A dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers

Abstract

The present invention discloses a dual-mode intelligent substance detection method based on bivalent nucleic acid aptamers, which includes two detection modes: fluorescence and colorimetry. This method belongs to the field of analytical chemistry. The present invention combines a bivalent aptamer with a double hairpin structure with its complementary sequence. Under the action of sodium borohydride and silver nitrate, DNA-silver nanoclusters and DNA-adsorbed silver nanoparticles are formed at different times and temperatures, respectively. In both detection modes, the bivalent aptamer acts as a molecular recognition target, and its complementary sequence acts as a signal-enhancing probe. Rapid, ultrasensitive detection is achieved by detecting fluorescence, absorbance, and analyzing the R+B value of colorimetric images using a smartphone app. This detection method is simple to operate, efficient, and sensitive, and exhibits good recovery and anti-interference capabilities in spiked sample testing. It has promising application prospects in the qualitative and quantitative analysis of aminoglycoside antibiotic compounds.

Description

Technical Field

[0001] The present invention relates to a dual-mode intelligent substance detection method based on bivalent nucleic acid aptamers, which can perform highly sensitive and rapid determination of aminoglycoside antibiotic compounds in food, aquatic products, medicines and outdoor environmental samples, and belongs to the technical field of analytical chemistry. Background Art

[0002] Kanamycin, an aminoglycoside antibiotic, is highly effective in treating Gram-negative and Gram-negative bacterial infections. Its excellent anti-infective properties make it a key component in biomedicine, agriculture, animal husbandry, and the food industry. However, with the widespread use of kanamycin, researchers have discovered that its ototoxicity and nephrotoxicity are higher among aminoglycoside antibiotics, second only to neomycin. Some technicians have pointed out that kanamycin is a major cause of deafness in children, most often due to excessive dosage or prolonged treatment. Therefore, excessive doses of kanamycin can have adverse effects on the human body. To prevent the overuse of kanamycin in medical treatment and the accumulation of kanamycin residues in animal-derived foods, it is necessary to develop highly sensitive and specific kanamycin detection methods to safeguard medical health and food safety.

[0003] To date, methods for detecting kanamycin include high-performance liquid chromatography (HPLC), gas chromatography (GC), capillary electrophoresis (CE), microbiological analysis, and immunoassays. However, these methods are difficult to perform, requiring highly skilled personnel and complex sample pretreatment. Aptamers are small oligonucleotide sequences or short peptides obtained through in vitro screening. They possess high affinity and strong specificity for their target molecules and are typically screened from nucleic acid sequence libraries using exponential enrichment ligand evolution techniques. In recent years, numerous aptamer-based antibiotic detection methods have been reported. Since the late 20th century, aptamers have been widely used in biosensing, often as recognition probes for biosensors. Some researchers have constructed more sophisticated and efficient aptamer sensors by splitting a single intact aptamer into two. Other researchers have also demonstrated the effectiveness of assembling two independent aptamers into bivalent aptamers as recognition probes. Generally, multivalent aptamers exhibit higher affinity than monovalent aptamers, resulting in more sensitive sensors. Therefore, the development of multivalent aptamer biosensors has become a new development trend.

[0004] DNA sequences can be mixed with sodium borohydride (NaBH4) and silver nitrate (AgNO3) at different reaction times and temperatures to form two different nanomaterials. DNA reacts with NaBH4 and AgNO3 at 0°C for 4 hours to form DNA-silver nanoclusters (DNA-AgNCs). DNA-AgNCs are silver nanoclusters synthesized using DNA as a template. Due to their excellent fluorescence properties, stability, and simple synthesis process, they have been widely reported in the field of biosensing. DNA reacts with NaBH4 and AgNO3 at room temperature for 5 minutes to form DNA-adsorbed silver nanoparticles (AgNPs). AgNPs are excellent optical nanomaterials, appearing dark gray when aggregated and yellow when dispersed, and are therefore commonly used in the construction of colorimetric biosensors.

[0005] The present invention constructs a dual-mode intelligent substance detection method based on bivalent nucleic acid aptamers to detect the kanamycin content in aquatic products. In the fluorescence mode, Bivalent Apt complements the cDNA bases, making the cytosine positions in the Bivalent Apt sequence more dispersed, resulting in weak fluorescence of the synthesized DNA-AgNCs. After the addition of kanamycin, the conformation of Bivalent Apt changes, thereby significantly enhancing the fluorescence of the synthesized DNA-AgNCs. In the colorimetric mode, the complementary chain formed by Bivalent Apt and cDNA opens the double hairpin structure of Bivalent Apt, making Bivalent Apt more easily adsorbed on the surface of synthesized silver nanoparticles (AgNPs), thereby preventing the aggregation of AgNPs. After the addition of kanamycin, Bivalent Apt falls off the AgNPs surface, causing the synthesized AgNPs to aggregate, the color of the reaction system changes from yellow to gray, and the absorbance changes significantly. By detecting fluorescence and absorbance and analyzing the R+B value of the colorimetric image using a smartphone app, rapid and ultrasensitive detection is achieved. Summary of the Invention

