CsERECTA gene-based tea tree leaf shape regulation and control method and tea tree light utilization rate improvement method

By regulating the shape of tea leaves using the CsERECTA gene silencing vector, the problem of improving the light utilization rate of tea trees was solved, thus improving the photosynthetic efficiency of tea trees.

CN120843533APending Publication Date: 2025-10-28GUIZHOU UNIV
View PDF 0 Cites 2 Cited by

Patent Information

Application Number
CN202510879123.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-27
Publication Date
2025-10-28

AI Technical Summary

Technical Problem

Current research on genes regulating tea leaf shape is insufficient, which limits the improvement of light utilization efficiency in tea plants.

Method used

By using gene silencing vectors for the CsERECTA gene, especially the pTRV2-CsERECTA vector, the expression of the CsERECTA gene in tea plants can be suppressed, thereby regulating the aspect ratio of tea leaves and improving light utilization.

Benefits of technology

Increasing the length-to-width ratio of tea leaves improves the light utilization rate of tea plants and enhances the synthesis of flavor compounds in tea leaves.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120843533A_ABST
    Figure CN120843533A_ABST
Patent Text Reader

Abstract

The invention provides a CsERECTA gene-based tea tree leaf shape regulation and control method and a tea tree light utilization rate improving method, which are characterized in that a sequence of a tea tree gene is cloned to obtain a complete sequence; then, the CsERECTA is subjected to bioinformatics analysis, expression of a GUS reporter gene is started by constructing a plant expression vector and connecting a target fragment, and a recombinant plant vector is used for genetic transformation of tobacco, so that the function of the CsERECTA is verified; the character of the CsERECTA transgenic line is analyzed, the leaf shape is determined, the method capable of improving the leaf shape of the tea tree is obtained, and a foundation is laid for cultivating a new variety and improving the light utilization rate of the tea tree by using the CsERECTA gene.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering, specifically relating to a method for regulating tea tree leaf shape and a method for improving the light utilization rate of tea trees based on the CsERECTA gene. Background Technology

[0002] Tea is a traditional Chinese beverage with high economic and cultural value. As a typical leaf plant, the morphological characteristics of the tea tree are a key focus in selecting breeding materials. Tea leaves are not only the edible part of the tea plant but also the most important photosynthetic organ. Their morphology influences photosynthetic efficiency by affecting light capture, water balance, and temperature regulation. Leaf shape, as one of the phenotypic aspects of tea, benefits from a higher length-to-width ratio. A more favorable spatial distribution of leaves promotes light absorption, reduces competition between upper and lower parts of the plant, as well as between plants and rows, and significantly improves light utilization efficiency.

[0003] While regulating leaf morphology, especially the length-to-width ratio of tea leaves, can increase the light utilization rate of tea plants, thereby regulating the synthesis of higher levels of tea flavor compounds under suitable light absorption conditions, the phenotypic traits of tea leaves are controlled by multiple factors. Besides environmental influences, they are primarily controlled by genes. Due to the limited identification of genes regulating leaf shape, further research is needed to strengthen the correspondence between genes and tea leaf shape in order to effectively regulate tea leaf shape.

[0004] Therefore, it is necessary to provide a method for regulating tea tree leaf shape and improving tea tree light utilization based on the CsERECTA gene, in order to solve or at least alleviate the technical problem of how to improve tea tree light utilization by regulating tea tree leaf shape through gene. Summary of the Invention

[0005] The main objective of this invention is to provide a method for regulating tea tree leaf shape and improving tea tree light utilization based on the CsERECTA gene, aiming to solve the aforementioned technical problem of how to improve tea tree light utilization by regulating tea tree leaf shape through gene regulation.

[0006] To achieve the above objectives, the present invention provides a CsERECTA gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0007] The present invention also provides a recombinant expression vector for expressing the CsERECTA gene as described above.

[0008] The present invention also provides an application of the recombinant expression vector as described above in reducing the aspect ratio of leaves.

[0009] The present invention also provides a gene silencing vector for silencing the CsERECTA gene in tea plants.

[0010] Furthermore, the gene silencing vector comprises pTRV2-CsERECTA;

[0011] Furthermore, the construction process of the gene silencing vector includes inserting the nucleotide sequence shown in SEQ ID NO.4 between the EcoRI and BamHI restriction sites of the pTRV2 vector.

[0012] The present invention also provides an application of gene silencing vectors as described above in improving the leaf shape of tea leaves.

[0013] The present invention also provides a method for regulating the leaf shape of tea leaves based on the CsERECTA gene, wherein the leaf shape of tea leaves includes the length-to-width ratio of the tea leaves;

[0014] The tea tree leaf shape regulation method includes: introducing a gene silencing vector as described above into Agrobacterium, and then culturing the tea tree after vacuum infection with the Agrobacterium.

[0015] This invention also provides an application of the tea tree leaf shape regulation method as described above in tea tree breeding.

[0016] The present invention also provides a method for improving the light utilization rate of tea trees based on the CsERECTA gene, comprising: controlling the leaf shape of tea trees by inhibiting the expression of the CsERECTA gene in tea trees, thereby improving the light utilization rate of tea trees.

