genus Trichoderma belonging to the Harzianum clade, named Trichoderma wumeng GUWM22. This strain was deposited in the China Center for Type Culture Collection on November 26, 2024, with the deposit number CCTCC NO: 20242639. Plate confrontation experiments were carried out using GUWM22 and 6 highly pathogenic plant pathogens (Phytophthora nicotianae, Phytophthora capsici, Botryosphaeria dothidea, Alternaria alternata, Phomopsis sp, and Colletotrichum truncatum). It was found that this strain has a strong inhibitory effect on the 6 pathogens, and the inhibition rate reached over 78% for all of them. Among them, the inhibition rate against Colletotrichum capsici was the highest, reaching 89.52%. In addition, GUWM22 also has a good control effect on postharvest anthracnose of chili peppers (linear peppers), with a control efficacy of 82.11%. It can be seen that Trichoderma wumeng GUWM22 is a new biocontrol Trichoderma species with good potential. This invention provides new strain resources and an environmentally friendly and efficient biocontrol approach for the effective control of chili anthracnose. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0019] Figure 1 is the phylogenetic tree of strain GUWM22;

[0020] Figure 2 are the morphological characteristics of strain GUWM22; A - B: Front and back views of the colony cultured on PDA medium at 25°C for 7 days; C: Conidial pustules on PDA; D: Chlamydospores; E: Conidia; F - H: Conidiophores and phialides;

[0021] Figure 3 are the colony morphologies of the confrontation culture of 6 pathogens and strain GUWM22;

[0022] Figure 4 is the inhibition rate of the confrontation culture of 6 pathogens and strain GUWM22;

[0023] Figure 5 Symptom phenotypes of pepper fruits inoculated with C. truncatum on the 7th day; A and C: control group; B and D: treatment group;

[0024] Figure 6 Lesion diameter of pepper fruits inoculated with C. truncatum on the 7th day. Detailed implementation manners

[0025] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0026] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0027] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0028] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the specification of the present invention, which are obvious to those skilled in the art. Other implementation manners obtained from the specification of the present invention are obvious to those skilled in the art. The specification and examples of the present invention are only exemplary.

[0029] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0030] Example 1 Isolation, screening and identification of Trichoderma

[0031] 1. Isolation and screening

[0032] 1.1 Test samples

[0033] In August 2023, root soil samples of Quercus semicarpifolia and Rhododendron were collected from Wumeng Prairie (104°37′E, 26°11′N), Liupanshui City, Guizhou Province.

[0034] 1.2 Main reagents

[0035] Potato dextrose agar (PDA): 200 g (peeled) of potatoes, 20 g of glucose, 15 - 20 g of agar powder, 1000 mL of distilled water.

[0036] 1.3 Isolation, screening, purification and preservation of Trichoderma

[0037] Using the dilution plate method, 1 g of each soil sample was placed into a test tube containing 9 mL of sterile water, and serially diluted to concentrations of 10 -1 、10 -2 、10 -3 . Then, 100 μL of the diluted solution was taken for PDA plate coating, with each concentration repeated 3 times. The plates were incubated in the dark at 25 °C in an incubator. After the colonies grew, mycelial blocks were picked from the colony edges and transferred to new PDA media for purification. Colonies with a morphology similar to Trichoderma were selected for preservation. The purified strains were numbered and marked, and the fungal cakes were stored in cryotubes containing glycerol at a final concentration of 15% at -80 °C. Alternatively, the strains could be cultured on PDA slants and stored at room temperature.

[0038] Result: One strain with a colony morphology consistent with the genus Trichoderma spp. was obtained.

[0039] 2. Construction of the molecular phylogenetic tree of Trichoderma

[0040] 2.1 DNA extraction of Trichoderma

[0041] The strains were cultured on PDA media for 7 days (at 25 °C), and then DNA was extracted using the Ezup column fungal DNA extraction kit (Sangon Biotech, China) according to the instructions.

