Chitinophilic bacteria and uses thereof

Abstract

The present application relates to the field of microbial technology, discloses a chitinophilic bacteria and its use. The chitinophilic bacteria provided by the present application is a new species in the genus, which can metabolically produce beta-glucosidase, iron carrier, IAA and other metabolites, and has good growth-promoting effect on plants.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, in particular to a Chitinophaga sp. and its use. BACKGROUND

[0002] In the process of modern agricultural production, unreasonable or excessive use of chemical fertilizers not only causes serious damage to the ecological environment, but also leads to agricultural non-point source pollution, and further affects the quality and safety of agricultural products, making the problems of chemical residues exceeding the standard in agricultural products increasingly prominent. In the field of agricultural management, biological management is one of the key ways to deal with the problem of unreasonable and excessive use of chemical fertilizers. Among various biological management methods, functional microbial inoculants are considered to be the most promising means to replace chemical fertilizers at the current stage, and are also important technical means for crop nutrition supply and biological control of crop diseases and pests.

[0003] Microbial fertilizer belongs to the third generation of agricultural fertilizer, which is naturally pollution-free. Through the metabolic activity of the active microorganisms contained therein, it can decompose organic matter and minerals in the soil and release nutrients required by plants, thereby providing sufficient nutrition for crops and promoting the growth and development of crops. Microbial fertilizer can improve the utilization rate of chemical fertilizer, reduce the use amount of chemical fertilizer, thereby reducing the cost of agricultural production, and reducing the pollution of chemical fertilizer to the environment.

[0004] However, it is found in agricultural practice that the effect of microbial fertilizer is different for different regions and different crops, so in order to meet the production needs of different regions and different agricultural crops, it is still necessary to develop microbial resources, and provide microbial strains with better effect according to the different planting characteristics of different regions and the growth needs of crops. SUMMARY

[0005] The purpose of the present application is to provide a Chitinophaga sp. and its use. The Chitinophaga sp. provided by the present application is identified as a new species of the genus, which has good functions of producing beta-glucosidase, producing iron carrier and producing IAA, and can effectively promote the growth of crops when applied to the rhizosphere soil of crops.

[0006] In order to achieve the above purpose, the present application provides a Chitinophaga sp. in one aspect, the preservation number of the Chitinophaga sp. is CGMCC No. 1.62395.

[0007] The second aspect of the present application provides a microbial inoculant, which comprises the Chitinophaga sp. of the first aspect.

[0008] The third aspect of the present application provides the use of the Chitinophaga sp. of the first aspect or the microbial inoculant of the second aspect, which comprises at least one of the following:

[0009] (1) preparing beta-glucosidase;

[0010] (2) preparing siderophore;

[0011] (3) preparing auxin;

[0012] (4) promoting plant growth;

[0013] (5) preparing microbial fertilizer.

[0014] The fourth aspect of the present application provides a method for preparing beta-glucosidase, which comprises culturing the Paenibacillus sp. of the first aspect 1.

[0015] The fifth aspect of the present application provides a method for preparing siderophore, which comprises culturing the Paenibacillus sp. of the first aspect.

[0016] The sixth aspect of the present application provides a method for preparing auxin, which comprises culturing the Paenibacillus sp. of the first aspect.

[0017] The seventh aspect of the present application provides a method for promoting plant growth, which comprises applying the Paenibacillus sp. of the first aspect or its culture, or the microbial inoculum of the second aspect to the rhizosphere soil of plants.

[0018] The eighth aspect of the present application provides a microbial fertilizer, which comprises the Paenibacillus sp. of the first aspect, or the microbial inoculum of the second aspect.

[0019] By the above technical solutions, the present application can achieve at least the following beneficial effects:

[0020] (1) The Paenibacillus sp. provided by the present application is identified as a new species in the genus, which provides a basis for the development of new microbial resources and the preparation of microbial fertilizer.

[0021] (2) The Paenibacillus sp. provided by the present application can produce metabolic products such as beta-glucosidase, IAA, and siderophore, and can be used for producing plant growth-promoting fertilizer or agent.

[0022] (3) The Paenibacillus sp. provided by the present application can be directly applied to the rhizosphere soil of crops to promote crop growth, which is simple and easy to use, has a significant growth-promoting effect, and has the potential to be used as a new type of microbial fertilizer raw material. Moreover, the strain can achieve good growth-promoting effect without the use of chemical fertilizer, has high environmental friendliness, and is suitable for large-scale popularization and application.

[0023] Biological preservation

[0024] The strain YIM B11428 provided by this invention, classified as Chitinophaga sp., was deposited on January 9, 2025, at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.1.62395. Attached Figure Description

[0025] Figure 1 Phylogenetic tree of chitinophile YIM B11428 constructed using the Neighbor-Joining method.

[0026] Figure 2 (A) Colony morphology of chitinophile YIM B11428 on R2A medium; (B) Transmission electron micrograph.

[0027] Figure 3 The image shows the detection results of β-glucosidase production by chitinophilic bacteria YIM B11428.

[0028] Figure 4 The image shows the detection results of siderophores produced by the chitinophile YIM B11428.

[0029] Figure 5 The image shows the qualitative detection results of IAA produced by the chitinophile YIM B11428.

[0030] Figure 6 The following charts show the comparison of tomato plant growth among different groups: (A) leaf growth; (B) plant height growth; and (C) diameter growth.

