2"-o-galloyl acteoside for preparing an anti-fibrosis drug
By using 2″-O-galloyl-seridin to prepare an anti-fibrotic drug, the expression of fibrosis-related genes and proteins was inhibited, solving the problem of limited efficacy of existing fibrosis treatments and achieving a more effective fibrosis inhibition effect.
Patent Information
- Application Number
- CN202411690731.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Priority Date
- 2023-11-30
- Filing Date
- 2024-11-22
- Publication Date
- 2025-11-21
- Estimated Expiration
- 2044-11-22
AI Technical Summary
Current technologies lack effective and specific drug treatments for fibrotic diseases. Existing drugs can only slow down the fibrosis process and have significant side effects, resulting in high treatment costs and an immature treatment system.
2″-O-galloyl gesinoside was used as the active ingredient to prepare an anti-fibrotic drug that inhibits the expression or transcription of α-smooth muscle actin, fibronectin, type I collagen genes, etc. It was applied in lung epithelial cell, skin fibroblast and hepatic stellate cell models to reduce the formation of extracellular matrix.
It significantly inhibits the fibrosis process, reduces the formation of extracellular matrix, improves the degree of fibrosis, and provides a safer and more effective method for treating fibrosis.
Smart Images

Figure CN119732965B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of antifibrotic drug technology, specifically relating to the application of 2″-O-galloylgistrin in the preparation of antifibrotic drugs. Technical Background
[0002] Fibrosis is the result of abnormal tissue repair, characterized by the formation of excess fibrous connective tissue and the deposition of extracellular matrix, leading to structural remodeling of organs such as the lungs, liver, intestines, and skin. Fibrosis is usually caused by severe or repeated tissue damage. In the early stages, it is mainly characterized by local inflammatory responses. As the disease progresses, the infiltration and exudation of immune cells gradually decrease, epithelial cells differentiate into fibroblast-like cells, fibroblasts proliferate abnormally, and extracellular matrix accumulates excessively, ultimately leading to fibrosis. The continuous development of fibrosis leads to tissue structural destruction, organ dysfunction and eventual failure, and even death.
[0003] Due to the complexity and incomplete understanding of the pathological mechanisms of fibrosis, there are currently very few drugs that can specifically treat fibrosis. In 2014, nintedanib and pirfenidone were launched as drugs for treating idiopathic pulmonary fibrosis, but these two drugs can only slow the progression of fibrosis, not reverse it. For fibrosis in other organs, there are currently no drugs on the market that can specifically target the fibrotic process. The commonly used clinical treatment regimen is glucocorticoids combined with cytotoxic drugs, hoping to stop the early fibrotic process through immunosuppression, but the treatment effect is limited and is usually accompanied by side effects such as bone marrow suppression and granulocytopenia or even agranulocytosis. In addition to drug treatment, severe fibrosis is often treated surgically. In recent years, antibodies specifically targeting key factors in the fibrotic process are under development, and mesenchymal stem cell transplantation technology has also been applied in the treatment of fibrosis, but these methods still have problems such as high treatment costs and immature treatment systems. Therefore, the development of novel anti-fibrotic drugs has broad application prospects and significant social importance.
[0004] Euphorbia helioscopia L. is an annual herbaceous plant belonging to the genus Euphorbia in the family Euphorbiaceae. It has a pungent and bitter taste, and is cool in nature. It possesses diuretic, anti-edema, nodule-dispersing, and insecticidal functions, and is mainly used to treat edema, ascites due to liver cirrhosis, and bacterial dysentery. Diterpenoids, triterpenoids, quercetin, and 2″-O-galloyl-hypericin have been isolated from Euphorbia helioscopia. 2″-O-galloyl-hypericin has also been reported to exist in persimmon leaves, Euphorbia pekinensis, and Pyrrosia lingua. Currently, there are no reports on the use of 2″-O-galloyl-hypericin for anti-fibrotic purposes. Summary of the Invention
[0005] The inventors have discovered that 2″-O-galloyl-seridin (structural formula below) has anti-fibrotic effects, and it has shown significant anti-fibrotic effects in lung epithelial cell mesenchymal transition model, human skin fibroblast activation model, human hepatic stellate cell activation model and bleomycin-induced mouse pulmonary fibrosis animal model.