[0042] 2.2 PCR amplification

[0043] The ITS universal primer pairs (ITS4 and ITS5), RPB2 primer pairs (fRPB2 - 5f and fRPB2 - 7cr), and TEF1 primer pairs (EF1 - 728F and TEF1LLErev) synthesized by Beijing Tsingke Biotechnology (Chongqing) Co., Ltd. were used for PCR amplification of the strain gene sequences. The specific primer information is shown in Table 1.

[0044] Table 1 Primer information

[0045]

[0046] Using the extracted DNA as a template, PCR amplification was carried out. The PCR reaction system was 25 μL: 12.5 μL Taq PCR Master Mix, 9.5 μL ddH2O, 1 μL forward and reverse primers, and 1 μL DNA template. An agarose gel with a concentration of 1% was prepared. Subsequently, 2 μL of the PCR product was placed in the wells of the 1% agarose gel for electrophoresis. After about 30 minutes, when the bands ran to the center of the gel block, the gel block was taken out and placed in a UV gel imager for observation. The brighter band samples in the gel were sent to Beijing Tsingke Biotechnology (Chongqing) Co., Ltd. for sequencing.

[0047] SEQ ID NO.1 (GUWM22 ITS sequence):

[0048] AAAAATGAACAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTTGTATACCCCCTCGCGGGTTGTTTTATAATCTGAGCCTTCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTGCCTCTTGGCGGTGGCCGTCTCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCACAGCCGTTAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCAT;

[0049] SEQ ID NO.2 (GUWM22 TEF1 sequence):

[0050]

[0051] SEQ ID NO. 3 (GUWM22 RPB2 sequence):

[0052]

[0053] 2.3 Phylogenetic analysis

[0054] The nucleotide sequences obtained by the company's sequencing were aligned using BLAST in the NCBI database, and the corresponding nucleotide sequences of Trichoderma strains with relatively high homology were downloaded from the GenBank database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) as reference sequences. Alignment was performed through the MAFFT v.7 online server (http: / / mafft.cbrc.jp / alignment / server / index), and manual adjustment was carried out using BioEdit v_7.2.6.1 (http: / / www.mbio.ncsu.edu / BioEdit / page2.html). The aligned gene sequences were spliced in the order of RPB2 and TEF1. The phylogenetic tree was constructed using IQ-TREE v.1.4.3, and analysis was performed using the maximum likelihood method (ML) and Bayesian inference (BI). The final phylogenetic tree was visualized through FigTree.

[0055] Phylogenetic analysis included 23 strains of Trichoderma (the gene accession numbers of the strains are shown in Table 2), as well as 2 outgroup species, T. pingquanense. Since the ML and BI phylogenetic trees showed similar topologies, only the ML tree is shown, see Figure 1 , revealing the classification of 1 new species in the Harzianum clade.

[0056] Table 2 Gene accession numbers of strains

[0057]

[0058] 3. Observation on the morphological characteristics of Trichoderma

[0059] The strain GUWM22 was cultured under dark conditions at 25°C for 3 days. Mycelial blocks were picked from the edge of the colony and transferred to the center of a new PDA plate, and then cultured under dark conditions at 25°C, repeating 3 times. The growth of the colony on the PDA medium (such as the density of mycelium, the color of the colony, and sporulation) was recorded every day. After culturing on the PDA medium for 2 days, a sterilized cover glass was inserted at a 45° angle at the edge of the colony. When the mycelium grew onto the cover glass, the morphological characteristics of conidiophores, phialides, conidia, and chlamydospores were observed using a Zeiss microscope (Carl Zeiss Microscopy GmbH, Jena, Germany).

[0060] The observation results are shown in Figure 2, on the PDA medium, the colony of strain GUWM22 has no pigment and obvious odor, with abundant aerial mycelium, showing a flocculent shape. After culturing for 3 days, dark green sporulation clusters are produced at the position of the fungal cake, mainly distributed near the fungal cake, and less at the edge. After 7 days, the whole petri dish is covered with dense conidia, and the color of the spores near the fungal cake is blackish green. On the PDA medium, the colony grows relatively fast and can cover a petri dish with a diameter of 90 mm at 25 °C in 2 - 3 days.

