Oligomeric nucleic acid as well as preparation method and application thereof

Abstract

The invention relates to an oligomeric nucleic acid as well as a preparation method and application thereof. The invention provides a single-stranded or double-stranded oligomeric nucleic acid, each strand has 15 to 35 nucleotides, and at least one nucleotide position of the oligomeric nucleic acid, which is not the head end, comprises a chemical modification shown in a formula (I) or a tautomer modification thereof. According to the modification method disclosed by the invention, the off-target effect of the siRNA is reduced, and meanwhile, the in-target activity of the siRNA is not influenced to the greatest extent.

Description

Oligonucleic acid and its preparation method and application Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and specifically relates to an oligonucleic acid and a preparation method and application thereof. Background Art

[0002] siRNA has a very important prospect for drug development. However, in vivo applications, siRNA often has varying degrees of off-target effects, and there may be cases where siRNA targets non-target genes. Off-target effects similar to the microRNA pathway are one of the main causes of siRNA off-target effects, namely the inhibitory activity on mRNA generated by the complete or incomplete pairing of the siRNA antisense strand (also known as the AS strand) seed region (positions 2-8 at the 5' end) with the target mRNA. The off-target effect of a single siRNA molecule may affect multiple mRNAs. Therefore, unpredictable toxic side effects may occur, which is the main reason for the toxic side effects of siRNA drugs.

[0003] To reduce off-target toxicity and improve the safety of siRNA drugs, the antisense strand seed region of the siRNA drug can be chemically modified at specific sites, thereby reducing the off-target toxicity of small nucleic acid drugs. By introducing chemical modifications, the strength of the interaction between the seed region and the target gene can be adjusted, and efforts are made to reduce off-target effects without affecting the silencing effect of the target mRNA (Mark K. Schlegel, Chirality Dependent Potency Enhancement and Structural Impact of Glycol Nucleic Acid Modification on siRNA. J. Am. Chem. Soc. 2017, 139, 8537-8546).

[0004] In the prior art, chemical modifications, such as GNA or UNA, introduced into the 5'-end seed region of the antisense strand of siRNA can reduce off-target toxicity, but also significantly reduce on-target activity. Therefore, there is a need for a chemical modification method that can minimize the on-target activity of siRNA while reducing off-target effects.

[0005] Summary of the Invention

[0006] The purpose of the present invention is to provide an oligonucleic acid that can reduce the off-target effect of siRNA while not affecting the on-target activity of siRNA to the greatest extent, as well as a preparation method and application thereof.

[0007] In order to achieve the above object, the technical solution adopted by the present invention is:

[0008] The first aspect of the present invention provides a single-stranded or double-stranded oligonucleic acid, each strand having 15 to 35 nucleotides, wherein at least one non-terminal nucleotide position of the oligonucleic acid comprises a chemical modification represented by formula (II) or a tautomer modification thereof,

[0009] wherein B1 is a natural nucleobase, a modified nucleobase, a universal base, or an H atom;

[0010] R1, R2 and R3 are each independently selected from H, OH, halogen, NH2, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, NCH3(CH3), OCH2CH2OCH3 and -O-alkylamino;

[0011] n is 1, 2, or 3;

[0012] Wherein, the chemical modification shown in formula (II) is not

[0013] Preferably, B1 is a natural nucleobase, a modified nucleobase, a universal base or an H atom;

[0014] R1, R2 and R3 are each independently selected from H, OH or CH3;

[0015] n is 1 or 2.

[0016] According to some embodiments, the oligonucleic acid is siRNA, comprising a sense strand and an antisense strand, each strand having 15 to 35 nucleotides, and the antisense strand comprises a chemical modification represented by Formula (II-1), Formula (II-2), (II-3) or (II-4) or a tautomer modification thereof at at least one nucleotide position from positions 2 to 8 in the 5' region of the antisense strand.

[0017] Wherein: B1 and B2 are natural nucleobases, modified nucleobases, universal bases or H atoms respectively.

[0018] Preferably, B1, B2 are modified or unmodified nucleobases, respectively.

[0019] According to some preferred embodiments, the chemical modification is selected from any one of the following structures:

[0020] According to some preferred embodiments, the chemical modification is selected from any one of the following structures: Ago, Ggo, Cgo, Ugo, Ggs, Tgo.

[0021] According to some embodiments, the chain comprises a chemical modification represented by formula (II), (II-1), (II-2), (II-3) or (II-4) or a tautomer modification thereof at at least one nucleotide position from position 5 to position 8 in its 5' region.

[0022] Furthermore, the chain comprises a chemical modification shown as (II), (II-1), (II-2), (II-3) or (II-4) or a tautomer modification thereof at at least one nucleotide position between positions 6 and 7 in its 5' region.

[0023] Furthermore, the chain is the antisense chain of a double-stranded oligonucleic acid, and contains a chemical modification represented by Ago, Ggo, Cgo, Ugo, Ggs or Tgo or a tautomer modification thereof at at least one nucleotide position between the 6th and 7th positions of its 5' region.

[0024] Furthermore, in addition to the chemically modified nucleotides represented by formula (II), (II-1), (II-2), (II-3) or (II-4) or their tautomer-modified nucleotides, the chain also contains at least one other modified nucleotide.

[0025] Furthermore, the other modified nucleotides are independently selected from the group consisting of 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides and 2'-substituted amino-modified nucleotides.

[0026] Preferably, the other modified nucleotides are independently selected from the group consisting of 2'-F modified nucleotides, 2'-O-CH3 modified nucleotides, 2'-O-CH2-CH2-O-CH3 modified nucleotides, 2'-O-CH2-CH=CH2 modified nucleotides, 2'-CH2-CH2-CH=CH2 modified nucleotides and 2'-deoxynucleotides;

[0027] More preferably, the other modified nucleotides are independently selected from: 2'-F modified nucleotides and 2'-O-CH3 modified nucleotides.

[0028] Furthermore, the oligonucleic acid is siRNA, which comprises a sense strand and an antisense strand, and the siRNA has at least one of the following characteristics:

[0029] (i) the antisense strand comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;

[0030] (ii) the antisense strand comprises 1, 2, 3, or 4 phosphorothioate internucleotide linkages;

[0031] (iii) the sense strand contains 2, 3, 4, or 5 2'-fluoro modifications;

[0032] (iv) the sense strand contains 1, 2, 3 or 4 phosphorothioate internucleotide linkages.

[0033] Furthermore, the siRNA comprises a duplex region with a length of 12-40 nucleotide pairs.

[0034] According to some specific embodiments, the sense strand of the oligonucleic acid is 5'-UmsGmsAmCmAfAmGfAfAfUmCmCmUmCmAmCmAmUm-3', and the antisense strand is 5'-AmsUfsUmGmUm(Ggo)AmGmGmAmUmUmCmUfUmGfUmCmAmsAmsCm-3'; or,

[0035] The sense strand of the oligonucleic acid is 5'-UmsGmsAmCmAfAmGfAfAfUmCmCmUmCmAmCmAmAmUm-3', and the antisense strand is 5'-AmsUfsUmGmUmGf(Ago)GmGmAmUmUmCmUfUmGfUmCmAmsAmsCm-3'; or,

[0036] The sense strand of the oligonucleic acid is 5'-CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3', and the antisense strand is 5'-UmsUfsUmGmAm(Ago)GmUmAmUmGmCmCmUfCmAfAmGmGmsUmsUm-3'; or,

[0037] The sense strand of the oligonucleic acid is 5'-CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3', and the antisense strand is 5'-UmsUfsUmGmAmAf(Ggo)UmAmUmGmCmCmUfCmAfAmGmGmsUmsUm-3'; or,

[0038] The sense strand of the oligonucleic acid is 5'-GmsUmsGmUmGmCmAfCfUf UmCmGmCmUmUmCmAmCmAm-3', and the antisense strand is 5'-UmsGfsUmGmAmAf(Ggo)CfGfAmAmGmUmGfCmAfCmAmCmsUmsUm-3'; or,

[0039] The sense strand of the oligonucleic acid is 5'-AmsCmsUmGmAmAmGfCfAfUmUmUmGmAmUmGmCmAmAm-3', and the antisense strand is 5'-UmsUfsGmCmAm(Ugo)CmAmAmAmUmGmCmUfUmCfAmGmUmsGmsUm-3'; or,

[0040] The sense strand of the oligonucleic acid is 5'-AmsCmsUmGmAmAmGfCfAfUmUmUmGmAmUmGmCmAmAm-3', and the antisense strand is 5'-UmsUfsGmCmAmUf(Cgo)AmAmAmUmGmCmUfUmCfAmGmUmsGmsUm-3'; or,

[0041] The sense strand of the oligonucleic acid is 5'-AmsUmAmAmCmUmCfAfCfUmAmUmAmAmUmUmAmCmUm-3', and the antisense strand is 5'-AmsGfsUmAmAm(Ugo)UmAmUmAmGmUmGmAfGmUfUmAmUmsUmsUm-3'; or,

[0042] The sense strand of the oligonucleic acid is 5'-AmsUmAmAmCmUmCfAfCfUmAmUmAmAmUmUmUmCmUm-3', and the antisense strand is 5'-AmsGfsUmAmAmUf(Ugo)AmUmAmGmUmGmAfGmUfUmAmUmsUmsUm-3'; or,

[0043] The sense strand of the oligonucleic acid is 5'-GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmsAms-3', and the antisense strand is 5'-VPUmsGfsUmGmAm(Ago)GmCmGmAmAmGmUmGfCmAfCmAmCmsUmsUm-3'; or,

[0044] The sense strand of the oligonucleic acid is 5'-GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmAm-3', and the antisense strand is 5'-UmsGfsUmGmAmAgoGmCmGmAmAmGmUmGfCmAfCmAmCmsUmsUm-3'.

[0045] According to other specific embodiments, the sense strand of the oligonucleic acid is 5'-CmsCmsUmUmGmAmGfGfCfAmUmAmCmUmUmCmAmAmAm-3', and the antisense strand is 5'-UmsUfsUmGmAmAf(Ggs)UmAmUmGmCmCmUfCmAfAmGmGmsUmsUm-3'; or,

[0046] The sense strand of the oligonucleic acid is 5'-GmsUmsGmUmGmCmAfCfUfUmCmGmCmUmUmCmAmCmAm-3', and the antisense strand is 5'-UmsGfsUmGmAmAf(Ggs)CfGf AmAmGmUmGfCmAfCmAmCmsUmsUm-3'.

[0047] The second aspect of the present invention provides an siRNA conjugate, which comprises the above-mentioned single-stranded or double-stranded oligonucleic acid and a conjugated group conjugated to the oligonucleic acid.

[0048] Furthermore, the conjugated group is connected to the 3' end and / or the 5' end of the sense strand.

[0049] In some specific and preferred embodiments, the conjugated group is

[0050] or

[0051] The third aspect of the present invention provides a pharmaceutical composition comprising the above-mentioned single-stranded or double-stranded oligonucleic acid or the above-mentioned siRNA conjugate, and a pharmaceutically acceptable carrier.

[0052] In a fourth aspect, the present invention provides a kit comprising the above-mentioned single-stranded or double-stranded oligonucleic acid, or the above-mentioned siRNA conjugate, or the above-mentioned pharmaceutical composition.

[0053] The fifth aspect of the present invention provides a compound represented by the following formula (IV) or its tautomer,

[0054] wherein B1 is a natural nucleobase, a modified nucleobase, a universal base or an H atom;

[0055] E is a leaving group; preferably, E is MMTr or DMTr;

[0056] Q is a phosphorus-containing reactive group; preferably, Q is

[0057] According to some specific and preferred embodiments, the compound represented by formula (IV) or its tautomer is selected from any of the following structures:

[0058] A sixth aspect of the present invention provides a method for preparing the above-mentioned single-stranded or double-stranded oligonucleic acid or the above-mentioned siRNA conjugate, comprising the following steps:

[0059] 1) synthesizing the compound represented by the above formula (IV) or its tautomer;

[0060] 2) synthesizing the oligonucleic acid or siRNA conjugate using the compound of step 1) or its tautomer.

[0061] In a seventh aspect, the present invention provides a method for inhibiting a target gene in a cell, comprising the step of introducing the above-mentioned single-stranded or double-stranded oligonucleic acid or the above-mentioned siRNA conjugate into the cell.

[0062] According to some embodiments, the target gene includes but is not limited to PD-L1, HBV, AGT, PCSK9, APOC3 or LPA, etc.

[0063] The eighth aspect of the present invention provides a method for modifying positions 2-8 of the antisense chain of siRNA to reduce off-target activity, wherein a chemical modification as shown in general formula (II), (II-1), (II-2), (II-3) or (II-4) or its tautomer modification is introduced into positions 2-8 of the antisense chain of the siRNA molecule.

[0064] According to some specific embodiments, the chemical modification represented by general formula (II), (II-1), (II-2), (II-3) or (II-4) or its tautomer is selected from any one of the structural formulas drawn above.

[0065] Furthermore, the chemical modification represented by general formula (II), (II-1), (II-2), (II-3) or (II-4) or its tautomer is selected from any one of Ago, Ggo, Cgo, Ugo, Ggs and Tgo.

[0066] Due to the application of the above technical solution, the present invention has the following advantages compared with the prior art:

[0067] The present invention introduces a special compound into the 5'-end seed region of the antisense strand of siRNA to reduce the off-target effect of siRNA while minimizing the impact on the on-target activity of siRNA, thereby improving the safety of siRNA as a drug. BRIEF DESCRIPTION OF THE DRAWINGS

[0068] FIG1 shows the level of HBV DNA relative to the vehicle group (%). DETAILED DESCRIPTION

[0069] It should be noted that, unless otherwise defined, the technical or scientific terms used in this application should have the same meaning as those commonly understood by those skilled in the art. The experimental methods in the following examples are all conventional methods unless otherwise specified. The raw materials, reagents, etc. used in the following examples are all commercially available products unless otherwise specified.

[0070] As used herein and in the appended claims, the singular forms "a," "an," "another," and "the" include plural referents unless the context clearly dictates otherwise.

[0071] definition

[0072] In the context of the present invention, capital letters A, U, C, G represent the base composition of a nucleotide; lowercase letter m represents that the nucleotide adjacent to the left of the letter m is a 2'-methoxy-modified nucleotide; lowercase letter f represents that the nucleotide adjacent to the left of the letter f is a 2'-fluoro-modified nucleotide; lowercase letter s represents that the two nucleotides adjacent to the left and right of the letter s are connected by a thiophosphate group; the letter combination VP represents that the nucleotide adjacent to the right of the letter combination VP is a vinyl phosphate-modified nucleotide, as shown below.