[0006]
[0007] Based on this, the present invention provides the following technical solution:
[0008] In a first aspect, the present invention provides the use of 2″-O-galloylgistridine in the preparation of antifibrotic drugs.
[0009] In a second aspect, the present invention provides the use of a composition comprising 2″-O-galloyl kimosiderin and optionally pharmaceutically acceptable excipients in the preparation of an antifibrotic drug.
[0010] Thirdly, the present invention provides the use of plant extracts containing 2″-O-galloyl kimosiderin in the preparation of antifibrotic drugs.
[0011] Furthermore, the plants may be Euphorbia helioscopia, persimmon (persimmon leaves), Euphorbia pekinensis, Pyrrosia lingua, etc.
[0012] Fourthly, the present invention provides the use of 2″-O-galloyl hypericin, compositions containing 2″-O-galloyl hypericin, or plant extracts containing 2″-O-galloyl hypericin in the preparation of products having one or more of the following effects:
[0013] (a) Inhibits the upregulation of α-smooth muscle actin (α-SMA) and / or fibronectin expression in cells;
[0014] (b) Suppresses the upregulation of transcription of type I collagen gene (COl1A1), fibronectin gene (FN1) and / or α-smooth muscle actin gene (ACTA2) in cells;
[0015] Furthermore, the upregulation of α-smooth muscle actin (α-SMA) and / or fibronectin expression, or the upregulation of type I collagen gene (COl1A1), fibronectin gene (FN1), and / or α-smooth muscle actin gene (ACTA2) transcription, is induced by TGF-β1 or bleomycin.
[0016] Further, the cells are lung epithelial cells, skin fibroblasts, or hepatic stellate cells; further, the skin fibroblasts are human skin fibroblasts, and the hepatic stellate cells are human hepatic stellate cells.
[0017] Furthermore, the product can be a drug, reagent, etc.
[0018] The reagents refer to products used in life science research, clinical diagnosis, and medical research. Attached Figure Description
[0019] Figure 1 To illustrate the effect of 2″-O-galloylgidarene on the expression levels of fibroblast markers α-smooth muscle actin (α-SMA) and fibronectin in the TGF-β1-induced lung epithelial-mesenchymal transition model in Example 2, the left image shows the exposure results of the protein sample immunoblotting analysis, and the right image shows the quantitative statistical graph after grayscale analysis of the immunoblotting results.
[0020] Figure 2 A graph showing the effect of 2″-O-galloylgidarene on the transcriptional levels of extracellular matrix type I collagen gene (COl1A1) and fibronectin gene (FN1) in the TGF-β1-induced lung epithelial-mesenchymal transition model in Example 2;
[0021] Figure 3 To illustrate the effect of 2″-O-galloylgidarene on the expression levels of type I collagen and fibronectin in the TGF-β1-induced human skin fibroblast activation model in Example 3, the left image shows the exposure results of the immunoblotting analysis of the protein samples, and the right image shows the quantitative statistical graph after grayscale analysis of the immunoblotting results.
[0022] Figure 4 A graph showing the effect of 2″-O-galloylgidarene on the transcriptional levels of extracellular matrix type I collagen gene (COl1A1) and fibronectin gene (FN1) in a TGF-β1-induced human skin fibroblast activation model in Example 3;
[0023] Figure 5 To illustrate the effect of 2″-O-galloylgidarene on the expression level of α-smooth muscle actin (a-SMA) in the TGF-β1-induced human hepatic stellate cell activation model in Example 4, the left image is the exposure result of the immunoblotting analysis of the protein samples, and the right image is the quantitative statistical graph made after grayscale analysis of the immunoblotting results.