[0031] Figure 7 This is a diagram showing the results of a growth-promoting experiment on the chitinous genera YIM B11428. Detailed Implementation

[0032] The endpoints and any values ​​of the ranges disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoint values ​​of the various ranges, the endpoint values ​​of the various ranges and individual point values, and individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered as specifically disclosed herein.

[0033] In the present application, "YIM B11428" is the number of Chitinophaga sp. provided by the present application in the research process, and "CGMCC NO. 1.62395" is the preservation number of the strain, both of which refer to the same strain and can be used interchangeably in the present application, or can also be directly written as "the strain of the present application". In the present application, unless otherwise specified, "Chitinophaga sp." refers to the strain CGMCC NO. 1.62395 provided by the present application.

[0034] Mycorrhizosphere (Shiro) refers to a relatively loose and clumpy structure composed of mutual interlacing and knotting of mycorrhizal fungal hyphae, soil, soil humus and root systems in soil, which is not only the place of hyphal differentiation and nuclear distribution, but also an important condition for the formation of fruiting bodies. As one of the important components of mycorrhizosphere, mycorrhizosphere functional microorganisms have high economic and ecological value. The inventors of the present application found in long-term research that mycorrhizosphere functional microorganisms can be used for promoting the growth of host plants.

[0035] In the research, the inventors of the present application accidentally isolated a Chitinophaga sp. from the soil of mycorrhizosphere. After identification, the strain belongs to a new species of Chitinophaga. Further research shows that the strain has good ability to produce metabolic products such as β-glucosidase, IAA and iron carrier, and can promote plant growth, and can be used for developing microbial fertilizer and other related products for promoting crop growth.

[0036] Based on this, the first aspect of the present application provides a Chitinophaga sp., and the preservation number of the Chitinophaga sp. is CGMCC No. 1.62395.

[0037] The second aspect of the present application provides a microbial agent, which comprises the Chitinophaga sp. of the first aspect.

[0038] The microbial agent provided by the present application can be a liquid microbial agent or a solid microbial agent. The present application does not have specific limitations on the type and obtaining method of the microbial agent, and any microbial agent preparation method and dosage form commonly used in the art can be applied to the present application. For example, the liquid microbial agent can be a culture solution obtained by culturing the Chitinophaga sp. provided by the present application using a liquid culture medium, or a product obtained by concentrating, diluting or other treatments on the culture solution which still presents a liquid state. For another example, the solid microbial agent can be a solid (powder) microbial agent obtained by drying (such as freeze-drying) the above-mentioned liquid microbial agent.

[0039] According to some preferred embodiments of the present application, in the microbial agent, the content of the Chitinophaga sp. is not less than 10 7 CFU / g, preferably 10 7 -10 11CFU / g. It should be noted that in the present application, CFU / g and CFU / mL can be used interchangeably (i.e., 1 CFU / g = 1 CFU / mL), wherein CFU / g is generally used to describe the viable bacteria content in solid bacterial agents, and CFU / mL is generally used to describe the viable bacteria content in liquid bacterial agents, which can be converted according to the volume-mass ratio of 1 mL of liquid bacterial agent = 1 g.

[0040] As used in the art, "10 7 CFU / g" in the present application means that 1 g of bacterial agent contains 10 7 CFU level of effective viable bacteria, "10 7 CFU level" means that the effective viable bacteria number of 1 g of bacterial agent reaches 10 7 CFU level. The effective viable bacteria number of 1 g of bacterial agent contains 1 x 10 7 CFU, 5 x 10 7 CFU, 9.9 x 10 7 CFU, etc. all belong to "10 7 CFU level". That is, in the bacterial agent of the present application, the content of the Chitinophagus genus bacteria can be greater than or equal to 1 x 10 7 CFU / g to less than 1 x 10 12 CFU / g.

[0041] For example, in the bacterial agent, the content of the Chitinophagus genus bacteria can be 1 x 10 7 CFU / g, 2 x 10 7 CFU / g, 3 x 10 7 CFU / g, 4 x 10 7 CFU / g, 5 x 10 7 CFU / g, 6 x 10 7 CFU / g, 7 x 10 7 CFU / g, 8 x 10 7 CFU / g, 9 x 10 7 CFU / g, 1 x 10 8 CFU / g, 2 x 10 8 CFU / g, 3 x 10 8 CFU / g, 4 x 10 8 CFU / g, 5 x 10 8 CFU / g, 6 x 10 8 CFU / g, 7 x 10 8 CFU / g, 8 x 10 8 CFU / g, 9 x 10 8 CFU / g, 1 x 10 9 CFU / g, 2 x 10 9 CFU / g, 3 x 10 9 CFU / g, 4 x 109 CFU / g, 5 x 10 9 CFU / g, 6 x 10 9 CFU / g, 7 x 10 9 CFU / g, 8 x 10 9 CFU / g, 9 x 10 9 CFU / g, 1 x 10 10 CFU / g, 2 x 10 10 CFU / g, 3 x 10 10 CFU / g, 4 x 10 10 CFU / g, 5 x 10 10 CFU / g, 6 x 10 10 CFU / g, 7 x 10 10 CFU / g, 8 x 10 10 CFU / g, 9 x 10 10 CFU / g, 1 x 10 11 CFU / g, 2 x 10 11 CFU / g, 3 x 10 11 CFU / g, 4 x 10 11 CFU / g, 5 x 10 11 CFU / g, 6 x 10 11 CFU / g, 7 x 10 11 CFU / g, 8 x 10 11 CFU / g, 9 x 10 11 CFU / g, 9.5 x 10 11 CFU / g, 9.9 x 10 11 CFU / g, or also can be the range of any two values described above, or any intermediate value in the range.