[0073] As used herein, the term "natural nucleobase" refers to a nucleobase that has not been modified from its naturally occurring form in RNA or DNA. Examples of "natural nucleobases" include the purine nucleobases adenine (A) and guanine (G) and the pyrimidine nucleobases thymine (T), cytosine (C), and uracil (U). In addition to "natural nucleobases," many modified nucleobases or nucleobase mimetics known to those skilled in the art are suitable for use in the compounds described herein.

[0074] As used herein, the term "modified nucleobase" refers to a nucleobase that is structurally very similar to a parent nucleobase, such as 7-deazapurine, 5-methylcytosine, or the G-clamp.

[0075] As used herein, a universal nucleic acid base is a base that can pair complementarily with at least two commonly used bases, such as hypoxanthine (whose nucleoside is inosine), which can pair with any of A, T, G, or C, with a binding affinity of I:C>I:A>I:G>I:T; or 5-Bromouridine (BrU), which can pair with A or G. Alternatively, other universal bases that can pair complementarily with at least two commonly used bases can also be used in the present invention, such as 3-nitropyrrole, 5-nitroindole, 7-azaindole, and the like.

[0076] As used herein, the term "seed region" is the region of the antisense strand of an RNAi agent that is responsible for recognizing the target mRNA and responds to, for example, nucleotides 2-8 from the 5' end of the antisense strand.

[0077] As used herein, the term "nucleotide position" refers to the position of a nucleotide in an oligonucleotide as counted from the nucleotide at the 5' end. For example, nucleotide position 1 refers to the 5' terminal nucleotide of the oligonucleotide.

[0078] As used herein, "oligonucleic acid," also known as "oligonucleotide," refers to a polymeric form of nucleotides within the range of 2 to 2500 nucleotides. Oligonucleotides may be single-stranded or double-stranded. In certain embodiments, the oligonucleotide has 500 to 1500 nucleotides, typically, for example, wherein the oligonucleotide is used for gene therapy. In certain embodiments, the oligonucleotide is single-stranded or double-stranded and has 7 to 100 nucleotides. In certain embodiments, the oligonucleotide is single-stranded or double-stranded and has 15 to 100 nucleotides. In another embodiment, the oligonucleotide is single-stranded or double-stranded with 15 to 50 nucleotides, typically, for example, wherein the oligonucleotide is a nucleic acid inhibitor molecule. In another embodiment, the oligonucleotide is single-stranded or double-stranded with 25 to 40 nucleotides, typically, for example, wherein the oligonucleotide is a nucleic acid inhibitor molecule. In another embodiment, the oligonucleotide is single-stranded or double-stranded and has 19 to 40 or 19 to 25 nucleotides, typically, for example, wherein the oligonucleotide is a double-stranded nucleic acid inhibitor molecule and forms a double helix with at least 18 to 25 base pairs. In other embodiments, the oligonucleotide is single-stranded and has 15 to 25 nucleotides, typically, for example, wherein the oligonucleotide nucleotide is a single-stranded RNAi inhibitor molecule. Typically, as described herein, the oligonucleotide contains one or more phosphorus-containing internucleotide linking groups. In other embodiments, as described herein, the internucleotide linking group is a phosphite amide group.

[0079] As used herein, "2'-fluoro-modified nucleotide" refers to a nucleotide in which the hydroxyl group at the 2'-position of the ribose group of the nucleotide is substituted with fluorine, and has a structure shown in the following formula (7).

[0080] Base herein refers to a base, such as A, U, G, C or T.

[0081] Similarly, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides and 2'-substituted amino-modified nucleotides refer to nucleotides in which the hydroxyl group at the 2' position of the ribose group of the nucleotide is replaced by the corresponding group.

[0082] As used herein, "conjugation" refers to the covalent attachment of two or more chemical moieties, each with a specific function, to one another; accordingly, "conjugate" refers to a compound formed by covalent attachment of these chemical moieties. Furthermore, "siRNA conjugate" refers to a compound formed by covalent attachment of one or more chemical moieties with a specific function to an siRNA.

[0083] In the context of the present invention, particularly when describing the siRNA of the application, containing the compositions of siRNA or the preparation method of siRNA conjugate, unless otherwise stated, described nucleoside monomer (nucleoside monomer) refers to, according to the kind and order of Nucleotide in the siRNA for preparation or the siRNA conjugate, the modification used in the phosphoramidite solid phase synthesis or unmodified nucleoside phosphoramidite monomer (unmodified or modified RNA phosphoramidites, RNA phosphoramidites is also referred to as Nucleoside phosphoramidites sometimes).Phosphoramidite solid phase synthesis is the method used in RNA synthesis known to those skilled in the art.The application's used nucleoside monomer all can be commercially obtained.

[0084] In the present invention, "non-first end of an oligonucleotide" refers to any position other than the first and last ends of an oligonucleotide, in other words, any position other than the first and last nucleotides (5'-3' direction) of an oligonucleotide.

[0085] The siRNA of the present application contains a nucleotide group as a basic structural unit. It is well known to those skilled in the art that the nucleotide group contains a phosphate group, a ribose group and a base.

[0086] The present invention introduces one of the compounds of the present application into the 5'-end seed region of the antisense strand of siRNA for chemical modification, which reduces the off-target effect of siRNA while minimizing the impact on the on-target activity of siRNA, thereby improving the safety of siRNA as a drug.

[0087] In the prior art, GNA or UNA modifications are usually introduced into the 5'-end seed region of the antisense strand of siRNA, which can reduce off-target toxicity but also result in a significant loss of on-target activity.

[0088] Wherein, UNA is shown in formula (3), and GNA is shown in formula (4).

[0089] In the above formulae (3) and (4), R is selected from H, OH or alkoxy (O-alkyl).

[0090] In the examples of the present application (including in vitro and in vivo experiments), different siRNA sequences targeting multiple targets were designed, and the on-target activity and off-target activity of siRNA were compared when the chemical modification of the present application and the GNA modification were introduced at the same position in the 5' end seed region of the antisense strand of the siRNA in the siRNA antisense strand composed of the same base sequence. The results showed that the introduction of the chemical modification and GNA modification of the present application can reduce the off-target effect of siRNA and improve the safety of siRNA as a drug; however, the siRNA introduced with the chemical modification of the present application has better on-target activity than the GNA modification, which indicates that the introduction of the chemical modification of the present application can not affect the on-target activity of siRNA to the greatest extent.

[0091] The present application provides many chemical modifications, such as Ago, Ggo, Cgo, Ugo, Cgs, Ggs, etc., and the introduction of one of these chemical modifications at at least one nucleotide position from the 2nd to the 8th position in the 5' region of the antisense chain can retain the on-target activity basically the same as the original sequence and significantly reduce the off-target activity.

[0092] In one embodiment, the antisense strand comprises a chemical modification represented by formula (II), (II-1), (II-2), (II-3) or (II-4) as defined above, or a tautomer modification thereof, at at least one nucleotide position from position 5 to position 8 in its 5' region;

[0093] Preferably, the antisense strand comprises a chemical modification represented by the above-defined formula (II), (II-1), (II-2), (II-3), (II-4) or a tautomer modification thereof at at least one nucleotide position between positions 6 and 7 in its 5' region.

[0094] In the examples of the present application (including in vitro and in vivo experiments), it was verified that the inclusion of the above-mentioned chemical modification at the 6th or 7th nucleotide position in the 5'-end seed region of the siRNA antisense strand can reduce the off-target effect of the siRNA while minimizing the impact on the on-target activity of the siRNA.

[0095] In a preferred embodiment of the present invention, in addition to the chemically modified nucleotides represented by formula (II), (II-1), (II-2), (II-3), (II-4) as defined above, or modified tautomers thereof, at least one of the sense strand and / or antisense strand further comprises at least one other modified nucleotide;

[0096] Preferably, in addition to the chemically modified nucleotides represented by formula (II), (II-1), (II-2), (II-3), (II-4) or their tautomer-modified nucleotides defined above, the remaining nucleotides in the sense chain and / or antisense chain are other modified nucleotides.

[0097] In some embodiments, the other modified nucleotides are independently selected from the group consisting of: 2'-fluoro-modified nucleotides, 2'-alkoxy-modified nucleotides, 2'-substituted alkoxy-modified nucleotides, 2'-alkyl-modified nucleotides, 2'-substituted alkyl-modified nucleotides, 2'-deoxynucleotides, 2'-amino-modified nucleotides and 2'-substituted amino-modified nucleotides.

[0098] Preferably, the other modified nucleotides are independently selected from the group consisting of 2'-F modified nucleotides, 2'-O-CH3 modified nucleotides, 2'-O-CH2-CH2-O-CH3 modified nucleotides, 2'-O-CH2-CH=CH2 modified nucleotides, 2'-CH2-CH2-CH=CH2 modified nucleotides and 2'-deoxynucleotides;

[0099] More preferably, the other modified nucleotides are independently selected from: 2'-F modified nucleotides and 2'-O-CH3 modified nucleotides.

[0100] In some embodiments, the 2'-alkyl modified nucleotide is a methoxy modified nucleotide (2'-OMe), as shown in formula (8).

[0101] Here, Base represents a base, such as A, U, G, C or T.

[0102] In some embodiments, the single-stranded or double-stranded oligonucleic acid / siRNA has at least one of the following characteristics:

[0103] (i) the antisense strand comprises 2, 3, 4, 5 or 6 2'-fluoro modifications;

[0104] (ii) the antisense strand comprises 1, 2, 3, or 4 phosphorothioate internucleotide linkages;

[0105] (iv) the sense strand contains 2, 3, 4, or 5 2'-fluoro modifications;

[0106] (v) The sense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide bonds, and the structure is shown in formula (1):

[0107] (vi) the siRNA comprises at least four 2'-fluoro modifications;

[0108] (vii) The siRNA comprises a duplex region of 12-40 nucleotide pairs in length.

[0109] 2. siRNA conjugates of the present invention

[0110] The present invention provides an siRNA conjugate, which comprises the above-mentioned single-stranded or double-stranded oligonucleic acid / siRNA and a conjugated group conjugated to the siRNA.

[0111] Preferably, the conjugate group comprises a pharmaceutically acceptable targeting group and a linker, and the single-stranded or double-stranded oligonucleic acid / siRNA, the linker and the targeting group are sequentially covalently or non-covalently linked.

[0112] In a preferred embodiment of the present invention, the conjugated group conjugated to the siRNA is TIN or FIN, wherein the synthesis of FIN refers to US2022 / 0008541A1.

[0113] 3. Pharmaceutical compositions and kits of the present invention

[0114] The present application provides a pharmaceutical composition, which contains the single-stranded or double-stranded oligonucleic acid / siRNA or siRNA conjugate as described above as an active ingredient and a pharmaceutically acceptable carrier.

[0115] The pharmaceutically acceptable carrier may be a carrier conventionally used in the field of siRNA administration, such as, but not limited to, magnetic nanoparticles (e.g., nanoparticles based on Fe3O4 or Fe2O3), carbon nanotubes, mesoporous silicon, calcium phosphate nanoparticles, polyethylenimine (PEI), polyamidoamine (PAMAM) dendrimer, poly(L-lysine, PLL), chitosan, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP), poly (D&L-lactic / glycolic acid) copolymer (PLGA), poly(2-aminoethyl ethylene phosphate), poly(L-lysine, PLL ... phosphate), PPEEA) and poly (methacrylate-N, N-dimethylaminoethyl ester) (poly (2-dimethylaminoethyl methacrylate), PDMAEMA) and one or more of their derivatives.

[0116] In the pharmaceutical composition, there is no particular requirement for the content of the single-stranded or double-stranded oligonucleic acid / siRNA or siRNA conjugate and the pharmaceutically acceptable carrier, and the conventional content of each component can be used.

[0117] The present disclosure provides a kit comprising the above-mentioned single-stranded or double-stranded oligonucleic acid / siRNA or the above-mentioned siRNA conjugate or the above-mentioned pharmaceutical composition.

[0118] In some embodiments, the kits described herein may provide single-stranded or double-stranded oligonucleic acid / siRNA or siRNA conjugates in one container. In some embodiments, the kits described herein may include a container for providing a pharmaceutically acceptable excipient. In some embodiments, the kits may also include other ingredients, such as stabilizers or preservatives. In some embodiments, the kits described herein may include at least one other therapeutic agent in other containers other than the container providing single-stranded or double-stranded oligonucleic acid / siRNA or siRNA conjugates described herein. In some embodiments, the kits may include instructions for mixing single-stranded or double-stranded oligonucleic acid / siRNA or siRNA conjugates with pharmaceutically acceptable carriers and / or excipients or other ingredients (if any).

[0119] In the kit of the present application, the single-stranded or double-stranded oligonucleic acid / siRNA, siRNA conjugate and pharmaceutically acceptable carrier and / or adjuvant and / or pharmaceutical composition, and / or pharmaceutically acceptable carrier and / or adjuvant can be provided in any form, such as liquid form, dried form or lyophilized form. In some embodiments, the single-stranded or double-stranded oligonucleic acid / siRNA, siRNA conjugate and pharmaceutically acceptable carrier and / or adjuvant and the pharmaceutical composition and pharmaceutically acceptable carrier and / or adjuvant are substantially pure and / or sterile. In some embodiments, sterile water can be provided in the kit of the present application.

[0120] The technical solution provided by the present invention is further described below in conjunction with specific embodiments. The following embodiments are only used to illustrate the present invention and do not limit the scope of protection of the present invention.

[0121] Example 1 Preparation of Compound SA000001

[0122] 1.1 Preparation of intermediate 2

[0123] Dissolve anhydrous diisopropylamine (16.2 g, 160.0 mmol, 22.6 mL, 2.0 equiv) in 350 mL of anhydrous tetrahydrofuran, cool to between -70°C and -78°C, and under nitrogen purge. Add n-butyllithium solution (2.5 M, 67.1 mL) dropwise (slowly over at least 10 minutes). Stir the reaction mixture at -70°C to -78°C for 30 minutes. Dissolve compound 1 (9.44 g, 79.9 mmol, 9.17 mL, 1.0 equiv) in 175 mL of anhydrous tetrahydrofuran, cool to between -70°C and -78°C, and under nitrogen purge, add the solution from the previous step dropwise (slowly over at least 10 minutes). Stir the reaction mixture at -70°C to -78°C for 30 minutes. Maintaining the previous temperature, hexamethylphosphoric triamide (26.1 g, 146 mmol, 25.6 mL, 1.82 equiv) and benzyl chloromethyl ether (17.5 g, 112 mmol, 15.5 mL, 1.4 equiv) were slowly added dropwise to the reaction mixture (addition was slow and continuous over at least 10 minutes). After the addition was complete, the mixture was warmed to 0°C and stirred for 3 hours. TLC and LCMS confirmed the disappearance of compound 1. The reaction was quenched by adding 600 mL of saturated ammonium chloride solution in two batches. The mixture was extracted with 200 mL of methyl tert-butyl ether. The organic phases were collected, washed with saturated brine, and dried over anhydrous sodium sulfate. After filtration, the filtrate was concentrated. The crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 100 / 1 to 1 / 1) to yield light brown compound 2 (9.69 g, 40.7 mmol, 51% yield).