[0024] Figure 6 A graph showing the effect of 2″-O-galloylgidarene on the transcriptional levels of type I collagen gene (COL1A1) and α-smooth muscle actin gene (ACTA2) in a TGF-β1-induced human hepatic stellate cell activation model in Example 4;
[0025] Figure 7 This is a flowchart of the bleomycin-induced mouse pulmonary fibrosis animal model experiment in Example 5;
[0026] Figure 8 These are CT images of the lungs of mice in each group in Example 5;
[0027] Figure 9 A graph showing the effect of 2″-O-galloyl-seridin on the transcriptional levels of extracellular matrix-encoding genes (type I collagen gene (Colla1) and fibronectin gene (Fn1)) in the lungs of mice with bleomycin-induced pulmonary fibrosis in Example 5;
[0028] One-way ANOVA was used to perform statistical analysis on the data. # indicates that the model group is less than 0.05 compared with the normal group, ## indicates that the model group is less than 0.01, and ### indicates that the model group is less than 0.001; * indicates that the compound group is less than 0.05 compared with the model group, ** indicates that the compound group is less than 0.01, and *** indicates that the compound group is less than 0.001. Detailed Implementation
[0029] To better understand the essence of this invention, the pharmacological experimental results of 2”-O-galloylgidarene in the treatment of fibrosis are provided below in the form of examples, illustrating its novel application in the pharmaceutical field. It must be noted that these examples are for illustrative purposes only and are not intended to limit the scope of protection of this invention.
[0030] The following examples use Euphorbia helioscopia as an example to extract 2”-O-galloyl-gistroeidin for research, but this does not limit the source of 2”-O-galloyl-gistroeidin.
[0031] Example 1.2 Preparation of “-O-galloyl gesinoside”.
[0032] Euphorbia helioscopia (purchased from Shanghai Yanghetang Chinese Herbal Pieces Co., Ltd.) was pulverized into coarse powder, and extracted with 10 times its volume (v / w) of water under reflux for 1 hour. The extract was filtered, and the residue was extracted again with 8 times its volume (v / w) of water under reflux for 1 hour. The extract was filtered again. The two extracts were combined and concentrated to dryness under reduced pressure. 1 times its volume (v / w) of water was added and heated under reflux for 1 hour, then allowed to stand overnight at room temperature. The precipitate was filtered, dissolved in a small amount of dimethyl sulfoxide, centrifuged at high speed, and the supernatant was subjected to C18 reversed-phase preparative HPLC separation with a 10-50% acetonitrile-water gradient elution at a detection wavelength of 254 nm. The chromatographic peak of 2″-O-galloyl-gigastrin was collected, evaporated to dryness under reduced pressure, and pure 2″-O-galloyl-gigastrin was obtained for the experiments in the following examples. 1¹H-NMR data (deuterated methanol, 600 MHz): 7.64 (¹H, d, J = 1.6 Hz), 7.49 (¹H, dd, J = 8.5, 1.6 Hz), 7.13 (2H, s), 6.78 (¹H, d, J = 8.5 Hz), 6.33 (¹H, d, J = 1.4 Hz), 6.16 (¹H, d, J = 1.4 Hz), 5.68 (¹H, d, J = 7.9 Hz), 5.44 (¹H, t, J = 9.9, 7.9 Hz), 3.92 (¹H, br d, J = 3.2 Hz), 3.82 (¹H, dd, J = 9.9, 3.3 Hz), 3.68 (2H, m), 3.58 (¹H, br t, J = 7.9 Hz). ESIMS: m / z 639[M+Na] + 615 [MH] - (Reference: Molecules, 2018, 23, 2167)
[0033] Examples 2 to 5 are provided below to illustrate the effects of 2″-O-galloylgistridine on TGF-β1-induced interstitial transition of lung epithelial cells, activation of skin fibroblasts and hepatic stellate cells, and its effects on the degree of bleomycin-induced pulmonary fibrosis in mice and the transcription level of extracellular matrix-encoded genes in lung cells.
[0034] Example 2.2 Evaluation of the drug activity of ″-O-galloylgistrin in a TGF-β1-induced lung epithelial-mesenchymal transition model
[0035] TGF-β1 can induce the transformation of epithelial cells into fibroblast-like cells and activate these cells to secrete large amounts of extracellular matrix. Therefore, the TGF-β1-induced epithelial-mesenchymal transition model is one of the commonly used in vitro models in fibrosis research. α-Smooth muscle actin (α-SMA) and fibronectin are both markers of fibroblasts used to characterize the severity of fibrosis.
[0036] (1) The experiment used normal human lung epithelial cells (Beas-2b, purchased from the American Center for Type Culture Collection), which were divided into 5 groups, including a normal group, a model group, and a 2″-O-galloyl-gidarene drug administration group (referred to as the compound group, whose drug solution was prepared by dilution in serum-free DMEM medium, with drug concentrations of 100 μM, 50 μM, and 25 μM, respectively). Beas-2b cells (2 × 10⁻⁶) 5 Cells were seeded at 100 cells / well in 12-well plates. After the cells adhered, they were cultured in serum-free DMEM medium and starved for 12 hours.