[0042] The third aspect of the present application provides the use of the Paenibacillus sp. of the first aspect, or the microbial inoculant of the second aspect, the use comprising at least one of:

[0043] (1) preparing beta-glucosidase;

[0044] (2) preparing siderophore;

[0045] (3) preparing auxin;

[0046] (4) promoting plant growth;

[0047] (5) preparing microbial fertilizer.

[0048] Beta-glucosidase belongs to the cellulase family and is an important component of the cellulolytic enzyme system. Beta-glucosidase participates in the metabolic process of plant cell walls, helps the reconstruction and renewal of plant cell walls, and supports the growth and development of plants. Beta-glucosidase can hydrolyze non-reducing end sugar groups, activate plant hormones such as indole acetic acid (IAA), jasmonic acid (JA), and salicylic acid (SA), and participate in the regulation of plant stem and leaf growth, vascular tissue differentiation, fertility, seed germination, and other aspects, thereby playing a key role in the growth and development of plants.

[0049] Iron carrier is a low-molecular-weight compound that chelates iron for the uptake of iron elements. Through the action of the iron carrier, the iron elements in the form of oxides and the like that plants cannot directly utilize are converted into a form that plants can directly utilize, thereby promoting the absorption of iron by plants and further promoting the growth and development of plants.

[0050] Auxin is a general term for a class of plant hormones, the chemical nature of which is indole acetic acid or its analogues or derivatives. Low concentrations promote plant growth, and high concentrations inhibit plant growth. Auxin participates in physiological processes such as plant growth and development, flowering, and fruit ripening.

[0051] The strain provided by the present application can efficiently synthesize beta-glucosidase, iron carrier, and auxin in the metabolic process, and thus can be used in the preparation and production of the above-mentioned substances. The beta-glucosidase, iron carrier, and auxin produced by the strain provided by the present application can be applied to plants and used as biological fertilizers or plant nutrients.

[0052] In the present application, the above-mentioned use (4) refers to the use of the strain provided by the present application or its culture, metabolites, and other substances produced by the strain on plants, thereby accelerating the growth and development process, increasing yield, or improving product quality.

[0053] As described above, the strain provided by the present application can produce a variety of substances that promote the growth and development of plants, and thus any plant that grows and develops after being affected by these substances can be applied to the use (4) of the present application. According to some preferred embodiments of the present application, the plant is selected from Solanaceae plants.

[0054] According to a particularly preferred embodiment of the present application, the plant is a tomato.

[0055] The strain provided by the present application can be directly applied to plants and can promote plant growth, and thus a microbial fertilizer can be prepared using the strain of the present application.

[0056] In the present application, the use (5) includes directly using the strain of the present application as a microbial fertilizer, and can also include mixing the strain of the present application with other fertilizer raw materials or further processing to obtain a microbial fertilizer containing (with activity) the strain.

[0057] According to some preferred embodiments of the present application, the use (5) can include preparing a microbial fertilizer by using the Chitinophagus sp. YIM B11428 as a microbial agent. The microbial agent is characterized as described above, and will not be repeated here.

[0058] The fourth aspect of the present application provides a method for preparing β-glucosidase, which comprises culturing the Chitinophagus sp. of the first aspect.

[0059] The fifth aspect of the present application provides a method for preparing siderophore, which comprises culturing the Chitinophagus sp. of the first aspect.

[0060] The sixth aspect of the present application provides a method for preparing auxin, which comprises culturing the Chitinophagus sp. of the first aspect.

[0061] In the present application, the methods for preparing β-glucosidase, siderophore and auxin can use the same method to culture the Chitinophagus sp. YIM B11428, or can use different methods to culture the Chitinophagus sp. YIM B11428 (for example, optimizing the culture method according to the production conditions of different metabolites to improve the yield of target products, etc.).

[0062] According to some preferred embodiments of the present application, the culture conditions include that the culture temperature is 25-35℃. For example, it can be 25℃, 26℃, 27℃, 28℃, 29℃, 30℃, 31℃, 32℃, 33℃, 34℃, 35℃, or can also be a range formed by any two of the above values, or any intermediate value of the range.

[0063] Preferably, different culture media can be used to improve the yield of target metabolites when preparing β-glucosidase, siderophore and auxin. Those skilled in the art can select appropriate culture media for the production of target metabolites according to the prior art, which will not be repeated here.

[0064] The seventh aspect of the present application provides a method for promoting plant growth, which comprises applying the Chitinophagus sp. of the first aspect or its culture, or the microbial agent of the second aspect to the rhizosphere soil of the plant.

[0065] According to some preferred embodiments of the present application, the culture of the Chitinophagus genus refers to a culture product obtained after culturing the Chitinophagus genus YIM B11428, which can be a culture solution (containing the Chitinophagus genus YIM B11428 and metabolites) or a product obtained after processing the culture solution (e.g. filtering to obtain a culture solution containing only metabolites, or further purification to obtain one or more desired metabolites).

[0066] Preferably, the culture includes at least one of the Chitinophagus genus YIM B11428, β-glucosidase, siderophore, and auxin.