[0124] 1 H NMR (400MHz, CDCl3): δ7.46-7.28 (m, 10H), 4.58-4.46 (m, 2H), 4.19-4.08 (m, 1H), 3.82-3.67 (m, 5H), 2.77 (q, J = 6.1Hz, 1H), 1.24 (d, J = 6.5Hz, 4H).

[0125] LC-MS:C 13 H 18 O4, molecular weight 238.1, 239.1 (M+H).

[0126] 1.2 Preparation of intermediate 3

[0127] Compound 2 (14.7 g, 61.7 mmol, 1.0 equiv) was dissolved in 150 mL of dichloromethane under nitrogen. Imidazole (16.8 g, 247.0 mmol, 4.0 equiv) and tert-butyldimethylsilyl chloride (27.9 g, 185.0 mmol, 22.7 mL, 3.0 equiv) were added at room temperature. The reaction mixture was stirred at room temperature for one hour. TLC and LCMS analysis showed the disappearance of compound 2. 100 mL of dichloromethane was added to the reaction mixture, and the reaction mixture was washed twice with 400 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The crude product was purified by silica gel column chromatography (petroleum ether / ethyl acetate = 100 / 1 to 10 / 1) to obtain compound 3 (12.0 g, 34.0 mmol, 55% yield) as a pale yellow oil.

[0128] 1 H NMR (400MHz, CDCl3): δ7.40-7.25(m,5H),4.52(d,J=2.4Hz,2H),4.10(t,J=6.3Hz,1H),3.75-3.65(m,4H),3.59 (dd, J = 9.2, 5.3 Hz, 1H), 2.79 (dt, J = 8.4, 5.9 Hz, 1H), 1.17 (d, J = 6.2 Hz, 3H), 0.86 (s, 9H), 0.04 (d, J = 8.6 Hz, 6H).

[0129] LC-MS:C 19 H 32 O4Si, molecular weight 352.1, 353.2 (M+H).

[0130] 1.3 Preparation of intermediate 4

[0131] Compound 3 (11.1 g, 31.5 mmol, 1.0 equiv) was dissolved in tetrahydrofuran and cooled to between -70°C and -60°C. Diisobutylaluminum hydride (1.0 M, 69.3 mL, 2.2 equiv) was added dropwise under nitrogen. Stirring continued at this temperature for two hours. LCMS analysis indicated the disappearance of compound 3. The temperature was raised to 0°C, and 20 mL of ethyl acetate was added. The reaction was then quenched with 100 mL of potassium sodium tartrate solution and stirred for another half an hour. The mixture was washed with 100 mL of saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated to afford compound 4 (9.75 g, 30.0 mmol, 95% yield) as a pale yellow oil.

[0132] 1H NMR (400MHz, CDCl3): δ7.40-7.27(m,5H),4.59-4.45(m,2H),4.19(dd,J=6.2,3.7Hz,1H),4.01(dd,J=11.3, 4.0Hz,1H),3.78-3.60(m,3H),1.78-1.68(m,1H),1.29-1.21(m,3H),0.95-0.87(m,9H),0.12-0.02(m,6H).

[0133] LC-MS:C 18 H 32 O3Si, molecular weight 324.1, 325.2 (M+H).

[0134] 1.4 Preparation of intermediate 5

[0135] Compound 4 (9.75 g, 30.0 mmol, 1.0 equiv) was dissolved in tetrahydrofuran and cooled to 0°C. p-Toluenesulfonyl chloride (11.5 g, 60.1 mmol, 2.0 equiv) and methylimidazole (6.17 g, 75.1 mmol, 5.99 mL, 2.5 equiv) were added dropwise under nitrogen. After the addition was complete, the mixture was allowed to warm to room temperature and stirred for 16 hours. LCMS analysis showed the disappearance of compound 4. 20 mL of ethyl acetate was added to the reaction mixture, and the reaction was quenched with 100 mL of potassium sodium tartrate solution under an ice bath. Stirring was continued for 30 minutes. The mixture was washed with 100 mL of saturated brine, dried over anhydrous sodium sulfate, filtered, and concentrated to afford the crude product, compound 5 (13.7 g, 28.6 mmol, 95% yield), as a pale yellow oil.

[0136] 1 H NMR (400MHz, CDCl3): δ7.89-7.68(m,2H),7.42-7.17(m,10H),4.47-4.33(m,2H),4.23(dd,J=9.6,5.1Hz,1H),4.13-4.06(m,1H) ,4.01-3.94(m,1H),3.52-3.34(m,2H),2.43(s,3H),2.02-1.89(m,1H),1.10(d,J=6.3Hz,3H),0.81(s,8H),0.04--0.05(m,6H).

[0137] LC-MS:C 25 H 38 O5SSi, molecular weight 478.1, 479.2 (M+H).

[0138] 1.5 Preparation of Intermediate 6

[0139] Under nitrogen, compound 5 (13.7 g, 28.6 mmol, 1.0 equiv) and 35 mL of acetonitrile were added to a dry reaction flask. The acetonitrile was evaporated at 35-40°C to remove water from compound 5. Under nitrogen, 80 mL of N,N-dimethylformamide, compound 5-1 (9H-purin-6-amine) (4.25 g, 31.5 mmol, 1.1 equiv), and potassium carbonate (3.96 g, 28.6 mmol, 1.0 equiv) were added to another clean, dry reaction flask. The temperature was raised to 95-100°C and stirring was continued for half an hour. At this temperature, a solution of compound 5 (13.7 g, 28.6 mmol, 1.0 equiv) in N,N-dimethylformamide (60 mL) was added dropwise to the reaction mixture, and stirring was continued for 12 hours. LCMS detection showed that compound 5 disappeared. The reaction solution was cooled to room temperature and 200 mL of ethyl acetate was added. The mixed solution was washed with 200 mL of sodium bicarbonate solution and 100 mL of saturated brine in sequence. The organic phase was dried over anhydrous sodium sulfate, filtered and the filtrate was concentrated. The crude product was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate = 20 / 1 to 10 / 1) to give compound 6 (6.2 g, 14.0 mmol, 49% yield) as a light yellow oil.

[0140] 1 H NMR (400MHz, CDCl3): δ8.37(s,1H),7.75(s,1H),7.39-7.24(m,6H),5.66(br,s,2H),4.47-4.34(m,3H),4.21(dd,J=14.1,8.8Hz, 1H), 4.07 (dd, J=6.2, 4.9Hz, 1H), 3.42-3.34 (m, 2H), 2.10-1.96 (m, 1H), 1.19 (d, J=6.4Hz, 3H), 0.90 (s, 9H), 0.06 (d, J=6.0Hz, 6H).

[0141] LC-MS:C 23 H 35 N5O2Si, molecular weight 441.1, 442.3 (M+H).

[0142] 1.6 Preparation of intermediate 7

[0143] Palladium on carbon (3.0 g, 10% purity) was dissolved in 25 mL of methanol at room temperature. A 25 mL methanol solution of compound 6 (5.2 g, 11.8 mmol, 1.0 equiv) and trifluoroacetic acid (134.0 mg, 1.18 mmol, 87.2 uL) were added. The reaction mixture was stirred under 50 psi of hydrogen pressure for 48 hours. LCMS analysis showed the disappearance of compound 6. The reaction mixture was filtered and concentrated to afford the crude product, compound 7 (3.9 g, 11.1 mmol), as a pale yellow oil.

[0144] 1 H NMR (400MHz, CDCl3): δ8.21(s,1H),8.12(s,1H),4.50-4.36(m,1H),4.33-4.22(m,1H),4.15-4.02(m,1 H), 3.53 (d, J = 5.9Hz, 2H), 2.21-2.09 (m, 1H), 1.25 (d, J = 6.4Hz, 3H), 0.88 (s, 9H), 0.05 (d, J = 3.1Hz, 6H).

[0145] LC-MS:C 16 H 29 N5O2Si, molecular weight 351.1, 352.2 (M+1).

[0146] 1.7 Preparation of intermediate 8

[0147] Compound 7 (3.9 g, 11.1 mmol, 1.0 equiv) was placed in a clean, dry reaction flask. 10 mL of pyridine was added under nitrogen and the temperature was raised until the pyridine was evaporated. This process was repeated once to remove water from compound 7. 28 mL of pyridine was added and trimethylsilyl chloride (4.8 g, 44.4 mmol, 5.63 mL, 4.0 equiv) was added under ice-cooling. The mixture was warmed to room temperature and stirred for two hours. TLC analysis showed the disappearance of compound 7. Benzoyl chloride (6.2 g, 44.4 mmol, 5.15 mL, 4.0 equiv) was added under ice-cooling and stirring continued for another two hours. TLC analysis showed the disappearance of the starting material reaction. 60 mL of water and 90 mL of concentrated aqueous ammonia were added dropwise and stirring continued for half an hour. The reaction solution was extracted with 250 mL of ethyl acetate, and the organic phase was washed with saturated brine, dried, filtered, and concentrated. The crude product was separated and purified by silica gel column chromatography (elution system: dichloromethane / methanol = 50 / 1 to 10 / 1) to obtain compound 8 (4.0 g, 8.78 mmol, 79% yield) as a light yellow oil.

[0148] 1H NMR (400MHz, CDCl3): δ9.22-8.90(m,1H),8.79(s,1H),8.07-8.04(m,2H),8.03(d,J=1. 4Hz,1H),7.65-7.59(m,1H),7.57-7.50(m,2H),4.62-4.50(m,1H),4.42(dd,J=14.3,8. 6Hz,1H),4.24-4.09(m,1H),4.05(d,J=6.3Hz,1H),3.59-3.48(m,1H),3.47-3.35(m,1H ), 2.04-1.98 (m, 1H), 1.31 (d, J = 6.3Hz, 3H), 0.98-0.84 (m, 9H), 0.11 (d, J = 10.1Hz, 5H).

[0149] LC-MS:C 23 H 33 N5O3Si, molecular weight 455.2, 456.3 (M+H).

[0150] 1.8 Preparation of Intermediate 9

[0151] Compound 8 (4.0 g, 8.78 mmol, 1.0 equiv) was placed in a clean, dry reaction flask. 10 mL of pyridine was added under nitrogen, and the pyridine was evaporated at elevated temperature. This process was repeated once to remove water from compound 8. 28 mL of pyridine was added, and 4,4'-bismethoxytrityl chloride (3.27 g, 9.66 mmol, 1.1 equiv) was added under an ice bath. The mixture was warmed to room temperature and stirred for 1 hour. TLC analysis showed the disappearance of compound 8. 150 mL of ethyl acetate was added to the reaction mixture, and the mixture was washed with 200 mL of sodium bicarbonate solution and 150 mL of saturated brine. The organic phase was dried, filtered, and the filtrate was concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 10 / 1 to 0 / 1) to afford compound 9 (5.91 g, 7.8 mmol, 88% yield) as a pale yellow oil.

[0152] 1H NMR (400MHz, CDCl3): δ9.07 (br s,1H),8.82(s,1H),8.04(d,J=7.1Hz,2H),7.80(s,1H),7.65-7.58(m,1H),7.57-7.50(m,2H), 7.28-7.13(m,9H),6.81-6.69(m,4H),4.52-4.43(m,1H),4.25(dd,J=14.2,8.6Hz,1H),4.07(dd ,J=6.3,4.2Hz,1H),3.76(d,J=4.5Hz,6H),3.22(dd,J=9.8,5.4Hz,1H),3.04(dd,J=9.8,6.1Hz, 1H), 2.34 (dd, J=8.1, 4.5Hz, 1H), 1.19 (d, J=6.3Hz, 3H), 0.90-0.77 (m, 9H), 0.07--0.09 (m, 6H).

[0153] LC-MS:C 44 H 51 N5O5Si, molecular weight 757.3, 758.4 (M+H).

[0154] 1.9 Preparation of Intermediate 10

[0155] Compound 9 (3.00 g, 3.96 mmol, 1.0 equiv) was dissolved in tetrahydrofuran. Pyridinium hydrofluoride (2.26 g, 79.2 mmol, 2.1 mL, 20.0 equiv) and imidazole (10.8 g, 158.0 mmol, 40.0 equiv) were added under nitrogen and ice-cooled. The mixture was warmed to room temperature and stirred for 2 hours. LCMS analysis showed the disappearance of compound 9. 50 mL of ethyl acetate was added, and the mixture was washed with 100 mL of sodium bicarbonate solution and 50 mL of saturated brine. The mixture was dried, filtered, and the filtrate was concentrated. The crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 10 / 1 to 0 / 1) to afford compound 10 (2.44 g, 3.79 mmol, 96% yield) as a pale yellow oil.

[0156] 1H NMR (400MHz, DMSO-d6): δ11.16 (br s,1H),8.70(s,1H),8.33(s,1H),8.05(d,J=7.4Hz,2H),7.69-7.61(m,1H),7.60-7.5 2(m,2H),7.25-7.12(m,5H),7.05(t,J=8.9Hz,4H),6.78(dd,J=8.9,3.1Hz,4H),4.79( d,J=4.0Hz,1H),4.51-4.28(m,2H),3.81(d,J=4.0Hz,1H),3.70(s,6H),3.10(dd,J=9 .8, 4.9Hz, 1H), 2.89 (dd, J = 9.7, 5.1Hz, 1H), 2.37-2.23 (m, 1H), 1.03 (d, J = 6.3Hz, 3H).

[0157] LC-MS:C 38 H 37 N5O5, molecular weight 643.2, 644.2 (M+H).

[0158] 1.10Synthesis of SA000001

[0159] Compound 10 (1.5 g, 2.33 mmol, 1.0 equiv) was placed in a clean, dry reaction flask. 4 mL of acetonitrile was added under nitrogen. The temperature was raised to 35-40°C and the acetonitrile was evaporated. This process was repeated once to remove the water from compound 10. 15 mL of anhydrous dichloromethane was added to the reaction flask at room temperature. Compound 11-1 (1.05 g, 3.5 mmol, 1.11 mL, 1.5 equiv) and 4,5-dicyanimidazole (358 mg, 3.03 mmol, 1.3 equiv) were then added and stirred at room temperature for one hour. TLC analysis showed the disappearance of compound 10. 30 mL of dichloromethane was added, and the mixture was washed with sodium bicarbonate solution (50 mL x 2) and saturated brine (50 mL). The organic phase was dried, filtered, and the filtrate was concentrated. The resulting crude product was dissolved in 50 mL of methyl tert-butyl ether, and 100 mL of 1% aqueous sodium hydroxide solution was added. The mixture was stirred for half an hour. The organic phase was collected after standing and stratification, washed with saturated brine, dried, filtered, and concentrated. The crude product was purified by C18 reverse phase column to obtain a light yellow product SA000001 (1.1 g, 1.3 mmol, 56% yield).