[0037] (2) Cells in the drug-treated group were pre-incubated with different concentrations of 2”-O-galloyl ferrous sulfate solution for 30 minutes, while cells in the other groups were simultaneously added to an equal volume of serum-free DMEM medium. TGF-β1 was diluted with serum-free DMEM medium to a final concentration of 10 ng / mL and added to the wells corresponding to the model group and drug-treated group cells. After stimulation for 24 hours, the lung epithelial-mesenchymal transition model was constructed. Cells in the normal group were added to an equal volume of serum-free DMEM medium.
[0038] (3) Cell samples from each group were collected to study the expression levels of α-smooth muscle actin (α-SMA) and fibronectin. Specific procedures included: cell lysis with SDS solution, protein extraction, and protein quantification using the BCA method. Protein samples (10 μL / lane) were separated by 7.5% SDS-PAGE gel and then transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk at room temperature for 1 hour, incubated overnight with primary antibody at 4°C, washed, and then incubated with secondary antibody at room temperature for 1 hour. Exposure was performed using ECL Prime Western Blotting Detection Reagent. Grayscale analysis was performed using ImageJ software. Results are shown below. Figure 1 .
[0039] Separate cell samples were taken from the above-mentioned cell line to study the transcriptional levels of extracellular matrix-encoding genes (type I collagen gene (COl1A1) and fibronectin gene (FN1)). The specific procedures included: homogenizing cells and extracting RNA from the cell samples using the RNA Simple Total RNA Extraction Kit. RNA content was detected using a Nano Drop spectrophotometer. RNA was reverse transcribed into cDNA using the Hifair™ II 1st Strand cDNA Synthesis SuperMix for qPCR kit. A sample-primer-SYBR Green reaction system was prepared, and extracellular matrix-encoding genes (type I collagen gene (COl1A1) (forward primer sequence: GAGGGCCAAGACGAAGACATC (SEQ ID NO: 1), reverse primer sequence: CAGATCACGTCATCGCACAAC (SEQ ID NO: 2)) and fibronectin gene (FN1) (forward primer sequence: CGTGGCTGTCAGTCAAAG (SEQ ID NO: 3), reverse primer sequence: AAACCTCGGCTTCCTCCATAA (SEQ ID NO: 4)) were amplified using a qPCR instrument. Relative quantification was performed using the ΔΔCt method. Results are shown in [Figure number missing]. Figure 2 .
[0040] Experimental results:
[0041] like Figure 1 As shown, compared with the normal group cells, the expression levels of α-smooth muscle actin and fibronectin were increased in the model group cells, indicating that the model group cells transformed more into fibroblast-like cells. The expression levels of α-smooth muscle actin and fibronectin in the 2″-O-galloyl-gistroside-treated group cells were lower than those in the model group, indicating that 2″-O-galloyl-gistroside can inhibit the transformation of lung epithelial cells into fibroblast-like cells.
[0042] like Figure 2 As shown, compared with the normal group cells, the transcription levels of the type I collagen encoding gene (COl1A1) and the fibronectin encoding gene (FN1) were increased in the model group cells, indicating that the model group cells expressed excessive extracellular matrix. Compared with the model group cells, the transcription levels of the type I collagen gene (COl1A1) and the fibronectin gene (FN1) were decreased in the 2″-O-galloyl-gistroside administration group, indicating that 2″-O-galloyl-gistroside can inhibit the transcription of extracellular matrix encoding genes in the TGF-β1-induced lung epithelial-mesenchymal transition model.
[0043] Example 3.2 Evaluation of the drug activity of ″-O-galloyl ginstinoside in a TGF-β1-induced human skin fibroblast activation model
[0044] (1) Human skin fibroblasts (BJ, purchased from the American Center for Type Culture Collection) were used in the experiment and divided into 5 groups, including a normal group, a model group, and a 2”-O-galloyl-gidarene drug administration group (referred to as the compound group, whose drug solution was prepared by diluting DMEM medium containing 0.5% serum, with drug concentrations of 100 μM, 50 μM, and 25 μM, respectively). BJ cells (2 × 10⁶) 5 Cells were seeded at 100 cells / well in 12-well plates. After the cells adhered, they were cultured in DMEM medium containing 0.5% serum and starved for 24 hours.