[0017] Compared with the prior art, the present invention has at least the following advantages:

[0018] This invention, based on the CsERECTA gene, silences the CsERECTA gene to improve tea tree leaf shape, increasing the length-to-width ratio of the leaves and thus enhancing light utilization efficiency. In the specific research process, the sequence of the CsERECTA (probable LRR receptor-like serine / threonine-protein kinase At3g47570) gene in tea was cloned, obtaining its complete sequence. Subsequently, bioinformatics analysis was performed, and a plant expression vector was constructed to ligate the target fragment and initiate GUS reporter gene expression. This vector was then used to genetically transform tobacco, thereby verifying the function of CsERECTA. The traits of the CsERECTA transgenic lines were analyzed, leaf shape was measured, and a method to improve leaf shape was obtained, laying the foundation for using the CsERECTA gene to cultivate new varieties and improve light utilization efficiency in tea trees. Attached Figure Description

[0019] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on the structures shown in these drawings without creative effort.

[0020] Figure 1 The images shown are of tobacco callus, regenerated buds, and regenerated plants transformed with the CsERECTA gene in Example 4 of this invention; in the images, WT represents wild-type tobacco plants and CsERECTA represents transgenic tobacco plants.

[0021] Figure 2 The images shown are of wild-type plants and CsERECTA-transgenic tobacco plants transplanted 5 days after transplanting, as well as identification images obtained by GUS staining, in Example 5 of this invention. From top to bottom, the first and second horizontal rows are images of the plants, and the third horizontal row is an identification image obtained by GUS staining. From left to right, columns (a) and (b) are wild-type plants, and columns (c) to (h) are CsERECTA-transgenic tobacco plants, corresponding to CsERECTA-1 to CsERECTA-6 respectively.

[0022] Figure 3 In Example 6 of this invention, wild-type plants and CsERECTA gene-transgenic tobacco plants and leaves were transplanted 20 days prior; A is a front view, B is a top view, C is the third leaf, columns (a) and (b) are wild-type plants, and columns (c) to (e) are CsERECTA gene-transgenic tobacco plants, corresponding to transgenic lines 1, 3, and 4 respectively.

[0023] Figure 4 This is a graph showing the length-to-width ratio of the third leaf of a wild-type plant and a CsERECTA-transgenic tobacco plant in Example 6 of the present invention; WT-1 to WT-2 are wild-type lines 1 and 2, and CsERECTA-1, CsERECTA-3, and CsERECTA-4 correspond to transgenic lines 1, 3, and 4, respectively.

[0024] Figure 5 This is a graph showing the length-to-width / leaf shape index of the third leaf of wild-type plants and CsERECTA transgenic tobacco plants in Example 6 of the present invention; WT-1 to WT-2 are wild-type lines 1 and 2, and CsERECTA-1, CsERECTA-3, and CsERECTA-4 correspond to transgenic lines 1, 3, and 4, respectively.

[0025] Figure 6This is a graph showing the length-to-width ratio of the third leaf of a wild-type plant and a CsERECTA-transgenic tobacco plant in Example 6 of the present invention; WT-1 to WT-2 are wild-type lines 1 and 2, and CsERECTA-1, CsERECTA-3, and CsERECTA-4 correspond to transgenic lines 1, 3, and 4, respectively.

[0026] Figure 7 This is a graph showing the relative expression levels of the CsERECTA gene in the third leaf of wild-type plants and CsERECTA gene-transgenic tobacco plants in Example 7 of the present invention; WT-1 to WT-2 are wild-type lines 1 and 2, and CsERECTA-1, CsERECTA-3, and CsERECTA-4 correspond to transgenic lines 1, 3, and 4, respectively.

[0027] Figure 8 This is an analysis of tea tree branches from plants that silence the CsERECTA gene using VIGS in Example 10 of this invention; WT represents wild-type tea tree branches, pTRV2 represents tea tree branches from the empty vector control, and pTRV2-CsERECTA-1 to pTRV2-CsERECTA-6 represent tea tree branches from plants that silence the CsCDCAa gene using VIGS; in the first horizontal row from top to bottom, except for WT and pTRV2, the branches are arranged from left to right in the order of pTRV2-CsERECTA-1 to pTRV2-CsERECTA-6; in the figure, WT represents wild-type, pTRV2 represents the empty vector control, and pTRV2-CsERECTA-1 to pTRV2-CsERECTA-6 represent silenced lines 1-6;

[0028] Figure 9 This is an analysis of the second leaf of the CsERECTA tea tree branch silenced by VIGS in Example 10 of the present invention; WT is the second leaf of the wild-type tea tree branch, pTRV2 is the second leaf of the tea tree branch of the empty control, and pTRV2-CsERECTA-1 to pTRV2-CsERECTA-8 are the second leaves of the tea tree branches of silenced strains 1-8.

[0029] Figure 10 This is a data analysis diagram of the length-to-width ratio of the second leaf of the branch of the VIGS silent CsERECTA tea tree in Example 10 of the present invention. WT is the second leaf of the wild-type tea tree branch, pTRV2 is the second leaf of the tea tree branch of the empty control, and pTRV2-CsERECTA-1 to pTRV2-CsERECTA-8 are the second leaves of the tea tree branches of silent strains 1-8.