[0061] The conidiophores have an obvious main axis, and paired or unilateral branches are borne on the main axis, with a relatively sparse arrangement; the phialides produced by the branches are also less, and the phialides do not appear completely in pairs, showing a flask shape, solitary or in whorls of 2 - 3, with a size of (5.3 - 13.7) × (1.6 - 3.5) μm, the ratio of length to width is 2 - 6.1 μm, and the base width is 1.4 - 2.7 μm (n = 50); the conidia are green, oval, with a size of (2.7 - 4.2) × (2.3 - 3.9) μm, the ratio of length to width is 1 - 1.49 μm (n = 50); the chlamydospores are thick-walled, nearly spherical, terminal or intercalary, with a size of (5.0 - 9.2) × (4.8 - 8.7) μm, the ratio of length to width is 1 - 1.49 μm (n = 50).

[0062] Based on the results of the multi-gene phylogenetic analysis and morphological characteristics of the isolated strain, strain GUWM22 was identified as a new species of the genus Trichoderma in the Harzianum clade, and its taxonomic name is Trichoderma wumeng. It was deposited in the China Center for Type Culture Collection on November 26, 2024. The deposit address is Wuhan University, Wuhan, China, and the deposit number is CCTCC NO: M20242639.

[0063] Example 2 Determination of the antibacterial ability against 6 kinds of pathogenic bacteria

[0064] The antagonistic effect of strain GUWM22 against pathogenic bacteria (see Table 2, provided by the Plant Pathology Laboratory of the College of Agriculture, Guizhou University) was determined by the plate confrontation method. The activated strain GUWM22 and a pathogenic bacteria fungal cake (with a diameter of 5 mm) were inoculated on both sides of the PDA plate, with a distance of 4 cm between them. A PDA plate inoculated only with the pathogenic bacteria was used as a control. The cultures were incubated at a constant temperature of 25 °C, and the colony diameter at 7 days was recorded. The antibacterial rate of strain GUWM22 against the pathogenic bacteria was calculated to evaluate the antibacterial effect of strain GUWM22. The formula for calculating the antibacterial rate is: Antibacterial rate = [(C - T) / C] × 100%. Where C and T represent the average growth radius of the tested pathogenic bacteria in the control group and the treatment group, respectively.

[0065] Table 2 Pathogenic bacteria

[0066]

[0067]

[0068] It was found through confrontation plate tests that after 7 days of cultivation ( Figure 3 ), strain GUWM22 had strong antibacterial effects against 6 kinds of pathogenic bacteria, and the antibacterial rates were all above 78% ( Figure 4 ), with the antibacterial rate against P. nicotianae being 78.89%; against P. capsici being 79.95%; against A. alternata being 85.31%; against B. dothidea being 85.99%; against Phomopsis sp. being 86.48%; and against C. truncatum being 89.52%. After 7 days of co-cultivation, obvious pigment changes were found at the mycelial junction of the 6 kinds of pathogenic bacteria and strain GUWM22. Among them, obvious sporulation phenomenon occurred at the junction of C. truncatum and T. wumeng.

[0069] Example 3 Protective effect of spore suspension on pepper fruits

[0070] Through antagonistic experiments, the C. truncatum with the best antibacterial effect was selected as the research object to evaluate the protective effect of strain GUWM22 on postharvest anthracnose of pepper (thread pepper). Sterile water was used as the control group, and the spore suspension of strain GUWM22 was used as the treatment group. Using the acupuncture inoculation method, the Trichoderma spore suspension (1×10 8 spores / mL) was sprayed on the stabbed parts, with sterile water as the control, and then the peppers were placed in an incubator at a constant temperature of 25°C. On the 2nd day after inoculation, the C. truncatum fungal blocks were inoculated at the stabbed parts. On the 7th day after inoculation, the disease incidence of the fruits was observed and the lesion diameter was measured by the cross method. There were 5 thread peppers for each treatment in the experiment, and the experiment was repeated 3 times. Disease prevention effect (%) = [(lesion diameter of the control group - lesion diameter of the treatment group) / lesion diameter of the control group] × 100.