[0045] (2) Cells in the drug-treated group were pre-incubated with different concentrations of 2″-O-galloyl-gidarene solution for 30 minutes. Cells in the other groups were simultaneously added to an equal volume of DMEM medium containing 0.5% serum. TGF-β1 was diluted with DMEM medium containing 0.5% serum to a final concentration of 25 ng / mL and added to the wells corresponding to the model group and drug-treated group cells. After stimulation for 24 hours, the human skin fibroblast activation model was constructed. Cells in the normal group were added to an equal volume of DMEM medium containing 0.5% serum.
[0046] (3) Cell samples from each group were collected to study the expression levels of type I collagen and fibronectin in the extracellular matrix. Specific procedures included: homogenizing cells, lysing cells with SDS solution, extracting proteins, and quantifying proteins using the BCA method. Protein samples (10 μL / lane) were separated by 7.5% SDS-PAGE gel and then transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk at room temperature for 1 hour, incubated overnight with primary antibody at 4°C, washed, and then incubated with secondary antibody at room temperature for 1 hour. Exposure was performed using ECL Prime Western Blotting Detection Reagent. Grayscale analysis was performed using ImageJ software. Results are shown below. Figure 3 .
[0047] Cell samples from the above groups were then used to study the transcriptional levels of extracellular matrix type I collagen gene (COL1A1) and fibronectin gene (FN1). Specific procedures included: extracting RNA from cell samples using the RNA Simple Total RNA Extraction Kit; detecting RNA content using a Nano Drop spectrophotometer; and reverse transcribing RNA into cDNA using the Hifair™ II 1st Strand cDNA Synthesis SuperMix for qPCR kit. A sample-primer-SYBR Green reaction system was prepared. The coding gene for type I collagen (COL1A1) (forward primer sequence: GAGGGCCAAGACGAAGACATC (SEQ ID NO: 1), reverse primer sequence: CAGATCACGTCATCGCACAAC (SEQ ID NO: 2)) and the coding gene for fibronectin (FN1) (forward primer sequence: CGTGGCTGTCAGTCAAAG (SEQ ID NO: 3), reverse primer sequence: AAACCTCGGCTTCCTCCATAA (SEQ ID NO: 4)) were amplified using qPCR. Relative quantification was performed using the ΔΔCt method. Results are shown in [Figure missing]. Figure 4 .
[0048] Experimental results:
[0049] like Figure 3As shown, compared with the normal group cells, the expression levels of type I collagen and fibronectin were increased in the model group cells, indicating that more fibroblasts were activated and expressed a large amount of extracellular matrix in the model group. Compared with the model group cells, the expression levels of type I collagen and fibronectin were decreased in the 2″-O-galloyl-gistroside administration group cells, indicating that 2″-O-galloyl-gistroside administration can inhibit the activation of skin fibroblasts and reduce the expression of extracellular matrix type I collagen and fibronectin.
[0050] like Figure 4 As shown, compared with the normal group cells, the transcription levels of type I collagen and fibronectin encoding genes were increased in the model group cells, indicating that the model group cells expressed excessive extracellular matrix. Compared with the model group cells, the transcription levels of type I collagen and fibronectin were decreased in the 2″-O-galloyl-gistroside administration group, indicating that 2″-O-galloyl-gistroside administration can inhibit the transcription of type I collagen gene (COL1A1) and fibronectin gene (FN1) in the TGF-β1-induced skin fibroblast activation model.
[0051] Example 4.2 Evaluation of the drug activity of ″-O-galloylgistridine in a TGF-β1-induced human hepatic stellate cell activation model
[0052] (1) Human hepatic stellate cells (LX-2, purchased from the American Center for Type Culture Collection) were used in the experiment and divided into 5 groups, including a normal group, a model group, and a 2″-O-galloyl-gidarene drug administration group (referred to as the compound group, whose drug solution was prepared by diluting DMEM medium containing 0.5% serum, with drug concentrations of 100 μM, 50 μM, and 25 μM, respectively). LX-2 cells (5 × 10⁶ cells / year) 4 Cells were seeded at 100 cells / well in 12-well plates. After the cells adhered, they were cultured in DMEM medium containing 0.5% serum and starved for 12 hours.