[0006] The present invention aims to propose a dual-mode substance detection method based on bivalent nucleic acid aptamers, which can achieve highly sensitive, highly selective, and portable quantitative detection of kanamycin in complex samples. The fluorescence detection mode has a limit of detection (LOD) of 5.98 fmol / L. The fluorescence detection mode has high sensitivity, easy control of the detection process, low energy consumption, good reproducibility of the prepared DNA-AgNCs, low detection cost, no tedious pretreatment of the actual sample, and low technical requirements for the experimenter. The colorimetric mode has rapid detection speed, mild synthesis conditions, convenient and intuitive results, and a wide detection range. The R+B value of the colorimetric image is measured by a smartphone app, and portable quantitative analysis of kanamycin is achieved within a linear range of 0 to 500 μmol / L. The two operating modes are mutually verified, further reducing the occurrence of false positive results and effectively improving the accuracy and precision of the method. The dual-mode substance intelligent detection method constructed by this invention based on bivalent nucleic acid aptamers has great application potential in Chinese shrimp meat, seawater, freshwater, and milk.

[0007] To achieve the above objectives, the present invention discloses a dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers, and the specific technical solutions adopted are as follows:

[0008] A dual-mode intelligent substance detection method based on bivalent nucleic acid aptamers includes fluorescence and colorimetric detection modes. In the fluorescence detection mode, Bivalent Apt complements cDNA bases, dispersing the cytosine positions in the Bivalent Apt sequence, resulting in weak fluorescence in the synthesized DNA-AgNCs. Adding kanamycin causes a conformational change in Bivalent Apt, significantly enhancing the fluorescence of the synthesized DNA-AgNCs. The minimum detection limit in this fluorescence mode is as low as 5.98 fmol / L. In the colorimetric detection mode, the complementary strands formed by Bivalent Apt and cDNA open the Bivalent Apt's double hairpin structure, making it more easily adsorbed on the surface of synthesized AgNPs, thereby preventing their aggregation. Adding kanamycin causes Bivalent Apt to fall off the AgNP surface, causing the synthesized AgNPs to aggregate. The color of the reaction system changes from yellow to gray, and the absorbance changes significantly. By detecting fluorescence and absorbance and analyzing the R+B value of colorimetric images using a smartphone app, rapid and ultrasensitive detection is achieved. This colorimetric mode enables portable and rapid quantitative analysis of kanamycin within a linear range of 0 to 500 μmol / L.

[0009] Furthermore, the sequences of Bivalent Apt and cDNA were purchased from Shanghai Sangon Biotechnology Co., Ltd. The Bivalent Apt sequence is shown in SEQ ID NO.1:

[0010] GGGACTTGGTTTAGGTAATGAGTCCCGGGACTTGGTTTAGGTAATGAGTCCC; the cDNA sequence is shown in SEQ ID NO.2: TAAACCAAGTCCG

[0011] Furthermore, the fluorescence detection mode includes the following steps:

[0012] (1) Preparation of DNA mother solution: Place the centrifuge tube containing DNA powder in a centrifuge at 8000 rpm / min for 30 s. After the centrifugation is completed, gently remove the centrifuge tube and open the lid. Add a certain amount of double-distilled water according to the instructions on the tube wall and shake thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store at 4°C for later use.

[0013] (2) Complementation of Bivalent Apt sequence with cDNA sequence: 10 μL of Bivalent Apt and cDNA were taken, respectively, dissolved in 85 μL Tris-EDTA buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.0), placed in a constant temperature metal bath for heating and denaturation, and slowly renatured to form a dsDNA structure;

[0014] (3) Recognition of Bivalent Apt and Kanamycin: 10 μL of kanamycin solution of different concentrations was added to the complex of step (2) above, and the reaction was carried out at 37°C for 60 min. The kanamycin concentration was 500 fmol / L to 50 nmol / L.

[0015] (4) Preparation of DNA-AgNCs signal probe: Add 2 μL of silver nitrate AgNO3 solution to the solution in step (3), shake vigorously for 5 minutes, and then ice-bathe for 90 minutes. Then, add 2 μL of sodium borohydride NaBH4 solution to the solution and ice-bathe in the dark for 240 minutes to obtain the DNA-AgNCs signal probe, completing the operation of the DNA-AgNCs-based fluorescence detection mode.

[0016] Furthermore, the colorimetric detection mode includes the following steps:

[0017] (1) Preparation of DNA mother solution: Place the centrifuge tube containing DNA powder in a centrifuge at 8000 rpm / min for 30 s. After the centrifugation is completed, gently remove the centrifuge tube and open the lid. Add a certain amount of double-distilled water according to the instructions on the tube wall and shake thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store at 4°C for later use.