[0030] Figure 11This is an analysis chart of the length-to-width ratio (leaf shape index) of the second leaf of the branch of the VIGS silent CsERECTA tea tree in Example 10 of the present invention. WT is the second leaf of the wild-type tea tree branch, pTRV2 is the second leaf of the tea tree branch of the empty control, and pTRV2-CsERECTA-1 to pTRV2-CsERECTA-8 are the second leaves of the tea tree branches of silent strains 1-8.

[0031] Figure 12 This is a data analysis diagram of the length-to-width ratio of the second leaf of the branch of the VIGS silent CsERECTA tea tree in Example 10 of the present invention. WT is the second leaf of the wild-type tea tree branch, pTRV2 is the second leaf of the tea tree branch of the empty control, and pTRV2-CsERECTA-1 to pTRV2-CsERECTA-8 are the second leaves of the tea tree branches of silent strains 1-8.

[0032] Figure 13 This is a graph showing the relative expression level of the CsERECTA gene in the second leaf of the VIGS-silenced CsERECTA tea tree in Example 11 of the present invention. WT represents the second leaf of the wild-type tea tree branch, pTRV2 represents the second leaf of the tea tree branch in the empty vector control, and pTRV2-CsERECTA-1 to pTRV2-CsERECTA-8 represent the second leaves of the tea tree branches of silenced strains 1-8.

[0033] The realization of the objective, functional characteristics and advantages of the present invention will be further explained in conjunction with the embodiments and with reference to the accompanying drawings. Detailed Implementation

[0034] The technical solutions of the embodiments of the present invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only a part of the embodiments of the present invention, and not all of them. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0035] Furthermore, the technical solutions of the various embodiments of the present invention can be combined with each other, but only if they are based on the ability of those skilled in the art to implement them. When the combination of technical solutions is contradictory or cannot be implemented, it should be considered that such combination of technical solutions does not exist and is not within the scope of protection claimed by the present invention.

[0036] When numerical ranges are given in the embodiments, it should be understood that, unless otherwise stated in the present invention, both endpoints of each numerical range and any value between the two endpoints may be selected. Unless otherwise defined, all technical and scientific terms used in this invention, as well as the prior art known to those skilled in the art and the description of this invention, may be implemented using any prior art methods, devices, and materials similar to or equivalent to those described, used, or made of materials in the embodiments of this invention.

[0037] This invention provides a CsERECTA gene, the nucleotide sequence of which is shown in SEQ ID NO.1, the coding region nucleotide sequence of which is shown in SEQ ID NO.2, and the amino acid sequence of the protein encoded by which the CsERECTA gene is shown in SEQ ID NO.3. This gene was located using genome-wide association analysis based on data obtained from differences in leaf denticles among different ancient tea tree populations and combined with tea tree genomic data.

[0038] In this invention, the nucleotide sequence of SEQ ID NO.1 is as follows:

[0039] Genomic Sequence

[0040] >TEA023265Scaffold120:381617-386886

[0041]

[0042] In this invention, the nucleotide sequence of SEQ ID NO.2 is as follows:

[0043] CDS Sequence

[0044] >TEA023265Scaffold120:381617-386886

[0045]

[0046] In this invention, the amino acid sequence of SEQ ID NO.3 is as follows:

[0047] Protein Sequence

[0048] >TEA023265Scaffold120:381617-386886

[0049]

[0050] The present invention also provides a recombinant expression vector for expressing the CsERECTA gene as described above; the recombinant expression vector includes pSH737-35S-CsERECTA-GUS; the construction process of the recombinant plant expression vector includes inserting the nucleotide sequence shown in SEQ ID NO.2 between the SpeI and SmaI restriction sites of the pSH737 vector.

[0051] The present invention also provides an application of the recombinant expression vector as described above in reducing the aspect ratio of leaves.

[0052] This invention also provides a gene silencing vector for silencing the CsERECTA gene in tea plants. Specifically, the gene silencing vector comprises pTRV2-CsERECTA; the construction process of the gene silencing vector includes inserting the UTR region of CsERECTA, i.e., the nucleotide sequence shown in SEQ ID NO.4, between the EcoRI and BamHI restriction enzyme sites of the pTRV2 vector. Specifically, this invention uses the nucleotide sequence shown in SEQ ID NO.4 to construct the CsERECTA gene silencing vector.

[0053] In this invention, the nucleotide sequence of SEQ ID NO.4 is as follows:

[0054] TGCCGTGATGCTGACTCTGCCACTACTTTATTTTCATTGATTTTCTTCACTTTCTTGTTTTGTTTTGTTCTGTTTTCTTATTCATAGCAGTCTTTGAGGAATGATCAGCCACATTCTGTTCTCCGAAAC TTCCTCTTGCCCCTTTTCGGTAGTATGAATCTCATCATAAATACTAACACTAACTACTCTATTGTGAATTTAATTTATAGTTGGTGCATGGTTGTTGTGGCAATCTTTGAAGACCTTTCTCAACTAAA.

[0055] This invention also provides an application of the gene silencing vector as described above in improving the leaf shape of tea plants, wherein the leaf shape includes the aspect ratio of the tea leaves. In this application, the gene silencing vector is introduced into Agrobacterium, and the Agrobacterium is used to vacuum-infect tea plant tissue, followed by culturing the tea plant tissue to obtain tea plants with improved leaf shape.