[0067] According to some preferred embodiments of the present application, the Chitinophagus genus or the culture thereof is applied in an amount such that the effective viable number of the Chitinophagus genus is not less than 10 7 CFU / strain / time.

[0068] Preferably, the Chitinophagus genus or the culture thereof is applied in an amount such that the effective viable number of the Chitinophagus genus is 10 7 -10 13 CFU / strain / time, preferably 10 9 -10 11 CFU / strain / time. For example, it can be 1 x 10 9 CFU / g, 2 x 10 9 CFU / g, 3 x 10 9 CFU / g, 4 x 10 9 CFU / g, 5 x 10 9 CFU / g, 6 x 10 9 CFU / g, 7 x 10 9 CFU / g, 8 x 10 9 CFU / g, 9 x 10 9 CFU / g, 1 x 10 10 CFU / g, 2 x 10 10 CFU / g, 3 x 10 10 CFU / g, 4 x 10 10 CFU / g, 5 x 10 10 CFU / g, 6 x 10 10 CFU / g, 7 x 10 10 CFU / g, 8 x 10 10 CFU / g, 9 x 10 10 CFU / g, 1 x 10 11 CFU / g, 2 x 10 11 CFU / g, 3 x 10 11 CFU / g, 4 x 10 11CFU / g, 5 x 10 11 CFU / g, 6 x 10 11 CFU / g, 7 x 10 11 CFU / g, 8 x 10 11 CFU / g, 9 x 10 11 CFU / g, 9.5 x 10 11 CFU / g, 9.9 x 10 11 CFU / g, or also a range between any two of the values mentioned above, or any intermediate value of this range.

[0069] According to some preferred embodiments of the application, the amount of the bacterial agent is such that the number of viable Paenibacillus bacteria is not less than 10 7 CFU / strain / time.

[0070] Preferably, the amount of the bacterial agent is such that the number of viable Paenibacillus bacteria is 10 7 - 10 13 CFU / strain / time, preferably 10 9 - 10 11 CFU / strain / time. For example, it can be 1 x 10 9 CFU / g, 2 x 10 9 CFU / g, 3 x 10 9 CFU / g, 4 x 10 9 CFU / g, 5 x 10 9 CFU / g, 6 x 10 9 CFU / g, 7 x 10 9 CFU / g, 8 x 10 9 CFU / g, 9 x 10 9 CFU / g, 1 x 10 10 CFU / g, 2 x 10 10 CFU / g, 3 x 10 10 CFU / g, 4 x 10 10 CFU / g, 5 x 10 10 CFU / g, 6 x 10 10 CFU / g, 7 x 10 10 CFU / g, 8 x 10 10 CFU / g, 9 x 10 10 CFU / g, 1 x 10 11 CFU / g, 2 x 10 11 CFU / g, 3 x 10 11 CFU / g, 4 x 10 11 CFU / g, 5 x 10 11 CFU / g, 6 x 10 11 CFU / g, 7 x 1011 CFU / g, 8x10 11 CFU / g, 9x10 11 CFU / g, 9.5x10 11 CFU / g, 9.9x10 11 CFU / g, or also can be the range of any two values described above, or any intermediate value in the range.

[0071] Preferably, the plant is a Solanaceae plant, preferably a tomato.

[0072] According to some preferred embodiments of the present application, the application frequency of the Paenibacillus chondritus or culture thereof, or the microbial agent can be 1-3 times for a crop. A crop refers to the planting period from planting to harvesting, and the planting period of different crops is different. Those skilled in the art can determine the application time of the Paenibacillus chondritus or culture thereof or microbial agent of the present application to different crops according to the growth characteristics and growth conditions of the crops themselves, combined with the application frequency provided in the present application. Since the Paenibacillus chondritus of the present application can promote the growth of roots and leaves when applied to crop seedlings, and also can promote flowering, in order to obtain better planting effect, shorten the planting period, and improve crop yield and agricultural product quality, it is preferred to apply at least once during the seedling stage of the crop.

[0073] The eighth aspect of the present application provides a microbial fertilizer, which comprises the Paenibacillus chondritus of the first aspect or the microbial agent of the second aspect.

[0074] According to preferred embodiments of the present application, the microbial fertilizer can further comprise an auxiliary material. Auxiliary materials refer to other materials used in the preparation of fertilizers, especially microbial fertilizers, in addition to active components (i.e. active microorganisms), such as culture media for culturing microorganisms or protecting microbial activity, diluents, buffers (such as phosphate buffer, sodium bicarbonate, magnesium oxide), excipients (such as tapioca starch, sorbitol), protective agents (such as sugar protective agents, sodium glutamate, calcium chloride), etc.

[0075] The present application will be described in detail below by way of examples. It should be understood that the following examples are only used to exemplarily further explain and illustrate the content of the present application, and are not used to limit the present application.

[0076] In the following examples, unless otherwise specified, the reagents and materials used are commercially available products purchased from regular biological or chemical suppliers, and the purity of the reagents is analytical pure.

[0077] Example 1

[0078] This example is used to illustrate the obtaining, identification and preservation of the Chitinophagus sp. YIM B11428.

[0079] (I) Obtaining of the strain

[0080] In the Ganba fungus conservation area of Wuding County, Chuxiong Yi Autonomous Prefecture, Yunnan Province, China, the soil samples were collected by digging the soil about 5 cm deep from the surface of the fungus pond within a diameter range of 20 cm after removing the plant litter such as dead branches and leaves on the surface.