[0018] (2) Complementation of Bivalent Apt sequence and cDNA sequence: 20 μL of Bivalent Apt and cDNA were dissolved in 40 μL of Tris-EDTA buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.5), heated in a constant temperature metal bath for denaturation, and slowly renatured to form dsDNA;

[0019] (3) Recognition of Bivalent Apt and Kanamycin: Add different concentrations of kanamycin solution to the complex of step (2), and react at 25°C for 120 min. The kanamycin concentration is 0 μmol / L to 500 μmol / L.

[0020] (4) Preparation of aptamer-templated silver nanoparticles (Apt-templated AgNPs) signal probe: Add 60 μL of AgNO3 solution to the solution in step (3) and shake to mix. After ice bath, add 60 μL of NaBH4 solution, shake to mix, and then protect from light for 5 minutes.

[0021] (5) Analysis of image R+B value using smartphone: The R+B value of the synthesized image under different concentrations of kanamycin solution was measured by smartphone app, thereby obtaining the correlation between kanamycin concentration and R+B value, and completing the construction of kanamycin colorimetric smart aptamer sensor based on aptamer-templated silver nanoparticles Apt-templated AgNPs.

[0022] Furthermore, in the fluorescence detection mode step (2), the Bivalent Apt concentration is 4 μmol / L, the cDNA concentration is 2 μmol / L, the Bivalent Apt and cDNA are mixed and heated at 95°C for 5 minutes, ice bathed for 5 minutes, and the temperature condition for forming the dsDNA conformation is 37°C, and incubated for 120 minutes.

[0023] Furthermore, in the fluorescence detection mode step (4), the concentration of the AgNO3 solution is 60 μmol / L, and the concentration of the NaBH4 is 60 μmol / L.

[0024] Furthermore, in the colorimetric detection mode step (2), the concentration of Bivalent Apt is 2.5 μmol / L, and the concentration of cDNA is 2 μmol / L.

[0025] Furthermore, in the colorimetric detection mode step (4), the concentration of the AgNO3 solution is 3 mmol / L, and the concentration of the NaBH4 solution is 3 mmol / L.

[0026] Furthermore, in the colorimetric detection mode step (2), Bivalent Apt is mixed with cDNA and placed in a constant temperature metal bath and heated to 95° C. for denaturation for 5 min. The temperature for forming the dsDNA conformation is 37° C., and the incubation time is 120 min.

[0027] The dual-mode intelligent substance detection method based on bivalent nucleic acid aptamers disclosed in the present invention has the following advantages over the existing technology:

[0028] (1) This invention first designed bivalent Apt-cDNA as a synthetic substrate sequence for DNA-AgNCs, and achieved for the first time a highly sensitive, specific, and stable dual-mode intelligent substance detection method based on bivalent nucleic acid aptamers. This fluorescence detection mode, combined with the principle that the addition of kanamycin causes conformational changes in bivalent Apt, significantly enhancing the fluorescence of synthesized DNA-AgNCs, and the significant affinity of bivalent Apt for kanamycin, enables the detection of kanamycin content in complex samples with high sensitivity, selectivity, and stability, with a detection limit as low as 5.98 fmol / L.

[0029] (2) Fluorescence detection mode: By combining aptamer recognition technology with DNA-AgNCs, a sensing system was constructed in which the fluorescence of the system dynamically increases with increasing kanamycin concentration. This system was used for highly sensitive and specific detection of kanamycin in Chinese shrimp meat, aquaculture water samples, and milk. Compared with other kanamycin detection methods, this kanamycin fluorescence detection mode has the advantages of high sensitivity and fast detection speed, and can be applied to the detection of antibiotics in biomedicine.

[0030] Secondly, the colorimetric detection mode of the present invention is based on the complementary chain formed by Bivalent Apt and cDNA, which opens the double hairpin structure of Bivalent Apt, making Bivalent Apt more easily adsorbed on the surface of synthesized AgNPs, thereby preventing the aggregation of AgNPs. After the addition of kanamycin, Bivalent Apt falls off the surface of AgNPs, causing the synthesized AgNPs to aggregate, the color of the reaction system changes from yellow to gray, and the absorbance changes significantly. By detecting the absorbance and analyzing the R+B value of the colorimetric image through a smartphone app, rapid and portable detection is achieved with a detection limit as low as 0.37μmol / L. The colorimetric detection mode combines aptamer recognition technology with aptamer-templated silver nanoparticle Apt-templated AgNPs colorimetric signal probes to construct a sensing system in which the reaction system color gradually deepens with increasing kanamycin concentration, and the extinction coefficient and R+B value dynamically decrease. This sensing system has been used for the highly sensitive and specific detection of kanamycin in Chinese shrimp meat, two aquaculture water samples, and milk.