[0160] 1H NMR(400MHz,CD3CN): δ9.33(br s,1H),8.61(br s,1H),7.99(d,J=11.0Hz,3H),7.67-7.60(m,1H),7.59-7.49(m,2H),7.32-6.99(m,9H), 6.75(td,J=9.2,6.5Hz,4H),4.50-4.38(m,1H),4.36-4.13(m,2H),3.72(dd,J=4.8,1.5H z,6H),3.66-3.45(m,3H),3.25(td,J=9.6,5.4Hz,1H),3.01(ddd,J=17.9,10.0,5.8Hz,1 H),2.62(t,J=5.9Hz,1H),2.53(t,J=5.9Hz,1H),1.32-1.22(m,4H),1.17-1.05(m,12H). 31 P NMR (DMSO-d6, 162MHz): δppm 147.7, 146.8.

[0161] LCMS:C 47 H 54 N7O6P, molecular weight 843.3, 844.5 (M+H).

[0162] Example 2 Preparation of Compound SA000014

[0163] 2.1 Synthesis of Compound 1-2

[0164] At -78°C under argon, a 2.5M solution of butyllithium in tetrahydrofuran (355.5 mL, 2.1 equiv) was slowly added dropwise to a solution of DIEA (85.7 g, 846.5 mmol, 119.6 mL, 2.0 equiv) in tetrahydrofuran (1.85 L). After the addition was complete, stirring was continued at -78°C for one hour. Subsequently, a solution of compound 1-1 (commercially available from Adamas) (50.0 g, 423.3 mmol, 48.6 mL, 1.0 equiv) in tetrahydrofuran (910.0 mL) was slowly added dropwise to the reaction mixture, and stirring was continued for one hour. HMPA (128.0 g, 714.3 mmol, 125.0 mL, 1.69 equiv) and benzyl chloromethyl ether (92.8 g, 592.6 mmol, 81.8 mL, 1.4 equiv) were then slowly added dropwise to the reaction solution. The temperature was then slowly raised to 0°C and stirred for 3 hours. After completion, the reaction solution was extracted three times with ethyl acetate. The organic phases were combined and dried by spin drying. The crude product was isolated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 30:1 to 19:1) to obtain compound 1-2 (54.0 g, 54% yield) as a yellow oil.

[0165] Compound 1-2 1 H NMR data: (400 MHz, CDCl3) δ 7.37-7.27 (m, 5H), 4.53-4.52 (m, 2H), 4.14 (s, 1H), 3.77-3.72 (m, 6H), 2.78-2.74 (m, 1H), 1.24-1.23 (d, J = 6.4 Hz, 4H).

[0166] Mass spectrometric identification of compound 1-2 (C 13 H 18 O4, molecular weight 238.1, [M+H]=239.2).

[0167] 2.2 Synthesis of Compounds 1-3

[0168] Compound 1-2 (51.0 g, 214.0 mmol) was dissolved in dichloromethane (510.0 mL) at room temperature. Imidazole (36.4 g, 535.1 mmol, 2.5 equiv) and tert-butyldimethylsilyl chloride (48.4 g, 321.0 mmol, 39.5 mL, 1.5 equiv) were then slowly added to the reaction mixture and stirred for 4 hours. After completion, the reaction mixture was extracted three times with saturated sodium bicarbonate solution and dichloromethane. The organic phases were combined and dried by spin drying. The crude product was isolated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 150:1 to 120:1) to obtain compound 1-3 (61.9 g, 82% yield) as a colorless oil.

[0169] Compounds 1-3 1 H NMR data: (400MHz, CDCl3) δ7.34-7.27(m,5H),4.55-4.48(m,2H),4.13-4.07(m,1H),3.72-3.67(m,4H),3.6 0-3.57(m,1H),2.80-2.77(m,1H),1.17-1.59(d,J=6.0Hz,4H),0.86(s,9H),0.05-0.03(d,J=8.8Hz,6H).

[0170] Mass spectrometric identification of compounds 1-3 (C 19 H 32 O4Si, molecular weight 352.1, [M+H]=353.2).

[0171] 2.3 Synthesis of Compounds 1-4

[0172] Compound 1-3 (60.0 g, 170.2 mmol) was dissolved in tetrahydrofuran (600.0 mL) at -78°C. Diisobutylaluminum hydride (1.0 M, 425.5 mL, 2.50 equiv) was then slowly added to the reaction mixture and stirred at -78°C for 2 hours. After completion, the reaction mixture was extracted three times with saturated ammonium chloride solution and ethyl acetate. The organic phases were combined and dried by spin drying. The crude product was isolated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 50:1 to 20:1) to obtain compound 1-4 (21.5 g, 39% reaction yield) as a colorless oil.

[0173] Compounds 1-4 1 H NMR data: (400 MHz, CDCl3) δ 7.28-7.19 (m, 5H), 4.46-4.44 (m, 2H), 4.13-4.10 (m, 1H), 3.95-3.91 (m, 1H), 3.67-3.55 (m, 3H), 3.03-3.01 (m, 1H), 1.70-1.63 (m, 1H), 1.17-1.09 (m, 3H), 0.83-0.78 (m, 9H), 0.02 (d, J = 5.2 Hz, 6H).

[0174] Mass spectrometric identification of compounds 1-4 (C 18 H 32 O3Si, molecular weight 324.1, [M+H]=325.2).

[0175] 2.4 Synthesis of Compounds 1-5

[0176] Compound 1-4 (5.5 g, 16.9 mmol), 2-amino-6-chloropurine (4.3 g, 25.4 mmol, 1.5 equiv), and triphenylphosphine (6.8 g, 25.9 mmol, 1.53 equiv) were dissolved in tetrahydrofuran (93.0 mL) at room temperature under nitrogen. Diisopropyl azodicarboxylate (5.4 g, 26.6 mmol, 5.16 mL, 1.57 equiv) was then slowly added to the reaction mixture in an ice-water bath. The reaction mixture was stirred at room temperature for 5 hours. After completion, the reaction mixture was extracted three times with saturated ammonium chloride solution and ethyl acetate. The organic phases were combined and dried by spin drying. The crude product was isolated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 10:1 to 3:1) to obtain compound 1-5 (7.6 g, 95% yield) as a yellow oil.

[0177] Compounds 1-5 1 H NMR data: (400MHz, CDCl3) δ7.51(s,1H),7.16-7.08(m,5H),4.99(s,2H),4.83-4.77(m,7H),4.26-4.12(m,2H),3.97-3.85(m,3H),3.67-3.55(m,3 H),3.23-3.09(m,2H),2.05-2.00(m,1H),1.87(s,2H),1.09(d,J=6.4Hz ,19H),1.01(d,J=6.4Hz,3H),0.74-0.70(m,9H),0.01(d,J=14.0Hz,6H).

[0178] Mass spectrometric identification of compounds 1-5 (C 23 H 34 ClN5O2Si, molecular weight 475.1, [M+H]=476.2).

[0179] 2.5 Synthesis of Compounds 1-6

[0180] Compound 1-5 (11.0 g, 23.1 mmol) was dissolved in pyridine (110.0 mL) at room temperature. Isobutyryl chloride (3.69 g, 34.66 mmol, 3.63 mL, 1.5 equiv) was slowly added to the reaction solution, which was then stirred at room temperature for 3 hours. After completion of the reaction, the pyridine solvent was removed by distillation under reduced pressure. The remaining solution was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and dried by spin drying to obtain a crude product, compound 1-6 (22.0 g), as a light brown oil, which was used directly in the next reaction.

[0181] Mass spectrometric identification of compounds 1-6 (C27 H 40 ClN5O3Si, molecular weight 545.1, [M+H]=546.3).

[0182] 2.6 Synthesis of Compounds 1-7

[0183] Compound 1-6 (10.0 g, 18.3 mmol) was dissolved in trifluoroacetic acid (111.1 mL) and water (35.0 mL) at room temperature, and the reaction mixture was stirred at 35°C for 12 hours. After completion of the reaction, water and trifluoroacetic acid were removed by distillation under reduced pressure. The remaining solution was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and dried by spin drying. The resulting crude product was isolated and purified by silica gel column chromatography (dichloromethane / methanol 100:1 to 25:1) to obtain compound 1-7 (4.8 g, reaction yield 27%) as a white solid.

[0184] Compounds 1-7 1 H NMR data: (400 MHz, CDCl3) δ 12.0 (s, 1H), 11.6 (s, 1H), 7.91 (s, 1H), 7.28-7.18 (m, 5H), 4.80 (d, J = 4.40 Hz, 1H), 4.35-4.23 (m, 3H), 4.15-4.09 (m, 1H), 3.77-3.73 (m, 1H), 3.32-3.27 (m, 2H), 3.23-3.09 (m, 2H), 2.83-2.76 (m, 1H), 2.18-2.15 (m, 1H), 1.13-1.10 (m, 9H).

[0185] Mass spectrometric identification of compounds 1-7 (C 21 H 27 N5O4, molecular weight 413.1, [M+H]=414.2).

[0186] 2.7 Synthesis of Compounds 1-8

[0187] Compound 1-7 (4.3 g, 10.4 mmol) was dissolved in methanol (43.0 mL) under hydrogen (50 psi) at room temperature. Trifluoroacetic acid (592.9 mg, 5.2 mmol, 0.38 mL, 0.5 equiv) and palladium on carbon (2.69 g, 2.53 mmol, 2.43 equiv) were added to the reaction mixture. The reaction mixture was stirred at 30°C for 16 hours. After completion of the reaction, the palladium on carbon was removed by filtration, and the remaining solution was distilled under reduced pressure to afford the crude product, compound 1-8, as a white solid (3.0 g, 87% yield).

[0188] Compounds 1-81 H NMR data: (400 MHz, DMSO-d6) δ 12.1 (s, 1H), 11.6 (s, 1H), 7.95 (s, 1H), 4.26-4.05 (m, 2H), 3.74-3.71 (m, 1H), 3.29 (d, J = 4.8 Hz, 2H), 2.82-2.75 (m, 1H), 1.94-1.90 (m, 1H), 1.13-1.10 (m, 9H).

[0189] Mass spectrometric identification of compounds 1-8 (C 14 H 21 N5O4, molecular weight 323.1, [M+H]=324.2).

[0190] 2.8 Synthesis of Compounds 1-9

[0191] Compound 1-8 (3.0 g, 9.28 mmol) was dissolved in pyridine (30.0 mL) at room temperature. 4,4'-Bismethoxytrityl chloride (3.46 g, 10.2 mmol, 1.1 equiv) was added to the reaction mixture in an ice-water bath. The reaction mixture was then stirred at 15°C for 2 hours. After completion of the reaction, the pyridine solvent was removed by distillation under reduced pressure. The remaining mixture was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and dried by spin drying. The resulting crude product was isolated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 3:1 to 0:1) to obtain compound 1-9 (3.5 g, 59% reaction yield) as a white solid.

[0192] Compounds 1-9 1 H NMR data: (400MHz, DMSO-d6) δ12.0(s,1H),11.5(s,1H),7.87(s,1H),7.22-7.14(m,5H),7.04(t,J=8.8Hz,4H),6.78-6.74(m,4H),4.75( d,J=3.6Hz,1H),4.25-4.21(m,1H),4.09-4.01(m,1H),3.71(d,J=1.2Hz,1H),3.07-3.04(m,1H),2.24-2.22(m,1H),1.13-1.06(m,9H).

[0193] Mass spectrometric identification of compounds 1-9 (C 35 H 39 N5O6, molecular weight 625.1, [M+H]=626.4).

[0194] 2.9 Synthesis of compound SA000014

[0195] Compound 1-9 (3.0 g, 4.79 mmol) was dissolved in dry acetonitrile (4.0 mL) at room temperature under nitrogen atmosphere, followed by distillation under reduced pressure to remove the acetonitrile three times. The remaining solution was dissolved in dichloromethane (30.0 mL), and 4,5-dicyanoimidazole (736.1 mg, 6.23 mmol, 1.3 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (2.17 g, 7.19 mmol, 2.28 mL, 1.5 equiv) were added to the reaction mixture. The reaction mixture was stirred at 15°C for 1 hour. After completion, the reaction mixture was dissolved in dichloromethane (12.0 mL) and 1% sodium hydroxide solution (40.0 mL) and stirred at 15°C for another 0.5 hour. The crude product was purified by C18 reverse-phase column chromatography to afford compound SA000014 (2.2 g, 53% yield) as a white solid.

[0196] 1H NMR data of compound SA000014: (400 MHz, CD3CN) δ 11.86 (s, 1H), 9.58 (s, 1H), 7.58-7.54 (m, 1H), 7.29-7.15 (m, 9H), 6.76 (s, 4H), 4.24-4.05 (m, 3H), 3.73-3.52 (m, 10H), 3.24-3.22 (m, 1H), 3.02-2.94 (m, 1H), 2.86-2.72 (m, 4H), 1.25-1.03 (m, 23H). 31 P NMR data: (400 MHz, CD3CN) δ 147.6, 146.8.

[0197] Mass spectrometric identification of compound SA000014 (C 44 H 56 N7O7P, molecular weight 825.1, [M+H]=826.5).

[0198] Example 3 Preparation of Compound SA000015

[0199] 3.1 Synthesis of Compound C-1

[0200] Compound 3-2 (8.5 g, 20.3 mmol, prepared by Example 5) and 1,2,4-triazole (19.5 g, 282.0 mmol, 13.9 equiv) were dissolved in pyridine (128.0 mL) at room temperature, and then 4-chlorophenyl dichlorophosphate (56.9 mmol, 9.25 mL, 2.8 equiv) was added dropwise to the reaction system under ice-water bath conditions. The reaction solution was stirred at 30 ° C for 16 hours. After the reaction was completed, the solvent pyridine was distilled off under reduced pressure, and the remaining system was extracted with water and ethyl acetate 3 times. The organic phases were combined and dried to obtain a crude product compound C-1 (9.5 g) as a yellow oil, which was directly used in the next reaction. Mass spectrometric identification of compound C-1 (C 24 H 35 N5O3Si, molecular weight 469.1, [M+H]=470.3).

[0201] 3.2 Synthesis of compound C-2

[0202] Compound C-1 (9.5 g, 20.2 mmol) was dissolved in 1,4-dioxane (95.0 mL) at room temperature. Aqueous ammonia (1.38 mol, 212.1 mL, 25% purity, 68.0 equiv) was then added to the reaction mixture. The reaction mixture was stirred at 30°C for 16 hours. After completion of the reaction, the solvent was removed by distillation under reduced pressure. The remaining solution was extracted three times with water and dichloromethane. The organic phases were combined and dried to afford crude compound C-2 (8.5 g) as a yellow solid, which was used directly in the next reaction.