[0081] The preparation method of the culture medium used in the strain isolation and purification is as follows:

[0082] The BG11 culture medium, photosynthetic bacterial culture medium and plate counting broth culture medium (PCB culture medium) were mixed at a weight ratio of 1:1:1, and then 20 g / L agar was added and sterilized at 121°C for 20 min. Among them, the BG11 culture medium, photosynthetic bacterial culture medium and PCB culture medium were purchased from Haibo Biotechnology Co., Ltd. (product numbers are HB8793, HB8882 and HB8756, respectively).

[0083] The soil sample 2 g was taken from the soil of the fungus pond in a 300 mL conical flask containing 198 mL of sterile water, and a proper amount of glass beads was added. The flask was placed in a shaker at 30°C and 140 r / min for 4-6 h. 200 μL of the solution was taken and diluted to 10 -4 and 10 -5 concentrations on the culture medium mentioned above, and then placed in a 30°C constant temperature incubator for culture for 3-5 days. Single colonies with different morphological characteristics were picked and purified for numbering.

[0084] A strain was obtained from the fungus pond soil sample through the above steps, which was named Chitinophagus sp. YIM B11428.

[0085] (II) Identification of the strain

[0086] 1. Molecular biology identification

[0087] The total DNA of the strain YIM B11428 was obtained by Chelex-100 rapid extraction method as a template, and 27F (5'-AGAGTTTGATCCTGGCTCAG-3', SEQ ID NO: 1) and 1492R (5'-TACGACTTAACCCCAATCGC-3', SEQ ID NO: 2) were used as primers. The reaction system and conditions in Table 1 were used for 16S rRNA gene amplification.

[0088] Table 1

[0089]

[0090] The amplification product was purified by 1% agarose gel electrophoresis (gel recovery and purification kit produced by Guangzhou Meiji Biological Technology Co., Ltd.) and sent to Beijing Qikexin Biological Technology Co., Ltd. for sequencing. The sequencing result is shown as SEQ ID NO: 3:

[0091] GTAGCAATACTGGGTGGCGACCGGCAAACGGGTGCGGAACACGTACGCAACCTTCCTTGAAGC

[0092] GGGGGATAGCCCGAAGAAATTCGGATTAATACCCCGTAGTATGGTGGAGAGGCATCTTTCTAT

[0093] CATTAAAGCTCCGGCACTTTAAGATGGGCGTGCGTCTGATTAGGTAGTTGGTGAGGTAACGGCT

[0094] CACCAAGCCGACGATCAGTAACTGGCGTGAGAGCGCGACCAGTCACACGGGCACTGAGACACG

[0095] GGCCCGACTCCTACGGGAGGCAGCAGTAAGGAATATTGGTCAATGGACGCAAGTCTGAACCAG

[0096] CCATGCCGCGTGGAGGATGAAGGTCCTCTGGATTGTAAACTTCTTTTATTTGGGAAGAAATGTG

[0097] GGTTTTCTAACTCATTTGACGGTACCAGATGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCG

[0098] CGGTAATACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGCGGAT

[0099] CTGTAAGTCAGTGGTGAAATCTCCGAGCTTAACTCGGAAACTGCCGTTGATACTATAGATCTTG

[0100] AATGTTGTGGAGGTTAGCGGAATATGTCATGTAGCGGTGAAATGCATAGATATGACATAGAAC

[0101] ACCAATTGCGAAGGCAGCTGGCTACACAAATATTGACGCTGAGGCACGAAAGCGTGGGGATCA

[0102] AACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGGATACTCGACATTTGCGATATAC

[0103] AGTAAGTGTCTGAGCGAAAGCATTAAGTATCCCACCTGGGAAGTACGACCGCAAGGTTGAAAC

[0104] TCAAAGGAATTGACGGGGGTCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGATACGCG

[0105] AGGAACCTTACCTGGGCTAGAATGCTGGGGGACTATGGGTGAAAGCTCATATTGTAGCAATAC

[0106] ACCGCCAGTAAGGTGCTGCATGGCTGTCGTCAGCTCGTGCCGTGAGGTGTTGGGTTAAGTCCCG

[0107] CAACGAGCGCAACCCCTATCTTTAGTTGCCAACAGGTTAAGCTGGGAACTCTAAAGAAACTGC

[0108] CGTCGTAAGACGCGAGGAAGGAGGGGATGATGTCAAGTCATCATGGCCTTTATGCCCAGGGCT

[0109] ACACACGTGCTACAATGGTAGGAACAAAGGGCTGCTACCTGGTAACAGGATGCTAATCTCAAA

[0110] AATCCTATCTCAGTTCGGATTGAGGGCTGCAACTCGCCCTCATGAAGCTGGAATCGCTAGTAAT

[0111] CGTATATCAGCAATGATACGGTGAATACGTTCCCGGACCTTGTACACACCGCCCGTCAAGCCATGAA(SEQ ID NO:3)

[0112] The sequencing results were compared and analyzed with the EzBioCloud online platform (https: / / www.ezbiocloud.net / ), and the strain was preliminarily identified. Then, the 16S rRNA sequence of the model strain with higher homology was selected as a reference comparison object in the LPSN platform (https: / / www.bacterio.net / List of Prokaryotic names with Standing in Nomenclature), and the similarity between the test strain and the reference strain was calculated by multiple sequence alignment using the Mega 7.0 software; the Neighbor Joining analysis was used to continue to use the MEGA 7.0 software to exclude base deletion sites, and the phylogenetic tree between the test strain and the reference strain was constructed; the Bootstrap value was set to 1000, and the rest were default values.