[0031] In summary, the present invention discloses a dual-mode intelligent substance detection method based on bivalent nucleic acid aptamers. The two detection modes verify each other, further preventing the generation of false positive results, and effectively improving the accuracy and confidence of the detection. At the same time, the feasibility of kanamycin multivalent aptamers is demonstrated, deepening the application potential of kanamycin nucleic acid aptamers. In the fluorescence mode, the hybridization of cDNA and Bivalent Apt sequences makes the position of Bivalent Apt cytosine more dispersed, resulting in weak fluorescence of the synthesized DNA-AgNCs. The addition of kanamycin causes the conformation of Bivalent Apt to change, thereby significantly enhancing the fluorescence of the synthesized DNA-AgNCs. In the colorimetric mode, the complementary chain formed by Bivalent Apt and cDNA opens the double hairpin structure of Bivalent Apt, making Bivalent Apt more easily adsorbed on the surface of synthesized AgNPs, thereby preventing AgNPs from aggregating. After the addition of kanamycin, Bivalent Apt falls off the surface of AgNPs, causing the synthesized AgNPs to aggregate. The color of the reaction system changes from yellow to gray, and the absorbance changes significantly. By detecting fluorescence, absorbance, and analyzing the R+B value of the colorimetric image using a smartphone app, rapid and ultra-sensitive detection is achieved. The fluorescence and colorimetric methods of this scheme are independent, and their integration not only fully utilizes the advantages of each method, but also improves the accuracy and confidence of the analysis by using dual-mode signals as self-calibration. The present invention is further integrated into a smartphone through clever sequence design and the synthesis of two signal probes: DNA silver nanoclusters DNA-AgNCs and aptamer-templated silver nanoparticles Apt-templated AgNPs. This dual-mode intelligent material detection method based on bivalent nucleic acid aptamers has high sensitivity for kanamycin detection and can achieve portable rapid quantitative detection. It has good research value in the field of food safety detection. The dual-mode intelligent detection method has far-reaching significance for detecting the kanamycin content in real samples of shrimp meat, lake water, seawater, and milk products. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 This is the detection principle diagram.

[0033] Figure 2 It is the fluorescence spectrum of the sensing system when different concentrations of kanamycin are added.

[0034] Figure 3 It is the standard curve of the fluorescence detection mode of the sensing system.

[0035] Figure 4 It is the standard curve of the colorimetric detection mode of the sensing system.

[0036] Figure 5 It is the standard curve of the intelligent detection mode of the sensing system. DETAILED DESCRIPTION

[0037] The present invention is further described below with reference to the accompanying drawings: A dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers, the detection principle of which is as follows Figure 1 As shown, first, two oligonucleotide chains were designed, one of which was a kanamycin bivalent aptamer: Bivalent Apt, and the other cDNA sequence was designed to be partially complementary to Bivalent Apt. This invention used Bivalent Apt-cDNA as a template sequence for synthesizing DNA-AgNCs for the first time.

[0038] A dual-mode intelligent substance detection method based on bivalent nucleic acid aptamers includes fluorescence detection mode and colorimetric detection mode. The synthesized signal probe DNA-AgNCs in the fluorescence detection mode has the characteristics of high fluorescence intensity, which is mainly due to the sophisticated design of the DNA template, such as Figure 1 As shown in the figure, the 3' end of Bivalent Apt is a G-rich sequence. Under fluorescence mode, the cDNA and Bivalent Apt bases complement each other, making the positions of Bivalent Apt cytosines more dispersed, resulting in weak fluorescence of the synthesized DNA-AgNCs. The addition of kanamycin changes the conformation of Bivalent Apt, thereby significantly enhancing the fluorescence of the synthesized DNA-AgNCs.

[0039] In colorimetric mode, the complementary strands formed by Bivalent Apt and cDNA open the double hairpin structure of Bivalent Apt, allowing Bivalent Apt to more easily adsorb to the surface of synthesized AgNPs, thereby preventing AgNP aggregation. Upon addition of kanamycin, Bivalent Apt detaches from the AgNP surface, causing the synthesized AgNPs to aggregate. The color of the reaction system changes from yellow to gray, and the absorbance changes significantly. Rapid and portable detection is achieved by monitoring fluorescence and absorbance, and analyzing the R+B value of the colorimetric image using a smartphone app.

[0040] Furthermore, the fluorescence detection mode includes the following steps:

[0041] (1) Preparation of DNA mother solution: Place the centrifuge tube containing DNA powder in a centrifuge at 8000 rpm / min for 30 s. After the centrifugation is completed, gently remove the centrifuge tube and open the lid. Add a certain amount of double-distilled water according to the instructions on the tube wall and shake thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store in a refrigerator at 4°C for later use.