[0071] In this experiment, the disease prevention effect of the spore suspension of strain GUWM22 was measured to evaluate the disease prevention potential of strain GUWM22 on postharvest peppers. The results are as Figure 5 shown. 7 days after inoculating the C. truncatum fungal cake, all the peppers in the control group developed diseases. C. truncatum produced yellowish-brown lesions at the fruit wounds, and there were a large number of white hyphae on the surface of the lesions. The lesion diameter could be clearly observed ( Figure 5 A in Figure 5 C in ); compared with the control group, the peppers in the treatment group had basically no obvious lesion symptoms at the fruit wounds, and there were basically no hyphae at the lesion sites ( Figure 5 B in Figure 5 D in ).

[0072] Statistical analysis of lesion diameter. On the 7th day after inoculation with C. truncatum, the average lesion diameters produced on chili peppers by the control group and the treatment group with three treatments were 16.38 mm and 2.93 mm respectively; there was a significant difference between the control group and the treatment group (P<0.01)( Figure 6 ).

[0073] The test results showed that the spore suspension of Trichoderma wumengense GUWM22 obtained in the present invention had a good disease prevention effect on chili fruits, and the prevention effect was 82.11%.

[0074] The above-described embodiments are only descriptions of the preferred embodiments of the present invention, and do not limit the scope of the present invention. Without departing from the design spirit of the present invention, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention should fall within the protection scope determined by the claims of the present invention.

Claims

1. A strain of Trichoderma wumeng GUWM22, characterized in that: The preservation number of the Wumeng Trichoderma GUWM22 is CCTCC NO: M20242639, the preservation date is November 26, 2024, the preservation unit is the China Center for Type Culture Collection, and the preservation address is Wuhan University, Wuhan, China.

2. Use of the Wumeng Trichoderma GUWM22 or its spores as claimed in claim 1 in inhibiting pathogenic bacteria.

3. Use of the Wumeng Trichoderma GUWM22 or its spores as claimed in claim 1 in the preparation of a bacterial agent for inhibiting pathogens.

4. The use according to claim 2 or 3, characterized in that The pathogens include Phytophthora nicotianae, Phytophthora capsici, Botryosphaeria dothidea, Alternaria alternata, Phomopsis sp and Colletotrichum truncatum.

5. Use of the Wumeng Trichoderma GUWM22 or its spores as claimed in claim 1 in preventing and / or treating pepper anthracnose.

6. Use of the Wumeng Trichoderma GUWM22 or its spores as claimed in claim 1 in the preparation of a bacterial agent for preventing and / or treating pepper anthracnose.

7. A bacterial agent for preventing and / or treating pepper anthracnose, characterized in that: It includes the Wumeng Trichoderma GUWM22 or its spores as described in claim 1.

8. A method for preventing and controlling pepper anthracnose, characterized in that: The method comprises the step of inoculating pepper fruits with the spore suspension of Trichoderma wumengense GUWM22 according to claim 1.

9. The method according to claim 8, characterized in that The pathogenic bacteria of pepper anthracnose include Colletotrichum truncatum.

Citation Information

Patent Citations

  • Trichoderma harzianum strain and application in prevention and control of phytophthora capsici Leonian thereof

    CN102719364A

  • Trichoderma asperellum strain and application thereof

    CN102911878A

  • Trichoderma virens for preventing and controlling phytophthora capsici and application thereof, and capsicum frutescens l. cultivation method

    CN110408547A

  • Trichoderma asperellum TZ312, application thereof, volatile metabolite thereof and application of volatile metabolite

    CN111893046A

  • Multifunctional trichoderma asperellum and application thereof

    CN113025501A

Cited By

  • Trichoderma Guizhou GZMT12 and application thereof

    CN121006284A

  • Application of trichoderma auritum GUWM22 in promoting pepper growth and preventing and treating pepper root rot

    CN122181548A

  • Application of Trichoderma monticola GUWM22 in promoting growth and preventing root rot of pepper

    CN122181548B