[0113] Figure 1 The phylogenetic tree of Chitinophaga YIM B11428 based on the Neighbor Joining analysis is shown, from which it can be seen that Chitinophaga YIM B11428 has the highest homology with Chitinophaga parva LY 1, but the homology rate is 97.52%, which is lower than 98.7%. According to the minimum standard proposed by Jongsik Chun in 2018 for prokaryotic classification using genomic data, it can be judged that the strain YIM B11428 is a new species of Chitinophaga.

[0114] The whole genome sequencing result of the strain YIM B11428 shows that its ANI value with the nearest strain Chitinophaga parva LY 1 is 81.81%, which is lower than the critical value of 95-96% recommended by the ANI standard, at the same time, the dDDH value is 32.77%, which is also lower than the standard value of 70%, and the G+C content is 52.36%, which meets the range of Chitinophaga genus; it is judged that the strain YIM B11428 is a new species of Chitinophaga.

[0115] 2. Morphology and physiological and biochemical characteristics identification

[0116] The physiological and biochemical characteristics of Chitinophaga YIM B11428 were determined according to the "Berger Bacterium Identification Manual" and "Common Bacterium System Identification Manual", and the colony morphology characteristics.

[0117] Colony and cell morphology: on R2A medium, the colony showed orange yellow, approximate circular shape, smooth edge, shiny surface, slightly convex in the middle of the colony, and wet and opaque (see Figure 2A); except for R2A medium, strain YIM B11428 also grew in NA and LB medium, but could not grow on TSB medium; by transmission electron microscopy observation, the cells were rod-shaped (about 500 nm in diameter), without flagella and spores (as shown in Fig. 1). Figure 2 B).

[0118] Physiological and biochemical characteristics: the strain was identified as a gram-negative bacterium by gram staining experiment; it was found to be non-motile by observation on semi-solid agar medium; the temperature tolerance range was 0-40℃, the pH tolerance range was 6.0-10.0, and the salt tolerance range was 0-1.5% (w / v); it had certain acid and alkali resistance and salt tolerance. It was hydrogen peroxide enzyme negative, oxidase positive, and strictly aerobic. Further comparison of the phenotypic characteristics of the strain with the reference standard strain Chitinophaga parva LY 1 showed the results as shown in Table 2.

[0119] Table 2

[0120]

[0121] In Table 2, "+" indicates positive, "-" indicates negative, and "w" means weakly positive.

[0122] According to the comparison results, it can be obtained that both of the two tested strains have the abilities of D-glucose fermentation, D-mannose assimilation, N-acetylglucosamine assimilation, D-maltose assimilation, cystine arylamidase, trypsin and a-glucosidase; but there is a significant difference in the utilization of nitro-beta-D-methyl galactoside between the two strains, YIM B11428 cannot utilize the substance, does not have beta-galactosidase, and the relatively obvious difference in enzyme activity between the two is that Chitinophaga parva LY 1 does not have trypsin but has esterase (C4) and beta-glycosidase activity, while strain YIM B11428 is just the opposite.

[0123] In combination with the molecular biology detection results of strain YIM B11428 and the bacterial morphology and physiological and biochemical characteristics detection results, the strain is identified as a new species strain of Chitinophaga, which is named Chitinophaga sp.

[0124] (III) Preservation of the strain

[0125] The Chitinophaga sp. strain YIM B11428 isolated as described above was preserved in the China General Microbiological Culture Collection Center on January 9, 2025, with the preservation number of CGMCC NO. 1.62395, and the address of the preservation unit is No. 1, Beichen West Road, Yard 3, Chaoyang District, Beijing.

[0126] Example 2

[0127] This example is used to illustrate the effect of β-glucosidase, siderophore and IAA produced by the Chitinophagus sp. YIM B11428.

[0128] (I) β-glucosidase

[0129] Esculin medium (g / L): Proteose peptone 5; Potassium phosphate dibasic 1; Ferric citrate 0.5; Esculin 3; Agar 2; pH adjusted to 7.3±0.1.

[0130] The Chitinophagus sp. YIM B11428 was inoculated on the esculin plate and slant medium by streaking and three-point method, respectively, and incubated in a 30°C incubator. The color of the medium was observed every day during the incubation. If the color of the medium turned black, it indicated that the strain could hydrolyze esculin and produce β-glucosidase, which was a positive result. Otherwise, it was a negative result.

[0131] Figure 3 The color change of the plate and slant medium on the third day of incubation is shown in the figure. It can be seen from the figure that the color of the medium turned dark and the color of the colony position was black, indicating that the strain had good ability to produce β-glucosidase.

[0132] (II) Siderophore

[0133] The CAS detection medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.) was used to detect the ability of producing siderophore.

[0134] The Chitinophagus sp. YIM B11428 was inoculated on the CAS solid medium by four-point inoculation method and incubated in a 30°C incubator for about 10 days. The size of the orange-yellow halo was observed and the ratio of the halo diameter (D) to the colony diameter (d) was recorded.

[0135] Figure 4 The halo on the CAS medium is shown in the figure. It can be seen that the Chitinophagus sp. YIM B11428 could produce siderophore. The ratio of the halo diameter to the colony diameter D / d was about 1.2 / 0.4, indicating that the strain had good ability to produce siderophore.