[0042] (2) Complementation of Bivalent Apt sequence with cDNA sequence: 10 μL of 4 μmol / L Bivalent Apt and 10 μL of 2 μmol / L cDNA were dissolved in 85 μL Tris-EDTA buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.0), heated at 95°C for 5 min, ice-bathed for 5 min, and then annealed at 37°C for 120 min to form a dsDNA structure;

[0043] (3) Recognition of Bivalent Apt and Kanamycin: 10 μL of kanamycin solution of different concentrations was added to the complex of step (2) above, and the reaction was carried out at 37°C for 60 min. The kanamycin concentration was 500 fmol / L to 50 nmol / L.

[0044] (4) Preparation of DNA-AgNCs signal probe: Add 2 μL of 60 μmol / L AgNO3 solution to the solution in step (3), shake vigorously for 5 minutes, and then ice-bathe for 90 minutes. Then, add 2 μL of 60 μmol / L ice-cold NaBH4 solution to the solution, mix well, and ice-bathe for 240 minutes. The DNA-AgNCs signal probe can be prepared, completing the operation of the DNA-AgNCs-based fluorescence detection mode.

[0045] Furthermore, the colorimetric detection mode includes the following steps:

[0046] (1) Preparation of DNA mother solution: Place the centrifuge tube containing DNA powder in a centrifuge at 8000 rpm / min for 30 s. After the centrifugation is completed, gently remove the centrifuge tube and open the lid. Add a certain amount of double-distilled water according to the instructions on the tube wall and shake thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store in a refrigerator at 4°C for later use.

[0047] (2) Complementation of Bivalent Apt sequence with cDNA sequence: 20 μL of 2.5 μmol / L Bivalent Apt and 20 μL of 2 μmol / L cDNA were dissolved in 40 μL Tris-EDTA buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.5), heated to 95°C in a thermostatic metal bath for denaturation for 5 min, then cooled to 37°C and incubated for 120 min to form dsDNA conformation;

[0048] (3) Recognition of Bivalent Apt and Kanamycin: Add different concentrations of kanamycin solution to the solution in step (2) above, and react at 25°C for 120 min. The kanamycin concentration is 0 μmol / L to 500 μmol / L.

[0049] (4) Preparation of aptamer-templated silver nanoparticles Apt-templated AgNPs signal probe: add 60 μL of 3 mmol / L AgNO3 solution to the solution in step (3) and shake to mix, then add 60 μL of 3 mmol / L NaBH4 solution after ice bath, shake to mix, and then stand at room temperature for 5 minutes to prepare the aptamer-templated silver nanoparticles Apt-templated AgNPs colorimetric probe;

[0050] (5) Analysis of image R+B value using smartphone: The R+B value of the synthesized aptamer-templated silver nanoparticles Apt-templated AgNPs images in different concentrations of kanamycin solution was measured using the smartphone APP "Color picker", thereby inferring the linear relationship between kanamycin concentration and R+B value, and completing the construction of a kanamycin colorimetric smart aptamer sensor based on aptamer-templated silver nanoparticles Apt-templated AgNPs.

[0051] Wherein, Bivalent Apt and cDNA were purchased from Shanghai Sangon Biotechnology Co., Ltd., and the Bivalent Apt sequence is shown in SEQ ID NO.1:

[0052] GGGACTTGGTTTAGGTAATGAGTCCCGGGACTTGGTTTAGGTAATGAGTCCC; the cDNA sequence is shown in SEQ ID NO.2: TAAACCAAGTCCG.

[0053] Example 1: Drawing of a standard curve for dual-mode intelligent aptamer sensor detection

[0054] (1) Drawing of standard curve for fluorescence detection mode

[0055] Under optimal detection conditions, the sensitivity of the aptamer sensor was evaluated. Fluorescence emission spectra of kanamycin at concentrations of 500 fmol / L, 1 pmol / L, 10 pmol / L, 100 pmol / L, 500 pmol / L, 1 nmol / L, 10 nmol / L, and 50 nmol / L at an excitation wavelength of 260 nm were recorded. The dynamic detection range of the aptamer sensor was determined, with kanamycin concentration as the horizontal axis and fluorescence intensity as the vertical axis. Figure 2, and the linear relationship between kanamycin concentration and fluorescence intensity, the linear equation and the detection limit LOD of the aptamer sensor were obtained by calculation.