[0056] The present invention also provides a method for regulating tea leaf shape based on the CsERECTA gene, comprising: inhibiting the expression of the CsERECTA gene in tea plants, specifically by inhibiting the expression of the CsERECTA gene in tea plants using any of the gene silencing vectors described above, thereby improving the leaf shape of tea plants; wherein the leaf shape of tea plants includes the aspect ratio of the tea leaves.

[0057] This invention also provides a method for regulating tea leaf shape based on the CsERECTA gene, wherein the tea leaf shape includes the aspect ratio of the tea leaves; the method for regulating tea leaf shape includes: introducing a gene silencing vector as described above into Agrobacterium, and then culturing the tea plant using the Agrobacterium in a vacuum infection process; specifically, the Agrobacterium can be used to vacuum-infect tea plant tissue, followed by tissue culture. In this invention, the tea variety is Wuniuzao.

[0058] The present invention also provides an application of the tea tree leaf shape regulation method as described above in tea tree breeding; specifically, by introducing the gene silencing vector as described above into Agrobacterium, and then culturing the tea tree after vacuum infection with the Agrobacterium, a new tea tree variety with a higher length-to-width ratio can be obtained.

[0059] In this invention, the aspect ratio includes one or more of the following: length-to-upper-width, length-to-middle-width, and length-to-lower-width; specifically, it can be the length-to-middle-width. In this invention, the length-to-upper-width is: the length from the base of the leaf to the tip / the width of the leaf at 1 / 4 of the distance from the tip; the length-to-middle-width is: the length from the base of the leaf to the tip / the width of the leaf at 1 / 2 of the distance from the tip; the length-to-lower-width is: the length from the base of the leaf to the tip / the width of the leaf at 1 / 4 of the distance from the base.

[0060] This invention also provides a method for improving the light utilization rate of tea trees based on the CsERECTA gene, comprising: inhibiting the expression of the CsERECTA gene in tea trees, specifically by inhibiting the expression of the CsERECTA gene in tea trees using any of the gene silencing vectors described above, thereby controlling the leaf shape of tea trees and thus improving the light utilization rate of tea trees; specifically, the gene silencing vectors described above can be used to improve the leaf shape of tea trees, thereby increasing the aspect ratio of the tea leaves so that the tea trees can receive more light.

[0061] The main reagents used in the experiments of this invention include:

[0062] (1) YEP solid medium: 10 g / L peptone + 10 g / L yeast extract + 5 g / L sodium chloride + 7.5 g / L agar powder, pH = 7.2;

[0063] (2) YEP liquid medium: 10 g / L yeast extract + 10 g / L peptone + 5 g / L sodium chloride, pH = 7.2;

[0064] (3) Tea tree branch resuspension: 4.474 g / L MS + 30 g / L sucrose + 2 mg / L 6-BA + 0.1 mg / L NAA + 20 mg / L LAS, pH = 5.8-6.0;

[0065] (4) Tea tree branch culture medium: 0.2 mg / L 6-BA + 0.3 mg / L GA3 + 25 mg / L chloramphenicol, pH = 5.8-6.0;

[0066] (5) Tobacco resuspension: 4.74 g / L MS + 30 g / L sucrose + 20 mg / L AS, pH = 5.8-6.0;

[0067] (6) Tobacco co-culture medium: 4.74 g / L MS + 30 g / L sucrose + 7 g / L agar powder + 1.0 mg / L 6-BA + 0.1 mg / L NAA, pH = 5.8-6.0;

[0068] (7) Tobacco screening medium: 4.74 g / L MS + 30 g / L sucrose + 7 g / L agar powder + 1.0 mg / L 6-BA + 0.1 mg / L NAA + 100 mg / L Tim + 50 mg / L Kana, pH = 5.8-6.0;

[0069] (8) Tobacco rooting medium: 2.39 g / L MS + 30 g / L sucrose + 6.5 g / L agar powder, pH = 5.8-6.0.

[0070] The following are specific examples of the present invention:

[0071] Example 1

[0072] Target gene sequence obtained:

[0073] Data obtained from the differences in leaf tooth characteristics of ancient tea trees were used to analyze the CsERECTA (TEA023265.1) gene sequence obtained by genome-wide association analysis (GWAS) and combined with the tea tree genome database, as shown in SEQ ID NO.1.

[0074] Example 2

[0075] Bioinformatics analysis of the CsERECTA gene:

[0076] Online software was used to predict the conserved domains of CsERECTA. The results showed that CsERECTA protein belongs to the PLN00113 superfamily and is a leucine-rich repeat-like receptor protein kinase that may be involved in protein-protein interactions.

[0077] Example 3

[0078] pSH737-35S-CsERECTA-GUS recombinant plasmid (constructed by the company) was introduced into Agrobacterium:

[0079] 1. Take GV3101 Agrobacterium competent cells (preserved by our research group, volume 100μL) stored at -80℃ and thaw them on ice or at room temperature;

[0080] 2. Under aseptic conditions, add 1 μg of pSH737-35S-CsERECTA-GU S plasmid DNA (volume not exceeding 1 / 10 of the competent cell volume) to the freshly thawed competent cell suspension, mix gently, and incubate in an ice-water bath for 5 min.

[0081] 3. Place the centrifuge tubes in liquid nitrogen for 5 minutes to freeze quickly;

[0082] 4. Quickly place the centrifuge tubes in a 28°C water bath for 5 minutes, without shaking the cultured bacterial solution.