[0053] (2) Cells in the drug-treated group were pre-incubated with different concentrations of 2″-O-galloyl-gidarene solution for 30 minutes. Cells in the other groups were simultaneously added to an equal volume of DMEM medium containing 0.5% serum. TGF-β1 was diluted with DMEM medium containing 0.5% serum to a final concentration of 5 ng / mL and added to the wells corresponding to the model group and drug-treated group cells. After stimulation for 24 hours, the human hepatic stellate cell activation model was constructed. Cells in the normal group were added to an equal volume of DMEM medium containing 0.5% serum.
[0054] (3) Cell samples from each group were collected to study the expression level of α-smooth muscle actin (α-SMA). Specific procedures included: homogenizing cells, lysing cells with SDS solution, extracting proteins, and quantifying proteins using the BCA method. Protein samples (10 μL / lane) were separated by 7.5% SDS-PAGE gel and then transferred to nitrocellulose membranes. The membranes were blocked with 5% skim milk at room temperature for 1 hour, incubated overnight with primary antibody at 4°C, washed, and then incubated with secondary antibody at room temperature for 1 hour. Exposure was performed using ECL PrimeWestern Blotting Detection Reagent. Grayscale analysis was performed using ImageJ software. Results are shown below. Figure 5 .
[0055] Cell samples from the above groups were collected to study the transcriptional levels of type I collagen gene (COL1A1) and α-smooth muscle actin gene (ACTA2). Specific procedures included: extracting RNA from cell samples using the RNA Simple Total RNA Extraction Kit; detecting RNA content using a Nano Drop spectrophotometer; and reverse transcribing RNA into cDNA using the Hifair™ II 1st Strand cDNA Synthesis SuperMix for qPCR kit. A sample-primer-SYBR Green reaction system was prepared, and the type I collagen gene (COL1A1) (forward primer sequence: GAGGGCCAAGACGAAGACATC (SEQ ID NO: 1), reverse primer sequence: CAGATCACGTCATCGCACAAC (SEQ ID NO: 2)) and the α-smooth muscle actin gene (ACTA2) (forward primer sequence: AAAAGACAGCTACGTGGGTGA (SEQ ID NO: 5), reverse primer sequence: GCCATGTTCTATCGGGTACTTC (SEQ ID NO: 6)) were amplified using qPCR. Relative quantification was performed using the ΔΔCt method. Results are shown below. Figure 6 .
[0056] Experimental results:
[0057] like Figure 5 As shown, compared with the normal group cells, the expression level of α-smooth muscle actin in the model group cells was increased, indicating that more fibroblasts were activated in the model group. Compared with the model group cells, the expression level of α-smooth muscle actin in the 2″-O-galloyl-gistroside-treated group cells was decreased, indicating that 2″-O-galloyl-gistroside treatment can inhibit the activation of hepatic stellate cells.
[0058] like Figure 6As shown, compared with the normal group cells, the transcription levels of the genes encoding type I collagen and α-smooth muscle actin were increased in the model group cells, indicating that the model group cells were activated into myofibroblasts and expressed excessive extracellular matrix. Compared with the model group cells, the transcription levels of the above genes were decreased in the 2″-O-galloyl-gistroside administration group, indicating that 2″-O-galloyl-gistroside administration can inhibit TGF-β1-induced hepatic stellate cell activation.
[0059] Example 5.2 Evaluation of the drug activity of ″-O-galloylgistridine in a bleomycin-induced mouse pulmonary fibrosis model.
[0060] (1) Eight-week-old male C57BL / 6 mice were used as experimental animals and purchased from the Shanghai Laboratory Animal Center, Chinese Academy of Sciences (License No.: 2023-0003). The mice were housed in the SPF-grade animal room of the Shanghai Institute of Materia Medica, Chinese Academy of Sciences, with the temperature controlled at 24±2℃ and the relative humidity controlled at 50±10%, and a 12-hour light-dark cycle. Feed and drinking water were provided to the animals freely. Before the start of the experiment, the experimental animals were acclimatized in the SPF-grade animal room for at least one week and their health status was monitored daily. The mice were randomly grouped, modeled, and administered drugs according to Table 1. After anesthetizing the mice with intraperitoneal injection of sulfadiazine, they were fixed on the operating table and bleomycin (0.85 mg / kg) was instilled into the bronchi of the mice to establish a pulmonary fibrosis model.