[0056] Detection procedure: First, 10 μL of 4 μmol / L Bivalent Apt and 10 μL of 2 μmol / L cDNA were dissolved in 85 μL TE buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.0), heated at 95°C for 5 min, then ice-bathed for 5 min, renatured at 37°C for 120 min, then added 10 μL of kanamycin solutions at concentrations of 500 fmol / L, 1 pmol / L, 10 pmol / L, 100 pmol / L, 500 pmol / L, 1 nmol / L, 10 nmol / L, and 50 nmol / L, and reacted at 37°C for 60 min, then added 2 μL of 60 μmol / L AgNO3 solution, vigorously shaken for 5 min, and then ice-bathed for 90 min, then added 2 μL of 60 μmol / L ice-cold NaBH4 solution to the solution, mixed, and then ice-bathed in the dark for 240 min, then the fluorescence intensity of the reaction system was detected using an Infinite-M100PRO multifunctional microplate reader at an excitation wavelength of 260 nm and an emission wavelength of 321 nm, with both the excitation and emission slits being 10 nm and the automatic scanning speed set to 2000 nm / min. The recovery rate and relative standard deviation were obtained by calculation.

[0057] DNA-AgNCs were synthesized by chemical reduction method. The synthesis process was mainly divided into two steps: first, the dsDNA template chain was mixed with AgNO3, and then NaBH4 was used to trigger the reaction of ssDNA and Ag. + Reduction reaction. The specific operation is as follows: First, take 10μL, 4μmol / L Bivalent Apt, and 10μL, 2μmol / L cDNA and dissolve them in 85μL TE buffer (10mmol / L Tris-HCl, 1mmol / L EDTA, pH8.0), heat at 95℃ for 5min, then ice bath for 5min, renature at 37℃ for 120min, then add 2μL, 60μmol / L AgNO3 solution, shake vigorously for 5min, then ice bath for 90min, then add 2μL, 60μmol / L ice-cold NaBH4 solution, shake and mix, then ice bath in the dark for 240min. Subsequently, the fluorescence intensity of the reaction system was detected using an Infinite-M100PRO multifunctional microplate reader at an excitation wavelength of 260nm and an emission wavelength of 321nm. The excitation and emission slits were both 10nm, and the automatic scanning speed was set to 2000nm / min. The recovery rate and relative standard deviation were obtained by calculation.

[0058] The performance of the fluorescence detection mode was studied under the optimal detection conditions. Figure 3 It can be seen that in the concentration range of 0-50 nmol / L, the fluorescence intensity of the fluorescent aptamer sensor increases with the increase of kanamycin concentration. The linear response range between fluorescence intensity and kanamycin concentration (1 pmol / L to 1 nmol / L) was quantitatively derived, and the regression equation was y=6.098*C+69377(R 2 =0.988), where y represents the fluorescence intensity and C represents the kanamycin concentration, see Figure 2 , the LOD was determined to be 5.98 fmol / L, which indicates that the fluorescent aptasensor we constructed has excellent detection sensitivity and extremely low detection limit.

[0059] (2) Drawing of the standard curve for colorimetric detection mode

[0060] Under optimal conditions, the sensitivity of this colorimetric detection mode was evaluated. The absorbance values ​​of kanamycin at a wavelength of 395 nm were recorded at concentrations ranging from 0 μmol / L to 500 μmol / L. The dynamic detection range of the aptamer sensor and the linear relationship between kanamycin concentration and absorbance were determined, with kanamycin concentration as the abscissa and absorbance as the ordinate. The linear equation and the limit of detection (LOD) of the colorimetric aptamer sensor were calculated.

[0061] Detection procedure: First, take 20 μL of 2.5 μmol / L Bivalent Apt and 20 μL of 2 μmol / L cDNA, dissolve them in 40 μL TE buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.5), and after denaturation treatment, add 10 μL of kanamycin solution with a concentration of 0 μmol / L to 500 μmol / L and react at room temperature for 120 minutes. Then add 60 μL of 3 mmol / L AgNO3 solution, shake and mix, and then add 60 μL of 3 mmol / L NaBH4 solution. After mixing, let it stand at room temperature for 5 minutes, and then use a full-wavelength microplate reader to detect the absorbance value of the reaction system at a wavelength of 395 nm.

[0062] Aptamer-templated silver nanoparticles (Apt-templated AgNPs) were synthesized by chemical reduction. The specific synthesis process is as follows: first, 20 μL of 2.5 μmol / L Bivalent Apt and 20 μL of 2 μmol / L cDNA were dissolved in 40 μL TE buffer (10 mmol / L Tris-HCl, 1 mmol / L EDTA, pH 8.5). After mixing, the mixture was renatured and 60 μL of 3 mmol / L AgNO3 solution was added under continuous stirring. After oscillation and mixing, 60 μL of 3 mmol / L NaBH4 solution was added and stirred continuously until the color of the solution changed from colorless to uniform golden yellow. Finally, the solution was purified with a microporous filter membrane (0.45 μm) and kept at 4°C for use.