[0083] 5. Place the centrifuge tubes back into the ice-water bath and keep them there for another 5 minutes;

[0084] 6. Under aseptic conditions, add 700 μL of antibiotic-free YEB or LB liquid medium and incubate at 28°C with shaking for 2-3 hours;

[0085] 7. Centrifuge at 6000 rpm for 1 min to collect the bacteria. Retain approximately 100 μL of supernatant and gently resuspend the cells by pipetting. Add this to a YEP solid medium plate containing the appropriate antibiotic. Spread the cells evenly using a sterile bacterial spreader. After the liquid in the plate has been completely absorbed, invert the plate and incubate at 28°C for 2-3 days (72-90 h at 28°C if the plate contains 50 μg / mL Rif; 48-60 h at 28°C if the plate contains 50 μg / mL Kana and 20 μg / mL Rif), until single colonies appear.

[0086] 8. Strain preservation: Pick a single colony and incubate overnight in 10 mL of YEP liquid medium containing 50 mg / L Rif and 50 mg / L Kana with shaking until OD... 600 When the concentration reaches 1.0, add 500 μL of glycerol and 500 μL of bacterial solution to a 1.5 mL sterile centrifuge tube, mix gently, seal with sealing film and label, freeze quickly in liquid nitrogen, and then store in an ultra-low temperature freezer at -80°C.

[0087] Example 4

[0088] Agrobacterium-mediated CsERECTA genetic transformation of tobacco:

[0089] 1. Agrobacterium activation and culture:

[0090] Agrobacterium strain GV3101 containing the pSH737-CsERECTA plant expression vector, which was transformed and preserved in Example 3, was taken from a -80℃ freezer and inoculated onto YEP solid medium (50 mg / L Rif, 50 mg / L Kana) and incubated upside down in a 28℃ incubator for 2–3 days. A single colony was picked and inoculated into 10 mL of YEP liquid medium (50 mg / L Rif, 50 mg / L Kana) and cultured at 28℃ with shaking at 200 rpm for 24 h. 1 mL of the above bacterial culture was then inoculated into 50 mL of YEP liquid medium (50 mg / L Rif, 50 mg / L Kana) for expansion culture and cultured at 28℃ with shaking at 200 rpm. The OD of the bacterial culture was measured based on the turbidity. 600 Value, pending OD 600 At 0.3-0.6, the bacterial culture was placed into a 50mL centrifuge tube, centrifuged at 4℃ and 5000rpm for 10min, the supernatant was discarded, and the culture was resuspended in an equal volume of resuspension.

[0091] 2. Agrobacterium-mediated genetic transformation in tobacco:

[0092] Use leaves from sterile tobacco seedlings as explants (if not sterile seedlings, disinfect the explants first: disinfect with 75% alcohol for 1 minute, rinse 2-3 times with sterile water, then disinfect with 0.1% mercuric chloride for 8 minutes, and rinse 4-5 times with sterile water). Cut the leaves of sterile tobacco seedlings into 1cm×1cm cubes with a sterile blade, immerse them in the resuspension for 6-8 minutes, and continuously shake to ensure full contact between the bacterial solution and the leaves. Remove the leaves and use sterile absorbent paper to dry the bacterial solution on the leaf surface. Arrange the leaves tightly in the co-culture medium with the leaf surface facing down, label them, seal them with sealing film, and co-culture them in a 25℃ dark incubator for 2 days. Cut a 1cm×1cm cube from a tobacco leaf, leaving half to be infected with the resuspension (method as above) as a control, and keep the culture conditions unchanged.

[0093] 3. Selection and rooting of resistant buds:

[0094] Tobacco leaves that have undergone dark culture were transferred to a selection medium (50 mg / L Kana, 100 mg / L Tim) and cultured in a light-controlled tissue culture room at 25°C. The medium was changed every 14 days, and contaminated medium was removed promptly. When the resistant buds grew to about 1-2 cm, they were cut off and transferred to a rooting medium (50 mg / L Kana, 100 mg / L Tim). When the root system of the tobacco tissue culture seedlings was fully developed, hardening-off treatment was performed and the seedlings were transplanted.

[0095] 4. Hardening off and transplanting of tobacco seedlings:

[0096] When the tobacco plants grow to 6-8cm and the root system is relatively complete, remove the culture bottles from the light-lit tissue culture room and place them in a dark place outdoors. Remove the sealing film and harden the seedlings for about 7 days (during which time the leaves should not lose too much water). Then, wash the culture medium off the roots with water and transplant them into greenhouse soil for cultivation (observe whether there are any differences in morphology between wild-type plants and transgenic plants during the growth process).

[0097] In this embodiment, please refer to the actual images of tobacco callus, regenerated buds, and regenerated plants transformed with the WT and CsERECTA genes. Figure 1 As shown.

[0098] Example 5

[0099] Identification of T0 generation transgenic tobacco plants:

[0100] 1. GUS histochemical staining of transgenic plants:

[0101] After the transplanted tobacco plants have survived (5 days), cut small leaves from the tobacco plants and put them into centrifuge tubes. Add 200 μl of GUS staining solution to completely submerge the leaves. After labeling, place the centrifuge tubes in a 37°C incubator overnight. Discard the GUS staining solution and decolorize the leaves in ethanol solutions of different concentrations in a gradient until the leaves turn white. Observe and take pictures.