[0203] Mass spectrometric identification of compound C-2 (C 22 H 35 N3O3Si, molecular weight 417.1, [M+H]=418.2).

[0204] 3.3 Synthesis of compound C-3

[0205] Compound C-2 (8.5 g, 20.2 mmol) was dissolved in N,N-dimethylformamide (85.0 mL) at room temperature, followed by the slow addition of acetic anhydride (3.1 g, 30.4 mmol, 2.85 mL, 1.5 equiv) to the reaction mixture. The reaction mixture was stirred at 30°C for 3 hours. After completion of the reaction, the solvent was removed by distillation under reduced pressure. The remaining mixture was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and dried by spin drying. The resulting crude product was isolated and purified using silica gel column chromatography (dichloromethane / methanol 1:0 to 100:1) to obtain Compound C-3 (4.2 g, 43% reaction yield) as a yellow solid.

[0206] Compound C-3 1 H NMR data: (400 MHz, DMSO-d6) δ 10.7 (s, 1H), 7.79 (d, J = 7.2 Hz, 1H), 7.29 (m, 5H), 7.08 (d, J = 7.2 Hz, 1H), 4.36 (d, J = 1.2 Hz, 2H), 4.05-3.99 (m, 2H), 3.72-3.67 (m, 1H), 3.39 (dd, J = 6.4 Hz, 2H), 2.15-2.08 (m, 1H), 2.08 (s, 3H), 1.15 (d, J = 6.4 Hz, 3H), 0.85 (s, 9H), 0.02 (d, J = 6.8 Hz, 6H).

[0207] Mass spectrometric identification of compound C-3 (C 24 H 37 N3O4Si, molecular weight 459.1, [M+H]=460.2).

[0208] 3.4 Synthesis of Compound C-4

[0209] Compound C-3 (4.3 g, 9.35 mmol) was dissolved in dichloromethane (46.0 mL) at -78°C, followed by the slow addition of boron trichloride (1.0 M in DCM, 46.8 mL, 5.0 equiv) to the reaction mixture. The reaction mixture was stirred at -78°C for 4 hours. After completion, the reaction was quenched with triethylamine (40.0 mL) and methanol (88.0 mL). The remaining mixture was extracted three times with water and dichloromethane. The organic phases were combined and dried by vortexing. The resulting crude product was purified by C18 reverse-phase column chromatography to afford compound C-4 (0.96 g, 40% yield) as a white solid.

[0210] Compound C-4 1 H NMR data: (400 MHz, DMSO-d6) δ10.7 (s, 1H), 8.01 (d, J = 7.2 Hz, 1H), 7.12 (d, J = 7.2 Hz, 1H), 4.60 (d, J = 4.8 Hz, 2H), 4.53-4.50 (m, 1H), 4.00-3.99 (m, 1H), 3.75-3.70 (m, 2H), 3.37-3.32 (m, 2H), 2.08 (s, 3H), 1.81-1.77 (m, 1H), 1.01 (d, J = 6.4 Hz, 3H).

[0211] Mass spectrometric identification of compound C-4 (C 11 H 17 N3O4, molecular weight 255.1, [M+H]=256.2).

[0212] 3.5 Synthesis of Compound C-5

[0213] Compound C-4 (1.5 g, 5.88 mmol) was dissolved in pyridine (10.0 mL) at room temperature. 4,4'-Bismethoxytrityl chloride (2.4 g, 7.05 mmol, 1.2 equiv) was added to the reaction mixture under ice-water bath conditions. The reaction mixture was then stirred at room temperature for 4 hours. After completion of the reaction, the pyridine solvent was removed by distillation under reduced pressure. The remaining mixture was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and dried by spin drying. The resulting crude product was isolated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 4:1 to 0:1) to obtain compound C-5 (0.7 g, 70% reaction yield) as a white solid.

[0214] Compound C-5 1 H NMR data: (400MHz, CDCl3) δ9.71 (s, 1H), 7.39 (d, J = 7.3Hz, 3H), 7.35-7.21 (m, 7H) ,7.06(d,J=7.1Hz,1H),6.85(d,J=8.8Hz,4H),4.71(d,J=3.3Hz,1H),4.43(dd,J =13.8,4.5Hz,1H),4.23-3.99(m,2H),3.80(s,6H),3.50-3.38(m,1H),3.31(dd ,J=10.0,4.1Hz,1H),2.69(t,J=9.4Hz,1H),2.21(s,3H),1.08(d,J=6.1Hz,3H).

[0215] Mass spectrometric identification of compound C-5 (C 32 H 35 N3O6, molecular weight 557.1, [M+H]=558.4).

[0216] 3.6 Synthesis of compound SA000015

[0217] Compound C-5 (2.0 g, 3.59 mmol) was dissolved in dichloromethane (20.0 mL) at room temperature under nitrogen. 4,5-Dicyanoimidazole (466.0 mg, 3.95 mmol, 1.1 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.4 g, 4.66 mmol, 1.48 mL, 1.3 equiv) were added to the reaction system. The reaction solution was then stirred at room temperature for 2 hours. After completion, the reaction solution was dissolved in methyl tert-butyl ether (10.0 mL) and 1% sodium hydroxide solution (10.0 mL) and stirred at room temperature for another 0.5 hour. The remaining solution was extracted three times with saturated sodium bicarbonate solution and dichloromethane. The organic phases were combined and dried by vortexing. The resulting crude product was purified by C18 reverse-phase column to afford compound SA000015 (1.5 g, 55% yield) as a white solid.

[0218] 1H NMR data of compound SA000015: (400 MHz, CD3CN) δ 9.15 (s, 1H), 7.50-7.18 (m, 11H), 6.84-6.80 (m, 4H), 4.22-4.08 (m, 2H), 3.75-3.22 (m, 11H), 3.23-3.22 (m, 2H), 2.62-2.51 (m, 2H), 2.38-2.35 (m, 1H), 2.12 (s, 3H), 1.022-1.07 (m, 15H). 31 P NMR data: (400 MHz, CD3CN) δ 147.5, 146.7.

[0219] Mass spectrometric identification of compound SA000015 (C 41 H 52 N5O7P, molecular weight 757.1, [M+H]=758.5).

[0220] Example 4 Preparation of Compound SA000016

[0221] 4.1 Synthesis of Compound 3-1

[0222] Compound 1-4 (9.99 g, 30.8 mmol), compound U-1 (commercially available, purchased from Shanghai Haohong Biopharmaceutical Technology Co., Ltd.) (9.33 g, 43.1 mmol, 1.4 equiv), and triphenylphosphine (16.6 g, 63.2 mmol, 2.0 equiv) were dissolved in dry tetrahydrofuran (350.0 mL) in an ice-water bath. Diisopropyl azodicarboxylate (13.1 g, 64.7 mmol, 12.6 mL, 2.1 equiv) was then added dropwise to the reaction system. The reaction solution was then stirred at room temperature for 2 hours. After completion, the reaction solution was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and dried by spin drying. The crude product was isolated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 10:1 to 8:1) to obtain compound 3-1 (16.1 g, 99% reaction yield) as a white solid.

[0223] Compound 3-1 1 H NMR data: (400 MHz, DMSO-d6) δ 7.89-7.74 (m, 4H), 7.56-7.53 (m, 2H), 7.33-7.29 (m, 5H), 5.80-5.73 (m, 1H), 4.46-4.38 (m, 2H), 4.00-3.91 (m, 2H), 3.60-3.50 (m, 1H), 3.49-3.43 (m, 2H) 2.17-1.98 (m, 1H), 1.13 (s, 3H), 0.83 (s, 9H), 0.01 (d, J = 6.0 Hz, 6H).

[0224] Mass spectrometric identification of compound 3-1 (C 29 H 38 N2O5Si, molecular weight 522.1, [M+H]=523.2).

[0225] 4.2 Synthesis of compound 3-2

[0226] Compound 3-1 (8.05 g, 15.4 mmol) was dissolved in methanol (160.0 mL) at room temperature, and sodium methoxide (2.77 g, 15.4 mmol, 30% purity, 1.0 equiv) was slowly added to the reaction system. The reaction solution was then stirred at room temperature for 12 hours. After completion of the reaction, the methanol solvent was removed by distillation under reduced pressure. The remaining solution was extracted three times with 1M hydrochloric acid solution and ethyl acetate. The organic phases were combined and dried by spin drying. The resulting crude product was isolated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 10:1 to 0:1) to obtain compound 3-2 (6.1 g, reaction yield 94%) as a white solid.

[0227] Compound 3-21 H NMR data: (400 MHz, DMSO-d6) δ 11.1 (s, 1H), 7.48 (d, J = 8.0 Hz, 1H), 7.30-7.24 (m, 5H), 5.47-5.44 (m, 1H), 4.45-4.35 (m, 2H), 3.98-3.94 (m, 1H), 3.79-3.78 (m, 1H), 3.63-3.57 (m, 1H), 3.38-3.35 (m, 2H), 2.04-1.95 (m, 1H), 1.10 (s, 3H), 0.83 (s, 9H), 0.01 (d, J = 6.0 Hz, 6H).

[0228] Mass spectrometric identification of compound 3-2 (C 22 H 34 N2O4Si, molecular weight 418.1, [M+H]=418.2).

[0229] 4.3 Synthesis of Compound 3-3

[0230] Compound 3-2 (4.0 g, 9.56 mmol) was dissolved in dichloromethane (30.0 mL) at -70°C, and boron trichloride (1.0 M in DCM, 66.9 mL, 7.0 equiv) was slowly added to the reaction system. The reaction solution was then stirred at -70°C for 3 hours. After completion, the reaction was quenched with triethylamine (5.0 mL) and methanol (30.0 mL). The remaining solution was extracted three times with water and dichloromethane. The organic phases were combined and dried by spin drying. The resulting crude product was purified by C18 reverse-phase column to afford compound 3-3 (0.7 g, 33% reaction yield) as a white solid.

[0231] Compound 3-3 1 H NMR data: (400 MHz, DMSO-d6) δ7.54 (d, J = 8.0 Hz, 1H), 5.51 (d, J = 7.6 Hz, 1H), 3.88-3.84 (m, 1H), 3.72-3.70 (m, 1H), 3.61-3.59 (m, 2H), 1.75-1.68 (m, 1H), 1.09 (d, J = 6.4 Hz, 3H).

[0232] Mass spectrometric identification of compound 3-3 (C9H 14 N2O4, molecular weight 214.1, [M+H]=215.2).

[0233] 4.4 Synthesis of Compound 3-4

[0234] Compound 3-1 (0.4 g, 1.87 mmol) was dissolved in pyridine (4.0 mL) at room temperature. 4,4'-Bismethoxytrityl chloride (949.0 mg, 2.8 mmol, 1.5 equiv) was added to the reaction mixture under ice-water bath conditions. The reaction mixture was then stirred at room temperature for 2 hours. After completion of the reaction, the pyridine solvent was removed by distillation under reduced pressure. The remaining mixture was extracted three times with saturated sodium bicarbonate solution and ethyl acetate. The organic phases were combined and dried by spin drying. The resulting crude product was isolated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 4:1 to 0:1) to obtain compound 3-4 (0.7 g, 70% reaction yield) as a white solid.

[0235] Compound 3-4 1 H NMR data: (400MHz, DMSO-d6) δ11.3(s,1H),7.37(d,J=8.0Hz,1H),7.33-7.29(m,4H),7.20-7.17(m,5H),6.86-6.83(m,4H),5.40(d,J=8.0H z,1H),4.61(d,J=4.8Hz,2H),3.83-3.79(m,2H),3.72(s,6H),3.71-3.68(m,1H),3.08-2.90(m,2H),1.90(s,1H),1.01(d,J=6.4Hz,3H).

[0236] Mass spectrometric identification of compound 3-4 (C 30 H 32 N2O6, molecular weight 516.1, [M+H]=517.4).

[0237] 4.5 Synthesis of compound SA000016

[0238] Compound 3-4 (1.2 g, 2.32 mmol) was dissolved in dichloromethane (12.0 mL) at room temperature under nitrogen. 4,5-Dicyanoimidazole (357.0 mg, 3.02 mmol, 1.3 equiv) and bis(diisopropylamino)(2-cyanoethoxy)phosphine (1.05 g, 3.48 mmol, 1.5 equiv) were added to the reaction system. The reaction solution was then stirred at room temperature for 2 hours. After completion, the reaction solution was dissolved in methyl tert-butyl ether (10.0 mL) and 1% sodium hydroxide solution (10.0 mL) and stirred at room temperature for another 0.5 hour. The remaining solution was extracted three times with ethyl acetate. The organic phases were combined and dried by vortexing. The resulting crude product was purified by C18 reverse-phase column to afford compound SA000016 (1.2 g, 71% yield) as a white solid.

[0239] Compound SA000016 1 H NMR data: (400 MHz, CD3CN) δ9.39 (s, 1H), 7.39-7.24 (m, 10H), 6.85-6.81 (m, 4H), 5.43-5.39 (m, 1H), 4.21-4.18 (m, 1H), 3.86-3.77 (m, 1H), 3.75 (s, 6H), 3.56-3.53 (m, 5H), 3.28-3.05 (m, 2H), 2.62-2.61 (m, 2H), 2.22-2.19 (m, 2H), 1.22-1.07 (m, 15H). 31 P NMR data: (400 MHz, CD3CN) δ 147.6, 146.5.

[0240] Mass spectrometric identification of compound SA000016 (C 39 H 49 N4O7P, molecular weight 716.1, [M+H]=717.5).

[0241] 4.6 Synthesis of Tgo Monomer

[0242] According to the synthesis method of Example Ugo, a white solid Tgo (4.8 g, 6.6 mmol, 74% yield) was prepared. The molecular formula of compound Tgo is: C 40 H 51 O7N4P, molecular weight: 730.3, LC-MS found 753.4 (M+Na). 1 H NMR (400MHz, DMSO-d6): δ11.75(d,J=215.2Hz,1H),7.90(d,J=4.6Hz,1H),7.23–7.22(m,4H),7.20–7 .14(m,1H),7.09(td,J=7.1,3.5Hz,4H),7.23–7.22(m,4H),4.23(dd,J=13.9,5.2Hz,1H),4.14–3.99( m,2H),3.71(s,6H),3.59–3.53(m,1H),3.51–3.43(m,2H),3.13(td,J=9.4,5.5Hz,1H),3.05–2.93(m ,1H),2.82(dt,J=13.5,6.8Hz,1H),2.73(t,J=5.9Hz,1H),2.65(t,J=5.8Hz,1H),1.26–0.98(m,19H). 31 P NMR (162MHz, DMSO-d6): δ 147.0, 146.6.