[0063] The detection performance of this colorimetric detection mode was studied under the optimal detection conditions. Figure 4 It can be seen that in the concentration range of 0 to 500 μmol / L, the absorbance of the aptamer sensor at 395 nm decreases with the increase of kanamycin concentration. The linear response range between absorbance and kanamycin concentration (50 μmol / L to 500 μmol / L) was quantitatively derived, and the regression equation was Y = -0.0005706*C + 2.083 (R 2 =0.992), where Y represents the absorbance value and C represents the kanamycin concentration. Figure 4 The LOD was determined to be 17.77 μmol / L.

[0064] Furthermore, the R+B value of the colorimetric image was analyzed using the smartphone APP “Color picker”. Figure 5 It can be seen that in the concentration range of 0 to 500 μmol / L, the R+B value of the colorimetric image decreases with the increase of kanamycin concentration. The corresponding range between R+B value and kanamycin concentration (0 μmol / L to 500 μmol / L) was quantitatively derived, and the regression equation was Y = -0.2853*C + 213.6 (R 2 =0.995), where Y represents the R+B value and C represents the kanamycin concentration. Figure 4 The LOD was determined to be 0.37 μmol / L.

[0065] Example 2: Detection of the dual-mode intelligent substance detection method in actual samples

[0066] In order to investigate the detection capability of the dual-mode intelligent substance detection method in actual samples, the kanamycin content in real samples was detected by spiking real samples with kanamycin, and the recovery rate and relative standard deviation were measured to analyze the detection performance in real samples.

[0067] First, we selected two aquaculture water samples, seawater and freshwater, for spike recovery experiments. The seawater was taken from Liandao, Haizhou District, Lianyungang, and the freshwater was taken from Jingsi Lake, Jiangsu Ocean University. The two aquaculture water samples were filtered multiple times using a 0.22μm sterile filter membrane before use to remove particulate matter. The pH of the water samples was then adjusted to neutral with sodium acetate buffer, and 10μL of water samples with different concentrations of kanamycin (final concentrations were 50pmol / L, 100pmol / L, 50μmol / L, and 100μmol / L, respectively) were taken for spike recovery experiments.

[0068] Milk pretreatment: Milk samples were purchased from a local supermarket. 20% acetic acid was added dropwise to 50 mL of milk sample until its pH dropped to 4.6. The sample was then placed in a 45°C water bath for 20 min to precipitate casein, and then centrifuged at 10,000 rpm for 20 min to remove protein and fat coagulation. The supernatant was collected and filtered with a 0.22 μm filter membrane to remove lipids. The kanamycin solution was then added to the prepared milk supernatant, and the experimental procedures were followed.

[0069] Before the experiment, shrimp meat was pretreated. Fresh Chinese shrimp purchased from the Lianyungang seafood market were cleaned and minced using a meat grinder. Five grams of sample were then mixed with 5 mL of ultrapure water. The resulting supernatant was collected, centrifuged at 10,000 rpm for 2 minutes, and filtered through a 0.22 μm filter to remove impurities. The supernatant was used to dilute the kanamycin standard solution to obtain final kanamycin concentrations of 50 pmol / L, 100 pmol / L, 50 μmol / L, and 100 μmol / L. The detection signal was analyzed using a fluorescence / colorimetric smart aptamer sensor.

[0070] By analyzing the detection signal results, we found that the constructed bivalent aptamer-based dual-mode intelligent detection method had a recovery rate of 94.1% to 104.6.1% for 50 pmol / L and 100 pmol / L kanamycin in seawater, freshwater, Chinese shrimp meat, and milk in fluorescence detection mode. The corresponding relative standard deviations (RSDs) ranged from 3.95% to 6.07%. In colorimetric detection mode, the recovery rates of 50 μmol / L and 100 μmol / L kanamycin in seawater, freshwater, Chinese shrimp meat, and milk were 95.09% to 104.41%. The corresponding relative standard deviations (RSDs) ranged from 3.99% to 6.15%. All these results confirmed that the constructed bivalent aptamer-based dual-mode intelligent detection method has excellent detection performance and practical application value in complex samples.

[0071] The specific samples and test results are shown in Table 1:

[0072] Table 1 Actual sample test table

[0073]

[0074] The above are all preferred embodiments of the present invention. For ordinary technicians in this technical field, without departing from the principle of the present invention, various equivalent modifications to the present invention are within the scope of protection of the claims attached to this application.