[0102] In this embodiment, images of wild-type plants and CsERECTA transgenic tobacco plants, as well as identification images using GUS staining, are shown below. Figure 2 As shown.

[0103] 2. DNA extraction from tobacco plants:

[0104] DNA was extracted from tobacco leaves 5 days after transplanting. The DNA from the plant samples was extracted using the CTAB method, and the specific steps are as follows:

[0105] (1) Material grinding: Take about 0.1g of leaves and grind them into fine powder in liquid nitrogen, then place them in a DNA extraction solution containing 1mL;

[0106] (2) Incubate in a 65℃ water bath for 45 minutes, mixing every 15 minutes. Cool to room temperature;

[0107] (3) Add 500 μL of chloroform:isoamyl alcohol = 24:1, mix vigorously for 15 s to emulsify, let stand for 10 min, and centrifuge at 13000 rpm for 10 min; take the supernatant into a new EP tube. Repeat this step once;

[0108] (4) Add an equal volume of pre-cooled isopropanol and mix gently.

[0109] (5) Place in -20℃ for 1 hour, then centrifuge at 13000 rpm for 10 minutes;

[0110] (6) Discard the supernatant and keep the white precipitate. Wash with 1 mL of 75% ethanol. Repeat this step once.

[0111] (7) Use a pipette to remove all the liquid at the bottom;

[0112] (8) Open the tube cap and place it in a fume hood to dry until there is no alcohol smell (DNA is not easy to dissolve if it is too dry);

[0113] (9) Dissolve in 50 μL of RNafress H2O;

[0114] (10) Detect DNA concentration using a nucleic acid concentration analyzer.

[0115] 3. PCR identification of tobacco genomic DNA:

[0116] The primer design is as follows:

[0117] CsERECTA-F: CTGGACTTATGGGACTCTCTCT;

[0118] CsERECTA-R:TGTGCTTGTCTCTCCTTCTTG.

[0119] The target gene was amplified using tobacco genomic DNA as a template. The reaction system consisted of 20 μL (2.0 μL template DNA, 7.0 μL ddH2O, 0.5 μL 5' primer, 0.5 μL 3' primer, and 10 μL Premix Ex Taq), with the reaction program set according to the primer annealing temperature. The PCR products were detected by agarose gel electrophoresis (concentration determined by the size of the amplified DNA fragment). The results showed that all six transplanted tobacco plants were positive transgenic plants.

[0120] Example 6

[0121] Measurement of leaf length and width of transgenic tobacco plants:

[0122] Leaves of T0 generation tobacco were picked and photographed with a camera. The leaf length and width were measured 20 days after transplanting using ImageJ, and the leaf shape was calculated.

[0123] See also Figure 3-6 As shown, the T0 generation tobacco lines 1, 3, and 4 show obvious changes in leaf shape; compared with the WT leaves, the leaves of the transgenic tobacco are generally wider, especially the upper half of the leaves.

[0124] Specifically, the length-to-width ratios of WT-1, WT-2, CsERECTA-1, CsERECTA-3, and CsERECTA-4 are 3.50, 3.39, 2.36, 2.16, and 2.41, respectively.

[0125] The length-to-width ratios of WT-1, WT-2, CsERECTA-1, CsERECTA-3, and CsERECTA-4 are 1.96, 1.99, 1.61, 1.61, and 1.62, respectively.

[0126] The length-to-width ratios of WT-1, WT-2, CsERECTA-1, CsERECTA-3, and CsERECTA-4 are 1.66, 1.67, 1.67, 1.64, and 1.64, respectively.

[0127] Example 7

[0128] Expression level of the CsERECTA gene in transgenic tobacco plants:

[0129] After photographing the leaves of T0 generation tobacco, they were quickly frozen in liquid nitrogen and stored in a -80°C freezer for later use.

[0130] 1. RNA extraction from tobacco leaves (follow the instructions for the RNA extraction kit):

[0131] (1) Place the weighed leaves into a pre-cooled mortar, pour in liquid nitrogen and grind into powder, then transfer to a centrifuge tube.

[0132] Simultaneously, add 400 μL of lysis buffer and 400 μL of dilution buffer to a centrifuge tube, mix thoroughly, incubate at room temperature for 5 min, and centrifuge at maximum speed for 5 min.

[0133] (2) Take 400 μL of anhydrous ethanol and add it to a 1.5 mL centrifuge tube prepared in advance. Add the supernatant to the tube and pipette it thoroughly 3-4 times. After mixing thoroughly, add it to the filter column and centrifuge at 13000 rpm at room temperature for 1 min. Discard the filtrate (if one is not enough, it can be added to the column in two batches).

[0134] (3) Add 600 μL of washing solution to the column, centrifuge at 13000 rpm at room temperature for 1 min, and discard the filtrate;

[0135] (4) Add 50 μL of incubation solution (40 μL of nuclease-free water and 10 μL of DNase I dilution) to the column and incubate at room temperature for 15 min;

[0136] (5) Add 600 μL of washing solution to the adsorption column, centrifuge at 13000 rpm at room temperature for 1 min, discard the filtrate, repeat once, then centrifuge for 2 min, and discard the collection tube.