[0243] Example 5 Preparation of compound SA000068 (Ggs)

[0244] 5.1 Preparation of Intermediate 1-2

[0245] Compound 1-1 (45.7 mmol, 10.9 g) was placed in a clean, dry reaction flask, and 110 mL of methanol was added. Palladium on carbon (wet basis, 10% Pd / C) (22% wt, 2.4 g) was then added under hydrogen at room temperature. Stirring was continued at room temperature for 16 hours. After the reaction, the palladium on carbon was removed by filtration, and the filtrate was concentrated to obtain a crude oil, compound 1-2 (6.8 g, 45.7 mmol, 100% yield), which was used directly in the next reaction without purification. Compound 1-2 molecular formula: C6H 12 O4, molecular weight: 148.07, LC-MS measured: 149.2 (M+H).

[0246] 5.2 Preparation of Intermediates 1-3

[0247] Compound 1-2 (45.7 mmol, 6.8 g) was placed in a clean, dry reaction flask, and 70 mL of acetonitrile and imidazole (6.0 equiv, 274.2 mmol, 18.67 g) were added. TBSCl (3.0 equiv, 137.1 mmol, 20.66 g) was slowly added in portions under an ice-water bath, and then stirred at room temperature for 16 hours. After the reaction, the solvent was concentrated to remove most of the solvent, dissolved in 200 mL of ethyl acetate, washed with 200 mL of water, dried, and dried. The resulting crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0 to 100 / 5) to obtain compound 1-3 (15.8 g, 41.9 mmol, 92% yield) as a light yellow oil. Compound 1-3 molecular formula: C 18 H 40 O4Si2, molecular weight: 376.25, LC-MS measured: 377.3 (M+H).

[0248] 5.3 Preparation of Intermediates 1-4

[0249] Under argon protection, compound 1-3 (41.9 mmol, 15.8 g) was placed in a clean, dry reaction flask, and 158 mL of tetrahydrofuran was added to dissolve it. The temperature was cooled to -78°C, and DIBAL-H (2.2 equiv, 92.3 mmol, 92.3 mL) was added dropwise while maintaining the temperature below -60°C. The temperature was maintained between -70°C and -60°C until the reaction was complete. Saturated ammonium chloride was added dropwise to quench the reaction, and 100 mL of ethyl acetate and 200 mL of potassium sodium tartrate solution were added. The mixture was stirred for 30 minutes, the organic phase was dried, filtered, and concentrated. The crude product was separated and purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0-50 / 50) to obtain compound 1-4 (13.1 g, 37.4 mmol, 89% yield) as a light yellow oil. Compound 1-4 molecular formula: C 17 H 40 O3Si2, molecular weight: 348.25, LC-MS measured: 349.3 (M+H).

[0250] 5.4 Preparation of Intermediates 1-5

[0251] Compound 1-4 (37.3 mmol, 13.0 g) was placed in a clean, dry reaction flask, and 130 mL of tetrahydrofuran was added. A purine intermediate (1.1 equiv, 41.0 mmol, 22.6 g) and triphenylphosphine (1.5 equiv, 55.9 mmol, 11.3 g) were added at room temperature. The temperature was lowered to below 0°C, and DIPAD (1.5 equiv, 55.9 mmol, 14.7 g) was added dropwise. Stirring was continued at room temperature for 2 hours. After the reaction, the reaction solution was concentrated, and the crude product was purified by silica gel column chromatography (gradient elution: petroleum ether / ethyl acetate = 100 / 0 to 30 / 70) to obtain compound 1-5 (32.3 g, 36.6 mmol, 98% yield) as a light yellow oil. Compound 1-5 molecular formula: C 42 H 76 N6O 10 Si2, molecular weight: 880.52, LC-MS measured: 881.7 (M+H).

[0252] 5.5 Preparation of Intermediates 1-6

[0253] Compound 1-5 (25.0 mmol, 22.0 g) was placed in a clean, dry reaction flask, and 66 mL of trifluoroacetic acid and 22 mL of water were added. The mixture was stirred at room temperature for 2 h. The solvent was removed by concentration, and 30 mL of acetonitrile and 30 mL of water were added. The mixture was stirred for 2 h, filtered, and dried to obtain the target product 1-6 as a white solid (6.3 g, 17.2 mmol, 69% yield). Compound 1-6 Molecular Formula: C 10 H 16N6O2, molecular weight: 252.13, LC-MS measured: 253.2 (M+H).

[0254] 5.6 Preparation of Intermediates 1-7

[0255] Compound 1-6 (17.2 mmol, 6.3 g) was dissolved in 120 mL of water and heated to 50°C. A 30 mL aqueous solution of sodium nitrite (3.0 equiv, 51.6 mmol, 3.56 g) was added dropwise to the mixture, followed by acetic acid (7.0 equiv, 120.4 mmol, 7.2 g). The mixture was stirred for 10 minutes. The temperature was lowered and aqueous ammonia was added dropwise to adjust the pH to 8. The crude product was concentrated and purified by a C18 reverse phase column to obtain 1-7 (4.2 g, 16.6 mmol, 66% yield) as a white solid. Compound 1-7 molecular formula: C 10 H 15 N5O3, molecular weight: 253.12, LC-MS measured: 254.2 (M+H).

[0256] 5.7 Preparation of Intermediates 1-8

[0257] Compound 1-7 (25.3 mmol, 6.4 g) was placed in a clean, dry reaction flask, and 128 mL of methanol and N,N-dimethylformamide dimethyl acetal (3.0 equiv, 75.9 mmol, 9.1 g) were added. Stir at room temperature overnight. After the reaction, the product was concentrated directly to obtain an off-white powder 1-8 (7.6 g, 24.6 mmol, 98% yield), which was used directly in the next reaction without purification. Compound 1-8 Molecular formula: C 13 H 20 N6O3, molecular weight: 308.16, LC-MS measured: 309.2 (M+H).

[0258] 5.8 Preparation of Intermediates 1-9

[0259] Compound 1-8 (24.6 mmol, 7.6 g) was placed in a clean, dry reaction flask, and 260 mL of pyridine and N,N-diisopropylethylamine (1.5 equiv, 37.1 mmol, 4.8 g) were added. Diphenylcarbamoyl chloride (1.5 equiv, 37.1 mmol, 8.57 g) was added under ice-cooling, and the mixture was stirred at room temperature for 1 h. After the reaction, 100 mL of saturated sodium bicarbonate solution was added dropwise to quench the reaction. The mixture was extracted with dichloromethane, dried over anhydrous sodium sulfate, and concentrated. The crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 0-90 / 10) to obtain compound 1-9 (8.6 g, 17.1 mmol, 69% yield) as an off-white solid. Compound 1-9 Molecular formula: C26 H 29 N7O4, molecular weight: 503.23, LC-MS measured: 504.3 (M+H).

[0260] 5.9 Preparation of Intermediate 1-10

[0261] 1-9 (17.1 mmol, 8.6 g) was placed in a clean, dry reaction flask, 86 mL of pyridine was added, and 4,4'-bismethoxytrityl chloride (1.3 equiv, 22.2 mmol, 7.5 g) was added at room temperature. Stirring was then continued at room temperature for 1 hour. After the reaction, most of the solvent was removed by concentration, 100 mL of ethyl acetate was added, and the mixture was washed with 100 mL of saturated sodium bicarbonate solution and 100 mL of saturated brine. The organic phase was dried, filtered, and concentrated. The resulting crude product was purified by silica gel column chromatography (gradient elution: dichloromethane / methanol = 100 / 0-90 / 10) to obtain a light yellow solid 1-10 (7.1 g, 8.8 mmol, 52% yield). Compound 1-10 Molecular formula: C 47 H 47 N7O6, molecular weight: 805.36, LC-MS measured: 806.5 (M+H).

[0262] 5.10 Preparation of compound SA000068 (Ggs)

[0263] 1-10 (1.24 mmol, 1.0 g) was placed in a clean, dry reaction flask and 10 mL of anhydrous dichloromethane was added. 2-Cyanoethyl N,N,N',N'-tetraisopropylphosphorodiamidite (2.0 equiv, 2.48 mmol, 0.75 g) and 4,5-dicyanimidazole (1.5 equiv, 1.86 mmol, 0.22 g) were added at room temperature under argon protection and stirred for one hour at room temperature. After the reaction, 10 mL of dichloromethane was added to the reaction solution and washed with 20 mL of saturated sodium bicarbonate solution. The organic phase was dried, filtered, and concentrated. The crude product was purified by C18 reverse phase column to obtain a white solid SA000068 (0.8 g, 0.8 mmol, 64% yield). Compound SA000068 molecular formula: C 56 H 64 N9O7P, molecular weight: 1005.47, LC-MS measured: 1006.7 (M+H). 1H NMR (400MHz, DMSO) δ8.89(s,1H),8.09(s,1H),7.39(dd,J=8.8,4.5Hz,8H),7.32–7.21(m,4H),7.21–7.11(m,3 H),7.08(ddd,J=8.6,3.8,2.2Hz,4H),6.78–6.70(m,4H),4.45–3.98(m,4H),3.68–3.43(m,4H),3.21(s,3H),3. 14(s,3H),2.91(ddd,J=21.9,9.6,5.5Hz,1H),2.70(t,J=5.9Hz,1H),2.59(ddd,J=11.4,8.6,4.4Hz,2H),1.36– 1.27(m,1H),1.20(dd,J=14.0,6.4Hz,3H),1.10(d,J=6.8Hz,6H),1.02(d,J=6.7Hz,3H),0.95(d,J=6.7Hz,3H). 31 P NMR (162MHz, DMSO) δ 147.06, 146.09.

[0264] Example 6 Preparation of siRNA Conjugates

[0265] Using the solid-phase phosphoramidite method, the specially modified compounds prepared in the above steps and commercially available conventionally modified monomers (purchased from Shanghai Zhaowei Technology Development Co., Ltd.) were used to link nucleoside monomers one by one in the 3'-5' direction according to the nucleotide arrangement order. The specially modified anti-off-target compound was placed in the seed region of the antisense strand (any position 4-8 from the 5' end). Each linking of a nucleoside monomer involved a four-step reaction: deprotection, coupling, capping, and oxidation or sulfurization. Synthesis conditions for the sense and antisense strands were used.

[0266] Instrument model: MerMade 12 Oligonucleotide syntheizer solid phase synthesizer, Beijing Haijing 1ml synthesis column, Si Tuofan SourceTM 15Q 4.6 / 100PE purification column.

[0267] The reagents used to synthesize siRNA conjugates were purchased from Suzhou Kelema.

[0268] The synthesis is briefly described as follows:

[0269] The single-strand synthesis reaction process is extended from 3' to 5' and is completed on a solid phase synthesizer. It includes four main reaction steps:

[0270] a. De-DMT reaction: Use dichloroacetic acid to remove the DMT protecting group on the nucleotide to obtain the 5'-hydroxyl end;

[0271] b. Coupling reaction: The protected nucleotide phosphoramidite monomer is mixed with the activator ethylthiotetrazolium. The phosphoramidite group is activated, and the 5'-hydroxyl group, still protected by DMT, undergoes a condensation reaction with the 5'-hydroxyl group attached to the solid support to form a phosphite triester.

[0272] c. Oxidation reaction: Under the action of iodine, the phosphite triester obtained in the previous condensation reaction is converted into a more stable phosphate ester (i.e., trivalent phosphorus is oxidized to pentavalent phosphorus);

[0273] d. Thio-reaction: Under the action of the thio-reagent PADS, the phosphite triester obtained in the previous condensation reaction is converted into a thiophosphate (oxidation or thio-reaction is selected according to the sequence design).

[0274] e. Capping reaction: There may be a very small number of 5'-hydroxyl groups (less than 2%) that do not participate in the condensation reaction. They are reacted with acetic anhydride and 1-methylimidazole to form acetate end-capping that cannot participate in subsequent reactions, preventing further reactions. This short fragment can be separated during purification.

[0275] Repeat the above four steps until the desired sequence is synthesized. The main chemical reaction equation is as follows

[0276] After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase support is cut, deprotected, purified, desalted, and then freeze-dried to obtain the sense chain and antisense chain, wherein:

[0277] The cleavage and deprotection conditions are as follows: First, prepare the aminolysis solution (a mixture of ammonia and ethanol = 3:1 to a volume of 2 mL), add the solid phase support to the above reaction flask, and shake thoroughly to evenly distribute. Aminolysis is carried out in a constant temperature water bath at 50°C for 16 hours. After 16 hours of aminolysis, the water bath is cooled to a temperature of 25°C ± 2°C, filtered through a fritted funnel, and the filtrate is collected in a round-bottom flask. The residue is rinsed with 50% ethanol aqueous solution, the filtrate is collected, concentrated on a rotary evaporator, and transferred to a glass bottle. A small sample of the crude product is sent to the analytical department for crude LC-MS analysis. The detection method is as follows: A Waters Acquity UPLC-LTQ LCMS (column: ACQUITY UPLC BEH C18) is used to detect the purity of the above sense and antisense chains and analyze the molecular weight. The measured values ​​are consistent with the theoretical values.

[0278] Purification and desalting conditions are as follows: purification using an ion exchange chromatography column and desalting using a Stovepane HiPrep™ 26 / 10 desalting gel column, followed by single-strand lyophilization. After lyophilization, the single-stranded product needs to be sampled for LC-MS analysis.

[0279] Finally, the obtained sense and antisense strands need to be annealed into double strands.

[0280] Annealing was performed as follows: the purified sense and antisense strands were dissolved in water for injection to prepare a 0.1 mg / mL to 40 mg / mL solution. The mixture was then calibrated using a thermometer Nanodrop Eight to determine the molar ratio. The mixture was heated at 90°C for 5 minutes, then cooled naturally to allow hydrogen bonding to form a double-stranded structure. Samples were collected and sent for SEC purity testing. The double-stranded sample was lyophilized.

[0281] Example 7 Preparation of siRNA for ligation delivery conjugate

[0282] 1. Preparation of GalNAc Target Head

[0283] 1. Synthesis of Compound 2

[0284] Compound 1 (30 g, 0.112 mol, CAS: 69555-14-2, commercially available TCI), potassium carbonate (31 g, 0.224 mol), and tetrabutylammonium bromide (3.62 g, 0.011 mol) were added to 600 ml of acetonitrile and mixed well. The mixture was cooled to 0 degrees Celsius and compound 1A (22 g, 0.112 mol, CAS: 17201-43-3, commercially available TCI) was gradually added. The temperature was then gradually raised to 25 degrees Celsius and stirred for 24 hours. After the compound 1 was consumed, the mixture was filtered and the solvent was removed by rotary evaporation by monitoring by thin-layer chromatography. The remaining solid was washed once with 300 ml of 2-mol hydrochloric acid and 300 ml of tetrahydrofuran, respectively, and extracted three times with 300 ml of ethyl acetate. After extraction, the aqueous phase was adjusted to pH 8.0 with sodium carbonate, extracted three times with 300 ml of ethyl acetate again, and the organic phase was washed once with 300 ml of water and separated with a separatory funnel. The ethyl acetate phase was freed from moisture using anhydrous sodium sulfate, and concentrated by rotary evaporation to obtain yellow solid compound 2 (14.1 g, 57.6% yield).