[0061] (2) On the first day after modeling, mice in the compound group were given 100 mg / kg of 2″-O-galloyl ginstinoside by gavage, and mice in the nintedanib group (purchased from Beijing Wokai Biotechnology Co., Ltd.) were given 60 mg / kg of nintedanib by gavage, once a day.
[0062] (3) On day 28, CT imaging of the mouse lungs was used to characterize the status of pulmonary fibrosis. The results are shown in […]. Figure 8Mice were euthanized, and lung tissue was collected and homogenized. RNA was extracted from the tissue samples using the RNA Simple Total RNA Extraction Kit. RNA content was detected using a Nano Drop spectrophotometer. RNA was reverse transcribed into cDNA using the Hifair™ II 1st Strand cDNA Synthesis SuperMix for qPCR kit. A sample-primer-SYBR Green reaction system was prepared, and the gene encoding type I collagen (Col1a1) (forward primer sequence: GCTCCCTTAGGGGCCACT (SEQ ID NO: 7), reverse primer sequence: ATTGGGGACCCTTAGGCCAT (SEQ ID NO: 8)) and the gene encoding fibronectin (Fn1) (forward primer sequence: ATGGGACCCCTCCTGATAGT (SEQ ID NO: 9), reverse primer sequence: GCCAGTGATTTCAGCAAAGG (SEQ ID NO: 10)) were amplified using qPCR. Relative quantification was performed using the ΔΔCt method. Results are shown in [Figure 1]. Figure 9 .
[0063] Table 1. Grouping and treatment of bleomycin-induced mouse pulmonary fibrosis animal models
[0064]
[0065] Experimental results:
[0066] CT lung imaging results as follows Figure 8 As shown, the lung CT images of mice in the normal group were darker, while those in the model group were significantly lighter, indicating that the lung tissue density in the model group was higher and pulmonary fibrosis had occurred. The lung CT images of mice in the compound group and the nintedanib group were significantly darker than those in the model group, indicating that oral administration of 2″-O-galloylgidate and nintedanib can alleviate the degree of bleomycin-induced pulmonary fibrosis in mice.
[0067] like Figure 9 As shown, compared with the normal group mice, the transcription levels of type I collagen encoding gene (Col1a1) and fibronectin encoding gene (Fn1) in the lung tissue of the model group mice were increased, indicating excessive accumulation of extracellular matrix in the lungs of the model group mice. Compared with the model group mice, the transcription levels of type I collagen and fibronectin in the lung tissue of the compound group and the nintedanib group mice were decreased, indicating that oral administration of 2”-O-galloyl ginsenoside can improve the excessive accumulation of extracellular matrix in the lungs.
Claims
1. The use of 2"-O-galloyl-seridin in the preparation of antifibrotic drugs, wherein the fibrosis is liver fibrosis, pulmonary fibrosis or skin fibrosis.
2. The use of a composition comprising 2"-O-galloyl kilocaloride and optionally pharmaceutically acceptable excipients in the preparation of an antifibrotic drug, wherein the fibrosis is liver fibrosis, pulmonary fibrosis or skin fibrosis.
3. The application according to claim 1 or 2, wherein the antifibrotic drug has one or more of the following effects: (a) Inhibits the upregulation of α-smooth muscle actin and / or fibronectin expression in cells; (b) Suppresses the upregulation of transcription of type I collagen, fibronectin and / or α-smooth muscle actin genes in cells.
4. The application according to claim 3, characterized in that, The upregulation of α-smooth muscle actin and / or fibronectin expression, or the upregulation of type I collagen gene, fibronectin gene and / or α-smooth muscle actin gene transcription, is induced by TGF-β1 or bleomycin.
5. The application according to claim 3, characterized in that, The cells are lung epithelial cells, skin fibroblasts, or hepatic stellate cells.
6. The application according to claim 5, characterized in that, The skin fibroblasts are human skin fibroblasts; and / or the hepatic stellate cells are human hepatic stellate cells.