[0137] (6) Place the adsorption column into a new collection tube, add 60 μL of nuclease-free water to the center of the membrane to dissolve the RNA precipitate, incubate at room temperature for 5 min, centrifuge at 12000 rpm at room temperature for 1 min, aspirate the liquid below again and add it to the adsorption column, incubate at room temperature for 2 min, centrifuge at 12000 rpm at room temperature for 1 min (in order to improve RNA yield).

[0138] (7) Concentration detection: The concentration of RNA samples was determined using a micro spectrophotometer, and the samples were stored at -80℃ after the concentration was found to be qualified.

[0139] 2. RNA is reverse transcribed into cDNA:

[0140] (1) Calculate the amount of RNA required for reverse transcription based on the concentration, and construct a 20 μL system;

[0141] (2) Melt the reagents in the reverse transcription kit at room temperature. After melting, briefly centrifuge to allow the sample on the wall to sink to the bottom of the tube, and then place it on ice.

[0142] (3) Prepare the reverse transcription mixture (prepare a large sample in advance), the system is as follows: 5×ture Reaction Mix 4μL, Oligo 1μL, Total RNA calculated according to concentration, RNase-Free ddH2O added to 20μL;

[0143] (4) Mix the prepared reverse transcription solution thoroughly by pipetting, incubate in a 42℃ metal bath for 20 min, incubate in an 85℃ metal bath for 5 min, cool to 4℃, and store in a -20℃ refrigerator.

[0144] 3. Detection of CsERECTA gene expression level by real-time PCR:

[0145] (1) Using the online quantitative primer design software IDT (https: / / sg.idtdna.com / pages / tools), specific quantitative primers were designed based on the specific sequence of the target gene's CDS, as follows:

[0146] CsERECTA-F:AGAACAAGGCCACCATCAATA;

[0147] CsERECTA-R: CGAACTACCCGAACCAATCA.

[0148] (2) Take 1 μL of the cDNA solution obtained by reverse transcription as a template, prepare the reaction mixture (mix the large sample first), mix well and dispense into PCR eight-tube tubes. The reaction mixture preparation system is as follows: 10 μL of 2×SYBR Buffer, 1 μL of cDNA template, 0.5 μL of 5' primer, 0.5 μL of 3' primer, 8 μL of RNase-Free ddH2O, and a total system of 20 μL.

[0149] (3) Briefly centrifuge to ensure no bubbles are generated. If bubbles are present, gently tap the tube wall. Place the tube in a real-time quantitative PCR instrument and set the PCR program according to the primer characteristics.

[0150] (4) The obtained data is analyzed and exported using software.

[0151] See also Figure 7 As shown, the results indicate that the relative gene expression levels of CsERECTA gene-transformed lines 1, 3, and 4 were significantly higher than those of WT. Specifically, the relative expression levels of the CsERECTA gene in lines WT-1, WT-2, CsERECTA-1, CsERECTA-3, and CsERECTA-4 were 1.00, 1.02, 4.06, 3.37, and 3.46, respectively.

[0152] Example 8

[0153] pTRV2-CsERECTA recombinant plasmid (constructed by the company) was introduced into Agrobacterium (introduction method as described in Example 3):

[0154] In this embodiment, when constructing the pTRV2-CsERECTA recombinant plasmid, the UTR region of CsERECTA, namely SEQ ID NO.4, is inserted between the EcoRI and BamHI restriction sites of the pTRV2 vector.

[0155] Example 9

[0156] Virus-mediated silencing of the CsERECTA gene in tea tree branches (VIGS):

[0157] 1. Agrobacterium activation and culture:

[0158] (1) Take the frozen bacterial culture (pTRV2-CsERECTA, pTRV2, pTRV1 Agrobacterium strains) out of the -80℃ freezer and thaw at room temperature. Use an inoculation loop to take the bacterial culture and streak it on YEP solid medium (containing 50 mg / L Kana, 50 mg / L Rif), and incubate upside down at 28℃ for 2 days;

[0159] (2) Pick a single colony and inoculate it into 10 mL of YEP liquid medium (containing 50 mg / L Kana and 50 mg / L Rif), and culture at 28°C and 200 rpm for 18 h with shaking.

[0160] (3) Take 2-3 mL of the above bacterial culture and inoculate it into 250 mL of YEP liquid medium (containing 50 mg / L Kana and 50 mg / L LRif), and incubate at 28°C with shaking at 200 rpm until OD. 600 Reached 1.2;

[0161] (4) Centrifuge (4℃, 5000-6000 rpm, 10 min), discard the supernatant, and resuspend in an equal volume of resuspension (or with a final concentration OD of 1.2). Mix the resuspended pTRV2-CsERECTA and pTRV1 Agrobacterium (experimental group), and mix pTRV2 and pTRV1 Agrobacterium (control group). After mixing, sonicate for 1 min and activate by shaking at 28℃ for 1 h.

[0162] 2. Preparation and vacuum inoculation of plant materials:

[0163] (1) Cut the tea tree branches (semi-lignified) into 15-20cm sections with axillary buds, leaving 1-2 intact leaves;

[0164] (2) Place the prepared tea tree branches into a vacuum bottle containing a mixed bacterial solution of pTRV2-CsERECTA and pTRV1 Agrobacterium (or a mixed bacterial solution of pTRV2 and pTRV1 Agrobacterium) and vacuum it twice (WT uses a resuspension for vacuuming).