[0285] Compound 2 1 H NMR data: 400 MHz, CDCl 3 7.60 (d, J=8.0 Hz, 2H), 7.34 (d, J=8.0 Hz, 2H), 4.16 (q, J=7.2 Hz, 2H), 3.41-3.34 (m, 1H), 3.16-2.88 (m, 2H), 1.24 (t, J=7.2 Hz, 3H).

[0286] Mass spectrometric identification of compound 2 (C 12 H 14 N2O2, molecular weight 218.1, [M+H]=219.1).

[0287] 2. Synthesis of Compound 3

[0288] Compound 2 was added to 85 ml of water containing 8.46 g (0.212 mol) of sodium hydroxide. After replacing the oxygen in the system with nitrogen, the solution was heated to 100°C and stirred for 4 hours. After compound 2 was completely reacted, the reaction system was cooled to 50°C, the pH was adjusted to 7.0 with 12 M hydrochloric acid, and the temperature was further cooled to 25°C. After stirring for one hour, the solvent was dried at 50°C to obtain a yellow solid 3 (12.2 g, 90.3% yield).

[0289] Compound 3 molecular formula C 10 H 11 NO4, molecular weight 209.1, [M+H]=210.1.

[0290] 3. Synthesis of Compound 3A

[0291] Compound 3A synthesis method: 16.3 g (0.078 mol) of compound 3 was dissolved in 114 ml of methanol. 46.3 g of thionyl chloride (0.39 mol) was added at 0-5 degrees Celsius. The mixture was stirred at 0-5 degrees Celsius for 30 minutes, then heated to 65 degrees Celsius and refluxed for 2 hours. After LCMS analysis confirmed that compound 3 was completely consumed, the reaction system was concentrated and the pH was adjusted to 1-2 with concentrated hydrochloric acid. The reaction system was extracted three times with 20 ml of dichloromethane. The pH of the aqueous phase was adjusted to pH 11-12 with solid potassium carbonate, and then extracted three times with 20 ml of dichloromethane. The organic phases were combined and dried. The resulting solid was separated and purified by silica gel column chromatography (petroleum ether / ethyl acetate 50:1 to 1:1) to obtain 8.1 g of compound 3A as a yellow oil (Rf value 0.3 on TLC in a petroleum ether:ethyl acetate = 1:1 system, reaction yield 43.8%).

[0292] Compound 3A 1 H NMR data: 400 MHz, CDCl 3 7.98 (d, J=8.4 Hz, 2H), 7.28 (d, J=8.4 Hz, 2H), 3.91 (s, 3H), 3.79-3.74 (m, 1H), 3.71 (s, 3H), 3.13 (dd, J=14.4, 5.6 Hz, 1H), 2.92 (dd, J=13.6, 8.0 Hz, 1H).

[0293] Mass spectrometry data of compound 3A: Molecular formula C 12 H 15 NO4, molecular weight 237.1, [M+H]=238.1.

[0294] 4. Synthesis of Compound 4

[0295] 6.7 g of compound 3A (0.028 mol) was dissolved in 34 ml of tetrahydrofuran and then added dropwise to 100 ml of tetrahydrofuran containing 3.22 g of lithium aluminum hydroxide (0.085 mol) (temperature 0-5 degrees Celsius) and stirred at 0-10 degrees Celsius for 1 hour. LCMS monitoring confirmed that compound 3A was consumed and a new compound was produced. After the reaction system was dropwise added 3 ml of termination reaction (temperature 5-15 degrees Celsius), 9 ml of 15% aqueous sodium hydroxide solution, 9 ml of water, and 9 g of sodium sulfate were added sequentially and stirred for 30 minutes. Filtered with diatomaceous earth subsequently, concentrated to give compound 4 (3.8 g, 74.2% yield) as a yellow oil.

[0296] NMR data of compound 4 1 H NMR:400MHz,DMSO-d6 7.32-7.02(m,4H),5.10(s,1H),4.55(s,1H),4.45(s,2H),3.30-3.23(m,1H),3.20-3.1 1(m,1H),2.89-2.78(m,1H),2.64(dd,J=13.2,5.6Hz,1H),2.39(dd,J=13.2,7.6Hz,1H).

[0297] Compound 4 Molecular Formula C 10 H 15 NO2 (molecular weight 181.1, [M+H]=182.2).

[0298] 5. Synthesis of Compound 5

[0299] 9.38 g of compound 4A (0.021 mol) was dissolved in 57 ml of N,N-dimethylformamide, and 4.07 g (0.0315 mol) of DIPEA and 8.74 g of HBTU (0.023 mol) were added. Subsequently, 3.8 g of compound 4 (0.021 mol) was added at 0-10°C, and the mixture was stirred at 0-10°C for 16 hours. The reaction system was filtered, and the filtrate was purified by preparative high performance liquid chromatography (Xtimate C18 preparative column, 250 mm x 80 mm, mobile phase water:acetonitrile = 10%-40%, 21 minutes) to obtain 5 (5.6 g, 43.7% yield) as a white solid.

[0300] NMR data of compound 5 1H NMR:400MHz,DMSO-d6 7.82(d,J=9.2Hz,1H),7.60(d,J=8.4Hz,1H),7.24-7.09(m,4H),5.21(d,J=3.2Hz,1H),5.10 (t,J=5.6Hz,1H),4.96(dt,J=11.2,3.6Hz,1H),4.79-4.71(m,1H),4.52-4.39(m,3H),4.08-3 .96(m,3H),3.93-3.80(m,2H),3.71-3.61(m,1H),3.28-3.20(m,1H),2.87-2.76(m,1H),2.6 1-2.54(m,1H),2.10(s,3H),2.03-1.96(m,5H),1.89(s,3H),1.76(s,3H),1.52-1.27(m,4H).

[0301] Molecular formula of compound 5: C 29 H 42 N2O 12 , molecular weight 610.2, [M+H]=611.2.

[0302] 6. Synthesis of Compound 6

[0303] 5.6 g of compound 5 (9.17 mmol) was added to 50 ml of pyridine, followed by the addition of 3.73 g of 4,4′-bismethoxytrityl chloride (11.0 mmol) at 0-5°C. The reaction was stirred at 25°C for 16 hours. The reaction mixture was filtered, the filtrate was dried, and then separated by preparative HPLC (Waters Xbridge BEH C18 column, 250 mm x 50 mm, 10 μm, mobile phase: water: acetonitrile 45% to 65% over 10 minutes). The purified sample was freeze-dried to yield 1.2 g of 6 (yield 14.3%) as a white solid.

[0304] NMR data of compound 6: 1H NMR:400MHz,DMSO-d6 7.77(dd,J=9.2,3.2Hz,1H),7.58(d,J=8.4Hz,1H),7.42-7.36(m,2H),7.33-7.24(m,6H),7.23-7.17(m,3H),7.17-7. 12(m,2H),6.91-6.84(m,4H),5.21-5.12(m,1H),4.97-4.88(m,1H),4.78-4.69(m,1H),4.43(dd,J=8.4,7.2Hz,1H),4 .03-3.91(m,5H),3.91-3.77(m,2H),3.70(s,6H),3.67-3.57(m,1H),3.38-3.32(m,1H),3.27-3.19(m,1H),2.84-2.7 5(m,1H),2.60-2.51(m,1H),2.08-2.03(m,3H),2.01-1.90(m,5H),1.85(s,3H),1.76-1.67(m,3H),1.47-1.24(m,4H).

[0305] Compound 6 is unstable in aqueous solution and easily degraded, so complete mass spectrometry data of compound 6 cannot be obtained.

[0306] 7. Synthesis of compound SA000004

[0307] 1 g of compound 6 (1.09 mmol) and 1H-imidazole-4,5-dicarbonitrile (194 mg, 1.64 mmol) were added to 1000 ml of dichloromethane. 496 mg of compound 6A (1.64 mmol) was added at 25°C, and the mixture was stirred at 25°C for 16 hours. After TLC monitoring confirmed the complete consumption of compound 6, a new compound was observed. The reaction system was spin-dried and isolated using silica gel column chromatography (petroleum ether:ethyl acetate, 20:1 to 1:1) to obtain 211 mg of white compound SA000004 (yield 17.3%).

[0308] NMR data of compound SA000004 1H NMR:400MHz,CD3CN 7.52-7.45(m,2H),7.40-7.29(m,6H),7.29-7.19(m,5H),6.94-6.83(m,4H),6.53-6.37(m,2H),5.27(d, J=3.2Hz,1H),5.04-4.93(m,1H),4.47(dd,J=15.6,8.4Hz,1H),4.26-4.14(m,1H),4.12-4.01(m,4H),4. 01-3.69(m,11H),3.68-3.34(m,5H),2.96-2.85(m,1H),2.79-2.69(m,1H),2.66(t,J=5.6Hz,2H),2.11- 2.04(m,5H),1.98-1.95(m,3H),1.91(s,3H),1.84-1.79(m,3H),1.63-1.32(m,4H),1.22-1.09(m,12H).

[0309] 2. Preparation of siRNA Conjugates

[0310] Using the solid-phase phosphoramidite method, the specially modified compounds prepared in the above steps and commercially available conventionally modified monomers (purchased from Shanghai Zhaowei Technology Development Co., Ltd.) were used to connect nucleoside monomers one by one from the 3'-5' direction according to the nucleotide arrangement order. The specially modified anti-off-target compound was placed in the seed region of the antisense chain (any position from the 4th to the 8th starting from the 5' end), and the delivery monomer compound was freely set to be placed at the 3' end or the 5' end according to the common monomer. Each connection of a nucleoside monomer included four steps of deprotection, coupling, capping, oxidation or sulfurization. The synthesis conditions used for the sense chain and antisense chain.

[0311] Equipment model: MerMade 12 Oligonucleotide syntheizer solid phase synthesizer, Beijing Haijing 1ml synthesis column, Si Tuofan Source TM 15Q 4.6 / 100PE purification column.

[0312] The reagents used to synthesize siRNA conjugates were purchased from Suzhou Kelema.

[0313] The synthesis is briefly described as follows:

[0314] The single-strand synthesis reaction process is extended from 3' to 5' and is completed on a solid phase synthesizer. It includes four main reaction steps:

[0315] a. De-DMT reaction: Use dichloroacetic acid to remove the DMT protecting group on the nucleotide to obtain the 5'-hydroxyl end;

[0316] b. Coupling reaction: The protected nucleotide phosphoramidite monomer is mixed with the activator ethylthiotetrazolium. The phosphoramidite group is activated, and the 5'-hydroxyl group, still protected by DMT, undergoes a condensation reaction with the 5'-hydroxyl group attached to the solid support to form a phosphite triester.

[0317] c. Oxidation reaction: Under the action of iodine, the phosphite triester obtained in the previous condensation reaction is converted into a more stable phosphate ester (i.e., trivalent phosphorus is oxidized to pentavalent phosphorus);

[0318] d. Thio-reaction: Under the action of the thio-reagent PADS, the phosphite triester obtained in the previous condensation reaction is converted into a thiophosphate (oxidation or thio-reaction is selected according to the sequence design).

[0319] e. Capping reaction: There may be a very small number of 5'-hydroxyl groups (less than 2%) that do not participate in the condensation reaction. They are reacted with acetic anhydride and 1-methylimidazole to form acetate end-capping that cannot participate in subsequent reactions, preventing further reactions. This short fragment can be separated during purification.

[0320] Repeat the above four steps until the desired sequence is synthesized. The main chemical reaction equation is as follows

[0321] After the last nucleoside monomer is connected, the nucleic acid sequence connected to the solid phase support is cut, deprotected, purified, desalted, and then freeze-dried to obtain the sense chain and antisense chain, wherein:

[0322] The cleavage and deprotection conditions are as follows: First, prepare the aminolysis solution (a mixture of ammonia and ethanol = 3:1 to a volume of 2 mL), add the solid phase support to the above reaction flask, and shake thoroughly to evenly distribute. Aminolysis is carried out in a constant temperature water bath at 50°C for 16 hours. After 16 hours of aminolysis, the water bath is cooled to a temperature of 25°C ± 2°C, filtered through a fritted funnel, and the filtrate is collected in a round-bottom flask. The residue is rinsed with 50% ethanol aqueous solution, the filtrate is collected, concentrated on a rotary evaporator, and transferred to a glass bottle. A small sample of the crude product is sent to the analytical department for crude LC-MS analysis. The detection method is as follows: A Waters Acquity UPLC-LTQ LCMS (column: ACQUITY UPLC BEH C18) is used to detect the purity of the above sense and antisense chains and analyze the molecular weight. The measured values ​​are consistent with the theoretical values.

[0323] Purification and desalting conditions are as follows: purification using an ion exchange chromatography column and desalting using a Stovepane HiPrep™ 26 / 10 desalting gel column, followed by single-strand lyophilization. After lyophilization, the single-stranded product is sampled for LC-MS analysis.

[0324] Finally, the obtained sense and antisense strands need to be annealed into double strands.

[0325] Annealing was performed as follows: the purified sense and antisense strands were dissolved in water for injection to prepare a 0.1-40 mg / mL solution. The mixture was then calibrated using a thermoscientific Nanodrop Eight to determine the molar ratio. The mixture was heated at 90°C for 5 minutes, then allowed to cool naturally to form a double-stranded structure through hydrogen bonding. Samples were then collected and sent for SEC purity testing. The double-stranded sample was lyophilized.

[0326] Example 8 In vitro evaluation of on-target and off-target activity of Safe01

[0327] In this example, the effects of the chemical modification shown in (II) at nucleotide position 6 or 7 in the 5' region of different antisense strands on the on-target activity and anti-off-target activity of siRNA were verified.

[0328] In formula (II), B1 may be A, G, C or U.

[0329] When B1 is base A, the chemically modified base A is called Ago; when B1 is base G, the chemically modified base G is called Ggo; when B1 is base C, the chemically modified base C is called Cgo; when B1 is base U, the chemically modified base U is called Ugo.

[0330] It can be seen from this that when B1 is different, the structure formed is different, and in this example, the on-target activity and anti-off-target activity of siRNA containing Ggo, Ago, Ugo, Cgo or Ggs are verified. For the convenience of describing this example, the general term Safe01 is used, which includes Ggo, Ago, Ugo or Cgo in Table 1 or Table 2, and its specific structure has been given above.