[0136] (III) IAA

[0137] KB medium: Proteose peptone 20 g / L; Glycerol 15 ml / L, K2HPO4 1.5 g / L; MgSO4·7H2O 1.5 g / L; Tryptophan 0.1 g / L; pH 7.2±0.2.

[0138] Sackowcki's reagent: 150 mL of concentrated sulfuric acid was slowly added to 250 mL of deionized water while stirring, and after the solution cooled, 7.5 mL of a 0.5 mol / L FeCl3·6H2O solution was added.

[0139] A single colony of ammonia-philic bacteria YIM B11428 was inoculated into KB medium and cultured at 30°C with 180 rpm shaking for 48 h. 1 mL of the fermentation broth was quickly mixed with 4 mL of Sackowcki's reagent in a centrifuge tube under sterile conditions, and color development was observed after 40 min of color development at room temperature in the dark. If pink color appeared, it was positive, indicating that the strain could secrete IAA.

[0140] 1 mL of KB medium was mixed with 4 mL of Sackowcki's reagent as a control (CK), and the reaction products were dropped onto white ceramic plates for color development. The results are shown in Table 1. Figure 5 As can be seen from Table 1, the YIM B11428 culture showed obvious pink color, indicating that the strain had good ability to secrete IAA.

[0141] Example 3

[0142] This example is used to illustrate the growth-promoting effect of chitinophilic bacteria YIM B11428 on tomatoes.

[0143] 1. Bacterial agent

[0144] YIM B11428 was inoculated into 300 mL of NB medium (purchased from Qingdao Haibo Biotechnology Co., Ltd.) and cultured at 30°C with 180 rpm shaking for 72 h to obtain a culture with a viable bacterial count of about 1 x 10 9 CFU / mL. The culture or its dilution (diluted with sterilized NB medium) was used as a liquid bacterial agent for subsequent growth-promoting experiments.

[0145] 2. Experimental plants

[0146] The same amount of soil was added to the flowerpots, and the tomato seedlings with similar growth were randomly grouped according to 3 pots per treatment. Each pot was planted with 3 seedlings.

[0147] 3. Experimental treatment

[0148] Each group was treated with different reagents (the same amount of reagent was used in each group) for root irrigation, and the growth of tomato seedlings in each group was observed. The treatment reagents for each group were as follows:

[0149] Control group:

[0150] CK1: sterilized NB liquid medium;

[0151] CK2: sterilized water;

[0152] Experimental group:

[0153] T1: liquid inoculum, YIM B11428 content 1 x 10 9 CFU / mL;

[0154] T2: liquid inoculum, YIM B11428 content 1 x 10 8 CFU / mL;

[0155] T3: liquid inoculum, YIM B11428 content 1 x 10 7 CFU / mL.

[0156] The tomato seedlings were treated with 100 mL / plant of the treatment reagent on the 7th day after transplanting to the flower pots, and then the treated tomato seedlings were placed in the greenhouse for growth, and the soil moisture was kept sufficient during the period. The number of tomato plant leaves, ground diameter, and plant height were measured every week for 4 weeks; in the 4th week, in addition to measuring the above parameters, the tomato plants were carefully dug out, washed with rhizosphere adhering soil, and the root length of the tomato plants was measured. The measurement method is as follows:

[0157] Leaf number: count the leaves in normal state, excluding the fallen and withered leaves.

[0158] Plant height: the height from the top of each tomato plant to the soil surface of the flower pot was measured by a ruler, and the average value ± standard deviation was taken as the plant height of the tomato plant.

[0159] Ground diameter: the diameter of each tomato stem was measured at about 1 ± 0.2 cm from the soil surface of the flower pot by a vernier caliper, and the average value ± standard deviation was taken as the ground diameter of the tomato plant.

[0160] Root length: the underground part of each tomato plant was dug out, washed, and then the distance from the root end to the top of the root tip was measured by a ruler, and the average value ± standard deviation of each group was taken as the root length of the tomato plant.

[0161] 4. Measurement results

[0162] The measurement results of the 3rd week and the 4th week are shown in Table 3 and Table 4 (Note: in Table 3 and Table 4, different superscript letters indicate significant difference (P<0.05), and the data in the table is the average value ± standard error).

[0163] Table 3

[0164] Parameter CK1 CK2 T1 T2 T3 Leaf number (piece) 50.50 ± 0.50 bc ]] 48.67 ± 3.00 c ]] 57.84 ± 2.84 ab ]]> 60.09 ± 1.42 a ]]> 47.34 ± 1.67 c <!-- 10 -->]]> Plant height (cm) 12.25 ± 0.75 ab ]] 11.09 ± 1.09 b ]] 14.34 ± 0.17 a ]] 14.50 ± 1.50 a ]]> 14.04 ± 0.21 a ]] Ground diameter (mm) 3.99 ± 0.04 b ]] 4.51 ± 0.12 ab ]] 4.79 ± 0.28 a ]] 4.53 ± 0.24 ab ]] 4.25 ± 0.05 ab ]]