[0165] (3) Remove the branches and thoroughly dry the excess bacterial solution on the branches and leaves;

[0166] (4) Place the branches in the culture solution and incubate in the dark for 3 days;

[0167] (5) After dark culture, culture in an artificial climate chamber for 30 days, and change the culture medium every 10 days.

[0168] Example 10

[0169] Analysis of tea tree branches with partially VIGS-silenced CsERECTA gene (see [link to analysis]). Figure 8 As shown; the leaf length and width of new leaves from tea branches of the WT (vacuum-suspended), pTRV2 (corresponding to a mixed culture of pTRV2 and pTRV1 Agrobacterium), and pTRV2-CsERECTA (corresponding to a mixed culture of pTRV2-CsERECTA and pTRV1 Agrobacterium) strains cultured for 30 days in Example 9 were measured (the measurement method is the same as in Example 6). The analysis of the second leaf of the VIGS-silenced CsERECTA tea branch is described in [reference needed]. Figure 9As shown; the results of the measurement of the length and width of the new leaves of the tea tree branches are shown in [reference needed]. Figure 10-12 As shown.

[0170] Specifically, the length-to-width ratios of WT, pTRV2, pTRV2-CsERECTA-1 to pTRV2-CsERECTA-8 are as follows: 2.520, 2.720, 3.204, 3.146, 3.558, 3.492, 2.890, 3.075, 3.376, and 2.952, respectively.

[0171] The length-to-width ratios of WT, pTRV2, pTRV2-CsERECTA-1 to pTRV2-CsERECTA-8 are 2.335, 2.328, 2.673, 2.843, 2.704, 3.323, 2.604, 2.514, 2.702, and 2.598, respectively.

[0172] The length-to-width ratios of WT, pTRV2, pTRV2-CsERECTA-1 to pTRV2-CsERECTA-8 are 2.775, 2.957, 3.799, 3.102, 3.624, 4.577, 3.411, 2.884, 3.714, and 3.134, respectively.

[0173] Compared to the leaves of WT and pTRV2, the leaves of the VIGS CsERECTA gene-silenced lines were generally thinner and longer. The leaf shape index was used as a reference (leaf shape index = leaf length / leaf width (medium width); leaf shape classification criteria: 1. oblong, index 3-4; 2. elliptical, index 2-3; 3. ovate, index 1.5-2).

[0174] Example 11

[0175] The expression levels of the CsERECTA gene in the new leaves of tea branches after 30 days of culture of the WT, pTRV2, and pTRV2-CsERECTA lines in Example 9 were determined (the determination method is the same as in Example 7).

[0176] See also Figure 13 As shown, the relative expression levels of the CsERECTA gene in all pTRV2-CsERECTA lines were significantly lower than those in the WT and pTRV2 lines. Specifically, the relative expression levels of the CsERECTA gene in WT, pTRV2, pTRV2-CsERECTA-1 to pTRV2-CsERECTA-8 were 1.00, 0.90, 0.75, 0.49, 0.72, 0.32, 0.78, 0.61, 0.74, and 0.78, respectively.

[0177] The above-described technical solutions provided by this invention are merely preferred embodiments and do not limit the scope of the patent. Any equivalent structural transformations made using the description and drawings of this invention under the technical concept of this invention, or direct / indirect applications in other related technical fields, are included within the scope of patent protection of this invention.

Claims

1. A CsERECTA gene, characterized in that, The nucleotide sequence of the CsERECTA gene is shown in SEQ ID NO.

1.

2. A recombinant expression vector, characterized in that, The recombinant expression vector is used for the expression of the CsERECTA gene as described in claim 1.

3. The application of the recombinant expression vector as described in claim 2 in reducing the aspect ratio of leaves.

4. A gene silencing vector, characterized in that, The gene silencing vector is used to silence the CsERECTA gene in tea plants.

5. The gene silencing vector according to claim 4, characterized in that, The gene silencing vector includes pTRV2-CsERECTA.

6. The gene silencing vector according to claim 4, characterized in that, The construction process of the gene silencing vector includes inserting the nucleotide sequence shown in SEQ ID NO.4 between the EcoRI and BamHI restriction sites of the pTRV2 vector.

7. The application of a gene silencing vector as described in any one of claims 4-6 in improving the leaf shape of tea leaves.

8. A method for regulating tea leaf shape based on the CsERECTA gene, characterized in that, The shape of the tea leaf includes the length-to-width ratio of the tea leaf; The method for regulating the leaf shape of tea trees includes: introducing the gene silencing vector as described in any one of claims 4-6 into Agrobacterium, and then culturing the tea trees after vacuum infection with the Agrobacterium.

9. The application of the tea tree leaf shape regulation method as described in claim 8 in tea tree breeding.

10. A method for improving light utilization efficiency in tea plants based on the CsERECTA gene, characterized in that, include: By inhibiting the expression of the CsERECTA gene in tea plants, the leaf shape of tea plants can be controlled, thereby improving the light utilization rate of tea plants.

Citation Information

Cited By

  • Application of tea tree CsTPR38 gene in regulation and control of leaf tooth density of tea tree

    CN122012605A

  • Application of tea tree CsTPR38 gene in regulating leaf tooth density of tea tree

    CN122012605B