[0331] In this embodiment, the chemical modification of GNA is introduced into base A to form Agn, the chemical modification of GNA is introduced into base G to form Ggn, the chemical modification of GNA is introduced into base U to form Ugn, and the chemical modification of GNA is introduced into base C to form Cgn.

[0332] In this example, the naked sequences used for modification in Table 1 below are as follows in the 5'-3' direction. The modifications to the sequences are detailed in Table 1 below.

[0333] siRNA-1: positive strand: UGACAAGAAUCCUCACAAU (SEQ ID NO: 1),

[0334] Antisense strand: AUUGUGAGGAUUCUUGUCAAC (SEQ ID NO: 2);

[0335] siRNA-2: positive strand: CCUUGAGGCAUACUUCAAA (SEQ ID NO: 3),

[0336] Antisense strand: UUUGAAGUAUGCCUCAAGGUU (SEQ ID NO: 4);

[0337] siRNA-3: positive strand: GUGUGCACUUCGCUUCACA (SEQ ID NO: 5),

[0338] Antisense strand: UGUGAAGCGAAGUGCACACUU (SEQ ID NO: 6);

[0339] siRNA-4: positive strand: ACUGAAGCAUUUGAUGCAA (SEQ ID NO: 7),

[0340] Antisense strand: UUGCAUCAAAUGCUUCAGUGU (SEQ ID NO: 8);

[0341] siRNA-5: positive strand: AUAACUCACUAUAAUUACU (SEQ ID NO: 9),

[0342] Antisense strand: AGUAAUUAUAGUGAGUUAUUU (SEQ ID NO: 10).

[0343] The on-target and off-target activities of compounds with different sequences were detected using a dual-luciferase reporter gene. HEK293 cells were cultured in DMEM high-glucose medium containing 10% fetal bovine serum at 37°C and 5% CO2. Referring to the product manual, the reporter gene plasmid and different concentrations of siRNA were co-transfected into the cells using Lipofectamine 2000 (ThermoFisher, 11668019). The siRNA sequences are shown in Table 1. Detection was performed using a dual-luciferase assay kit (Yishen Bio, 11405ES80) 24 hours after transfection. Sequences complementary to the antisense strand (on-target reporter plasmid) and five tandem sequences consistent with sites 12-19 at the 5' end of the sense strand (off-target reporter plasmid) were inserted into the 3' untranslated region of the Renilla luciferase of the reporter plasmid. The reporter plasmids all contain firefly luciferase as an internal control. The group transfected with only the plasmid served as the control group. The results are shown in Table 2. The results show that siRNA containing Safe01 retained on-target activity in vitro and significantly reduced off-target activity; the results of tests on different targets showed that the on-target activity and anti-off-target activity of Safe01 were better than those of GNA.

[0344] Table 1 In vitro reporter test sequences

[0345] Table 2 In vitro reporter test results

[0346] Example 9 Testing the in vivo activity of Safe01 modified compounds using C57BL / 6-HBV (hepatitis B virus) transgenic mice

[0347] C57BL / 6-HBV transgenic mice were selected from Beijing Weitongda Biotechnology Co., Ltd.: 1.28 times the length of HBV (type A, GeneBank: AF305422.1) linearized fragment was injected into the pronucleus of C57BL / 6NCrl mouse embryos to obtain transgenic positive mice. Peripheral blood HBV copy number analysis showed that the copy number remained at 10 7 ~10 8 The HBV transgenic mouse strain was established by mating hemizygous wild-type C57BL / 6NCrl mice with the founder mice of eq / ml.

[0348] The original siRNA sequence compound is SD003254, and the Safe01 anti-off-target modified compound is SD003257, and their sequences are shown in Table 3.

[0349] C57BL / 6-HBV transgenic mice were divided into three groups, with five mice in each group. Blood was collected from the animals submandibularly on day -3 and centrifuged at 5000 rpm at 4°C for 10 minutes. The serum was diluted with PBS, with the dilution factor determined based on the specific situation. The diluted samples were then sent to Beijing Dian Medical Testing Laboratory Co., Ltd. for HBV DNA testing, and the results were back-calculated based on the dilution factor. HBV DNA quantification was performed using fluorescent probe quantitative PCR. Animals were divided into groups based on HBV DNA levels. On day 0, the three groups were subcutaneously injected with vehicle (phosphate-buffered saline), SD003254, or SD003257 at a dose of 3 mg / kg body weight. Blood was collected again on day 56 to measure HBV DNA levels, and the activity of SD003254 and SD003257 was compared.

[0350] The levels of HBV DNA before and after administration relative to the vehicle group (%) are shown in Figure 1 .

[0351] On day 56 after treatment, the SD003254 and SD003257 groups showed approximately 92.8% and 87.6% inhibition rates, respectively, compared to the vehicle group, with essentially identical activity (P values ​​greater than 0.5, indicating no statistically significant difference). This suggests that the Safe01 molecular modification had no significant effect on the compound's long-term efficacy in vivo.

[0352] Table 3 Compound sequence information

[0353] In this embodiment, the conjugated groups (FIN) conjugated to the siRNA are:

[0354] Example 10 Analysis of the anti-off-target activity of Safe01 modified compounds using RNA-seq

[0355] RNA-seq, or transcriptome sequencing technology, is a sequencing analysis using high-throughput sequencing technology to analyze differentially expressed genes. The standard workflow starts with RNA extraction in the laboratory, followed by mRNA enrichment or removal of ribosomal RNA, cDNA reverse transcription, and preparation of sequencing libraries connected by adapters. Next, the library will be sequenced by a high-throughput sequencing platform, and each sample will typically be sequenced to a read length of 10,000,000 to 30,000,000. Finally, the data obtained from the experiment is analyzed by aligning or splicing the sequencing reads to the transcriptome, quantifying the read lengths covering the transcripts, filtering and normalizing between samples, and using statistical models to describe the differences in expression levels of each gene between the various sample groups.

[0356] HEK293 cells were transfected with SD003254 and SD003257 in vitro. RNA-seq analysis was performed to compare the effects of the Safe01-modified compounds on improving off-target effects. HEK293 cells were cultured in DMEM high-glucose medium supplemented with 10% fetal bovine serum at 37°C and 5% CO2. For transfection, HEK293 cells were seeded in 6-well plates at a density of 600,000 cells per well in 2 mL of medium. siRNA was transfected using Lipofectamine RNAiMAX (ThermoFisher, 13778150) according to the product instructions. The final siRNA concentration was 10 nM. Cells were harvested 24 hours after treatment and sent to Suzhou GeneWeiZhi Biotechnology Co., Ltd. for RNA-seq analysis.

[0357] The RNA-seq results are shown in Table 4. The results show that the number of upregulated and downregulated genes in the Safe01-modified compound SD003257 is reduced compared with SD003254, indicating that Safe01 improves the off-target effect.

[0358] Table 4 RNA-seq analysis results of the test substances

[0359] Example 11 Comparative evaluation of on-target activity of Safe01 and A0360 in vitro

[0360] In this example, the effects of chemical modifications represented by (II) and A0360 at nucleotide position 6 in the 5' region of the antisense strand on the on-target activity of siRNA were comparatively evaluated.

[0361] In formula (II), B1 may be A, G, C or U.

[0362] When B1 is different, the structure formed is different. For the convenience of describing this embodiment, the general term Safe01 is used, which includes the Ago in Table 5 or Table 6 (when B is base A, the chemically modified base A is called Ago), and its specific structure has been given above.

[0363] use Dual-luciferase assay sequence on-target activity. On-target activity was assessed by co-transfecting cells with 10 ng of on-target reporter plasmid (containing the sequence GSCM, which is fully complementary to the antisense strand, inserted into the 3' untranslated region of the Renilla luciferase reporter plasmid) and siRNA diluted 2.5-fold from 20 nM to 0.00524 nM using Lipofectamine 2000 (ThermoFisher, 11668019). HEK293 cells were cultured in DMEM high-glucose medium supplemented with 10% fetal bovine serum at 37°C and 5% CO2. siRNA sequences are shown in Table 5. Detection was performed 24 hours after transfection using the Dual-Luciferase Assay Kit (Promega, E1980). The reporter plasmids all contained firefly luciferase as an internal control. A group transfected with only the plasmid served as a control.

[0364] The Renilla luciferase signal readings in each well were normalized to the firefly luciferase (control) signal ratio, and then compared with cells transfected with the same plasmid but not treated with siRNA to calculate the relative levels at different concentrations. The test results are shown in Table 6. The results show that siRNA containing Safe01 retains essentially the same on-target activity as the original sequence in vitro, and Safe01 has better on-target activity than A0360.

[0365] Table 5 Compound sequence information

[0366] Table 6 Analysis results of relative expression levels of test substances

[0367] The above detailed description of the present invention is intended to enable persons familiar with the art to understand the contents of the present invention and implement them. It does not limit the scope of protection of the present invention. Any equivalent changes or modifications made based on the spirit of the present invention should be included in the scope of protection of the present invention.

Claims

1. A single-stranded or double-stranded oligonucleic acid, each strand having 15 to 35 nucleotides, wherein at least one nucleotide position other than the first and last ends of the oligonucleic acid comprises a chemical modification represented by formula (II) or a tautomer modification thereof, in, B1 is a natural nucleobase, a modified nucleobase, a universal base or an H atom; R1, R2 and R3 are independently selected from H, OH, halogen, NH2, C1-C6 alkyl, C1-C6 alkoxy, C2-C6 alkenyl, C2-C6 alkynyl, S-CH3, NCH3(CH3), OCH2CH2OCH3 and -O-alkylamino; n is 1, 2 or 3; Wherein, the chemical modification represented by the formula (II) is not 2. The single-stranded or double-stranded oligonucleic acid according to claim 1, characterized in that: The oligonucleic acid is siRNA, comprising a sense strand and an antisense strand, each strand having 15 to 35 nucleotides, wherein the antisense strand comprises a chemical modification represented by formula (II-1), formula (II-2), (II-3) or (II-4) or a tautomer modification thereof at at least one nucleotide position from the 2nd to the 8th nucleotide position in the 5' region of the antisense strand, Wherein: B1 and B2 are natural nucleobases, modified nucleobases, universal bases or H atoms, respectively.

3. The single-stranded or double-stranded oligonucleic acid according to claim 2, characterized in that: The chemical modification is selected from any of the following structures:

4. The single-stranded or double-stranded oligonucleic acid according to claim 2, characterized in that: The chemical modification is selected from any of the following structures:

5. The single-stranded or double-stranded oligonucleic acid according to any one of claims 1 to 4, characterized in that: The chain comprises a chemical modification represented by formula (II), (II-1), (II-2), (II-3) or (II-4) or a tautomer modification thereof at at least one nucleotide position from position 5 to position 8 in its 5' region.

6. The single-stranded or double-stranded oligonucleic acid according to claim 5, characterized in that: The chain comprises a chemical modification or a tautomer modification thereof at at least one of nucleotide positions 6 and 7 in the 5' region.

7. The single-stranded or double-stranded oligonucleic acid according to claim 5, characterized in that: The strand is an antisense strand of a double-stranded oligonucleic acid, and contains a chemical modification represented by Ago, Ggo, Cgo, Ugo, Ggs or Tgo or a tautomer modification thereof at at least one nucleotide position between the 6th and 7th nucleotides in its 5' region.

8. The single-stranded or double-stranded oligonucleic acid according to claim 5, characterized in that: In addition to the chemically modified nucleotides shown in formula (II), (II-1), (II-2), (II-3) or (II-4) or their tautomer-modified nucleotides, the chain further comprises at least one other modified nucleotide.

9. The single-stranded or double-stranded oligonucleic acid according to claim 8, characterized in that: The other modified nucleotides are independently selected from the group consisting of 2'-fluoro modified nucleotides, 2'-alkoxy modified nucleotides, 2'-substituted alkoxy modified nucleotides, 2'-alkyl modified nucleotides, 2'-substituted alkyl modified nucleotides, 2'-deoxy nucleotides, 2'-amino modified nucleotides and 2'-substituted amino modified nucleotides.

10. The single-stranded or double-stranded oligonucleic acid according to claim 8, characterized in that: The oligonucleic acid is siRNA, which comprises a sense strand and an antisense strand, and the siRNA has at least one of the following characteristics: (i) the antisense strand comprises 2, 3, 4, 5 or 6 2'-fluoro modifications; (ii) the antisense strand comprises 1, 2, 3 or 4 phosphorothioate internucleotide linkages; (iii) the sense strand contains 2, 3, 4 or 5 2'-fluoro modifications; (iv) the sense strand contains 1, 2, 3 or 4 phosphorothioate internucleotide linkages. 11 . An siRNA conjugate, comprising the single-stranded or double-stranded oligonucleic acid according to any one of claims 1 to 10 and a conjugation group conjugated to the oligonucleic acid. 12 . A pharmaceutical composition comprising the single-stranded or double-stranded oligonucleic acid according to claim 1 or the siRNA conjugate according to claim 10 , and a pharmaceutically acceptable carrier. 13 . A kit comprising the single-stranded or double-stranded oligonucleic acid according to any one of claims 1 to 10 , or the siRNA conjugate according to claim 11 , or the pharmaceutical composition according to claim 12 .

14. A compound represented by the following formula (IV) or its tautomer, in, B1 is a natural nucleobase, a modified nucleobase, a universal base or an H atom; E is a leaving group; preferably, E is MMTr or DMTr; Q is a phosphorus-containing reactive group; preferably, Q is 15. The compound represented by formula (IV) or its tautomer according to claim 14, characterized in that: It is selected from any of the following structures:

16. A method for preparing the single-stranded or double-stranded oligonucleic acid according to any one of claims 1 to 10 or the siRNA conjugate according to claim 11, comprising the following steps: 1) synthesizing the compound represented by formula (IV) according to claim 13 or 14 or its tautomer; 2) synthesizing the oligonucleic acid or siRNA conjugate using the compound of step 1) or its tautomer.

17. A method for inhibiting a target gene in a cell, characterized in that: The method comprises the step of introducing the single-stranded or double-stranded oligonucleic acid according to any one of claims 1 to 10 or the siRNA conjugate according to claim 11 into the cell.

18. A method for modifying positions 2-8 of the antisense strand of siRNA to reduce off-target activity, characterized in that: The chemical modification represented by the general formula (II), (II-1), (II-2), (II-3) or (II-4) as described in claim 1 or 2 or its tautomer modification is introduced into the 2-8 position of the antisense strand of the siRNA molecule.

19. The method according to claim 18, characterized in that: The chemical modification represented by general formula (II), (II-1), (II-2), (II-3) or (II-4) or its tautomer is selected from any of the following structures:

20. The method according to claim 18, characterized in that: The chemical modification represented by general formula (II), (II-1), (II-2), (II-3) or (II-4) or its tautomer is selected from any of the following structures:

Images