Claims

1. A dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers, characterized by: The dual-mode intelligent substance detection method based on bivalent nucleic acid aptamers includes a fluorescence detection mode and a colorimetric detection mode. In the fluorescence mode, the bivalent aptamer Bivalent Apt complements the complementary DNA cDNA base, making the cytosine position of the Bivalent Apt sequence more dispersed, resulting in weak fluorescence of the synthesized DNA silver nanocluster DNA-AgNCs. After the addition of kanamycin, the Bivalent Apt conformation changes, thereby significantly enhancing the fluorescence of the synthesized DNA-AgNCs. In the colorimetric mode, the complementary chain formed by Bivalent Apt and cDNA opens the double hairpin structure of Bivalent Apt, making Bivalent Apt more easily adsorbed on the surface of synthesized silver nanoparticles AgNPs, thereby preventing the aggregation of AgNPs. After the addition of kanamycin, Bivalent Apt falls off the AgNPs surface, causing the synthesized AgNPs to aggregate. The color of the reaction system changes from yellow to gray, and the absorbance changes significantly. By detecting fluorescence, absorbance, and analyzing the R+B value of the colorimetric image using a smartphone app, rapid and ultrasensitive detection is achieved. The Bivalent Apt sequence is shown in SEQ ID NO. 1: GGGACTTGGTTTAGGTAATGAGTCCCGGGACTTGGTTTAGGTAATGAGTCCC; the cDNA sequence is shown in SEQ ID NO. 2: TAAACCAAGTCCG; The minimum detection limit of the fluorescence detection mode is 5.98 fmol / L, and the fluorescence detection mode includes the following steps: (1) Preparation of DNA mother solution: Place the centrifuge tube containing DNA powder in a centrifuge and centrifuge at 8000 rpm / min for 30 s. After centrifugation, add double-distilled water and shake to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store at 4°C for later use. (2) Complementation of Bivalent Apt sequence with cDNA sequence: 10 μL of Bivalent Apt and cDNA were dissolved in 85 μL of buffer solution to react and form dsDNA structure. The pH value of the buffer solution was 8.

0. (3) Recognition of Bivalent Apt and Kanamycin: 10 μL of kanamycin solution of different concentrations was added to the complex in step (2), and the reaction was carried out at 37°C for 60 min. The kanamycin concentration was 500 fmol / L~50 nmol / L. (4) Preparation of DNA-AgNCs signal probe: Add 2 μL AgNO3 solution to the solution in step (3), shake vigorously for 5 min, and then place on ice for 90 min. Then, add 2 μL NaBH4 solution to the solution and place on ice in the dark for 240 min to prepare the DNA-AgNCs signal probe, completing the operation of the DNA-AgNCs-based fluorescence detection mode; The colorimetric detection mode comprises the following steps: (1) Preparation of DNA mother solution: Place the centrifuge tube containing DNA powder in a centrifuge and centrifuge at 8000 rpm / min for 30 seconds. After the centrifugation is completed, add double-distilled water and shake to mix thoroughly to fully dissolve the DNA powder. Accurately quantify the DNA sample solution to 100 μmol / L and store at 4°C for later use. (2) Complementation of Bivalent Apt sequence with cDNA sequence: 20 μL of Bivalent Apt and cDNA were dissolved in 40 μL of buffer solution to react and form dsDNA structure. The pH value of the buffer solution was 8.

5. (3) Recognition of Bivalent Apt and Kanamycin: Add different concentrations of kanamycin solution to the complex in step (2), and react at 25°C for 120 min. The kanamycin concentration is 0 μmol / L to 500 μmol / L. (4) Preparation of aptamer-templated silver nanoparticles (Apt-templated AgNPs) signal probe: Add 60 μL of AgNO3 solution to the solution in step (3) and shake to mix. After ice bath, add 60 μL of NaBH4 solution, shake to mix, and then react in the dark for 5 minutes. (5) Analysis of image R+B value using smartphone: The R+B value of the synthesized aptamer-templated silver nanoparticles (Apt-templated AgNPs) images in different concentrations of kanamycin solution was measured using a smartphone app to obtain the correlation between kanamycin concentration and R+B value, thus completing the construction of a kanamycin colorimetric smart aptamer sensor based on aptamer-templated silver nanoparticles (Apt-templated AgNPs).

2. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 1, characterized in that: In step (2), the concentration of Bivalent Apt is 4 μmol / L, and the concentration of cDNA is 2 μmol / L. After the Bivalent Apt and cDNA are mixed, they are heated at 95° C. for 5 minutes and ice-bathed for 5 minutes. The temperature condition for forming the dsDNA conformation is 37° C. and incubated for 120 minutes.

3. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 1, characterized in that: In the step (4), the concentration of the AgNO3 solution is 60 μmol / L, and the concentration of the NaBH4 is 60 μmol / L.

4. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 1, characterized in that: In step (3), the concentration of Bivalent Apt is 2.5 μmol / L, and the concentration of cDNA is 2 μmol / L.

5. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 1, characterized in that: In step (4), the concentration of the AgNO3 solution is 3 mmol / L, and the concentration of the NaBH4 solution is 3 mmol / L.

6. The dual-mode substance intelligent detection method based on bivalent nucleic acid aptamers according to claim 1, characterized in that: In step (2), Bivalent Apt is mixed with cDNA and placed in a constant temperature metal bath and heated to 95°C for denaturation for 5 minutes. The temperature for forming the dsDNA conformation is 37°C, and the incubation time is 120 minutes.

Images