[0165] Table 4

[0166] Parameter CK1 CK2 T1 T2 T3 Leaf number (piece) 53.84 ± 1.17 bc ]] 50.67 ± 1.67 c ]]> 65.84 ± 4.17 a ]] 66.17 ± 2.84 a ]]> 61.33 ± 3.00 ab ]] Plant height (cm) 15.25 ± 1.58 a ]] 12.67 ± 1.17 a ]] 15.67 ± 0.84 a ]] 15.59 ± 0.59 a ]] 17.09 ± 1.42 a ]] Ground diameter (mm) 4.54 ± 0.33 a ]] 4.78 ± 0.03 a ]] 5.01 ± 0.20 a ]] 4.87 ± 0.20 a ]] 4.62 ± 0.13 a ]] Root length (cm) 28.35 ± 1.90 a ]] 19.50 ± 0.75 a ]] 29.82 ± 3.74 a ]] 28.66 ± 4.13 a ]] 31.08 ± 4.76 a ]]

[0167] It is calculated that after the third week of tomato growth after root irrigation, the average leaf number of T2 group is significantly higher than that of CK1 group by 19% and CK2 group by 23%; the average ground diameter of T1 group is significantly higher than that of CK1 group by 20%; in addition, the average plant height of the experimental groups is greater than that of CK1 group and is also significantly greater than that of CK2 group, among which T1 and T2 treatment groups are relatively better, which are 17% and 18% higher than CK1 group and significantly 29% and 31% higher than CK2 group. After the fourth week of tomato growth after root irrigation, the average leaf number, plant height, ground diameter and root length of T1 and T2 groups are greater than those of the control groups; among them, the leaf number of T2 group is significantly higher than that of CK1 group by 23% and CK2 group by 31%, the plant height of T3 group is 12% higher than that of CK1 group, and the ground diameter of T1 group is 10% higher than that of CK1 group.

[0168] Figure 6 The measurement results of the leaf increase number (A), plant height growth (B) and ground diameter growth (C) of tomato plants at the end of growth and at the beginning of the control groups CK1, CK2 and the experimental groups T1, T2 and T3 are shown in FIGS. 13A, 13B and 13C, respectively. Figure 6 As can be seen from (A), the leaf increase number of T2 group and the control group has a significant difference, which is significantly higher than CK1 group by 1.65 times and CK2 group by 2.63 times, and the leaf increase number of T1 and T3 groups is also significantly higher than that of CK2 group; according to the results of the experiment, it is found that the leaf increase number of T2 group is significantly higher than that of CK1 group and CK2 group, and the leaf increase number of T1 and T3 groups is also significantly higher than that of CK2 group. Figure 6 (B and C) can be seen that T2 group is higher than the control group in plant height growth and ground diameter growth, plant height growth is 1.14 times and 2.3 times higher than CK1 group and CK2 group respectively, and ground diameter growth is 3.09 times and 1.89 times higher than CK1 group and CK2 group respectively.

[0169] Figure 7 From left to right, the comparison results of tomato plants of CK2, CK1, T1, T2 and T3 groups are shown, it can be seen that the root length, leaf number and root hair density of the experimental groups are better than those of the control groups, and the plant growth of the experimental groups is generally better; the experimental groups bloom earlier than CK2 group, among which the number of flowers of T2 group is relatively more.

[0170] From the above results, it can be seen that after YIM B11428 is applied to rhizosphere soil, it has a good growth promoting effect on tomato seedling leaf, root length, plant height, ground diameter, etc., especially for tomato leaf, which has a significant growth promoting effect, which has a certain positive influence on the photosynthesis and sugar and water accumulation of tomato plants, and can improve the quality of tomato fruits; in addition, it is also the first time to find that bacteria of Chitinophagus genus have growth promoting effect on Solanaceae plants.

[0171] The preferred embodiments of the present application are described in detail above, but the present application is not limited thereto. Within the technical concept of the present application, various simple modifications can be made to the technical solutions of the present application, including that each technical feature is combined in any other suitable manner. These simple modifications and combinations should also be considered as disclosed by the present application and fall within the protection scope of the present application.

Claims

1. A chitinophilic fungus ( Chitinophaga sp. ), characterized in that, The Chitinophaga sp. has a preservation number of CGMCC No. 1.62395.

2. An inoculant characterized in that, The microbial agent comprises the Chitinophaga sp. according to claim 1.

3. The microbial agent of claim 2, wherein, The content of the Paenibacillus sp. in the bacterial agent is not less than 10 7 CFU / g.

4. The microbial agent of claim 3, wherein, The content of the Paenibacillus sp. in the bacterial agent is 10 7 -10 11 CFU / g.

5. Use of the chitinophilic bacteria according to claim 1 or of the bacterial agent according to any one of claims 2 to 4, characterized in that, The use comprises at least one of the following: (1) preparing β-glucosidase; (2) preparing siderophore; (3) preparing auxin; (4) promoting plant growth; (5) preparing microbial fertilizer.

6. Use according to claim 5, wherein, The plant is selected from Solanaceae plants.

7. Use according to claim 6, wherein, The plant is tomato.

8. A method of producing a β-glucosidase, characterized by, The method comprises culturing the Chitinophaga sp. according to claim 1.

9. A method of preparing a siderophore, characterized by, The method comprises culturing the Chitinophaga sp. according to claim 1.

10. A method of preparing a growth hormone, characterized by, The method comprises culturing the Chitinophaga sp. according to claim 1.

11. A method of promoting plant growth, characterized by, The method comprises applying the Chitinophaga sp. according to claim 1 or a culture thereof, or the microbial agent according to any one of claims 2-4, to the rhizosphere soil of the plant.

12. A microbial inoculant, characterized in that, The microbial fertilizer comprises the Chitinophaga sp. according to claim 1, or the microbial agent according to any one of claims 2-4.

Images