Phi29 DNA polymerase mutant and application thereof

Abstract

The invention relates to the technical field of biology, in particular to a phi29 DNA polymerase mutant and application thereof. The protein provided by the invention is selected from at least one of the following items: (A), the protein is an amino acid sequence compared with a wild type phi29 DNA polymerase and comprises at least one of the following mutation sites: M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S and / or F526L; (B) the protein is an amino acid sequence compared with phi29 DNA polymerase and has at least one palm structural domain; according to the mutation form of the phi29 DNA polymerase, the amplification efficiency and capability of non-natural substrates under the catalysis of Mg < 2 + > can be remarkably improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a phi29 DNA polymerase mutant and a use thereof. Background Art

[0002] DNA polymerase plays a vital role in regulating the process of DNA replication in the body. It participates in and ensures the accurate transmission of genetic information in the body. With the continuous advancement of science and technology, the research on the transformation of polymerase is also deepening, which has enabled the gradual improvement and development of DNA molecular sequencing technology. In the polymerase-nanopore sequencing system, a clear electrochemical signal can be generated. This process is highly dependent on whether the polymerase can effectively use artificial substrates for synthesis. The efficiency of this synthesis directly affects the accuracy and speed of sequencing. Therefore, the optimization of polymerase function is the key to improving the performance of sequencing technology.

[0003] Phi29 DNA polymerase is a polymerase derived from the Phi29 bacteriophage in Bacillus subtilis and is classified as a family B DNA polymerase. This enzyme is favored for its excellent processivity, strand displacement activity, high fidelity, and low amplification bias. It is widely used in the amplification of DNA libraries in rolling circle replication or multiple displacement amplification techniques to meet the large number of libraries required for gene sequencing. However, due to the fact that Phi29 DNA polymerase uses Mg 2+ When ion catalyzed, it is difficult to use artificially modified substrates to extend and amplify DNA, which to some extent limits its potential for application in nanopore sequencing technology. Therefore, in order to make Phi29 DNA polymerase better adapt to the needs of polymerase-nanopore sequencing systems, scientists need to continuously improve and optimize its properties. Summary of the invention

[0004] Therefore, the technical problem to be solved by the present invention is to provide a phi29 DNA polymerase mutant and its use.

[0005] To this end, the present invention provides the following technical solutions:

[0006] A protein selected from at least one of the following:

[0007] (A), the protein is an amino acid sequence compared to the wild-type phi29 DNA polymerase, comprising at least one of the following mutation sites: M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L;

[0008] (B) The protein has at least one palm domain compared to the amino acid sequence of the wild-type phi29 DNA polymerase, thereby obtaining a protein with DNA polymerase activity.

[0009] Optionally, the palm domain is located between positions 86 and 87 of the wild-type phi29 DNA polymerase;

[0010] Optionally, the amino acid sequence of the palm domain is KTVFSKGAPYQTVTDVEE (see SEQ ID NO. 26).

[0011] Optionally, the wild-type phi29 DNA polymerase has an amino acid sequence as shown in SEQ ID NO.21.

[0012] Optionally, the protein has an amino acid sequence as shown in any of SEQ ID NOs. 1 to 10.

[0013] The present invention provides a biomaterial, which is any one of the following:

[0014] 1) A nucleic acid molecule encoding the protein; optionally, the nucleic acid molecule comprises a DNA molecule or an RNA molecule;

[0015] 2) A vector containing the nucleic acid molecule described in 1).

[0016] The present invention provides the protein and the biomaterial having any of the following uses:

[0017] B1. catalyze DNA replication and / or catalyze DNA amplification;

[0018] B2, catalyzing rolling circle amplification or catalyzing multiple strand displacement amplification;

[0019] B3. Perform DNA sequencing, RNA sequencing or whole genome sequencing;

[0020] B4, construct sequencing library;

[0021] B5. preparing products that catalyze DNA replication and / or catalyze DNA amplification;

[0022] B6. preparing products that catalyze rolling circle amplification or catalyze multiple strand displacement amplification;

[0023] B7. Prepare products for DNA sequencing, RNA sequencing or whole genome sequencing;

[0024] B8. Prepare products for constructing sequencing libraries.

[0025] Optionally, the use includes:

[0026] Utilize Mg 2+ Catalyze artificially modified substrates for DNA synthesis, replication or amplification, or increase Mg 2+ Selectivity for catalyzing artificially modified substrates for DNA synthesis, replication or amplification.

[0027] Optionally, the artificially modified substrate refers to a deoxyribonucleotide modified with an oligonucleotide or an analog thereof.

[0028] The invention provides an enzyme preparation comprising the protein.

[0029] Optionally, the enzyme preparation is used as a polymerase; Optionally, as a DNA polymerase; Optionally, as a 2+ Catalyze artificially modified substrates for DNA synthesis, replication or amplification or increase Mg 2+ Ion pairs catalyze the synthesis, replication or amplification of DNA by selective DNA polymerases on artificially modified substrates.

[0030] The invention provides a kit for catalyzing DNA replication, catalyzing DNA amplification, library construction or library sequencing, comprising the protein or the biological material.

[0031] The technical solution of the present invention has the following advantages:

[0032] 1. A protein provided by the present invention is selected from at least one of the following: (A) the protein is an amino acid sequence compared to the wild-type phi29 DNA polymerase, comprising at least one of the following mutation sites: M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L; (B) the protein is an amino acid sequence compared to the wild-type phi29 The amino acid sequence of a DNA polymerase has at least one palm domain, and a protein with DNA polymerase activity is obtained; the research results of the present invention reveal an important discovery, that is, the specific mutants M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L obtained by screening, as well as the mutant form of phi29 DNA polymerase having a "palm" domain, can significantly improve the activity of the protein in the presence of magnesium ions (Mg 2+ ) under the conditions of using non-natural substrates for DNA extension amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0034] Figure 1 is the electrophoresis identification result of Ion_1 to Ion_6 polymerases in Example 1 of the present invention;

[0035] Figure 2 is the electrophoresis identification result of Ion_7 to Ion_9 polymerase in Example 1 of the present invention;

[0036] Figure 3 is the electrophoresis identification result of Ion_10-Ion_11 polymerase in Example 1 of the present invention;

[0037] Figure 4 is the recombinant plasmid map constructed in Example 1 of the present invention;

[0038] Figure 5It is the electrophoresis result of the extension products of Ion_1 to Ion_9 polymerases in Example 2 of the present invention;

[0039] Figure 6 This is the electrophoresis result of the extension products of Ion_10-Ion_11 polymerase in Example 2 of the present invention. DETAILED DESCRIPTION

[0040] The following examples are provided for a better understanding of the present invention, but are not intended to limit the best mode of implementation, nor to limit the content and protection scope of the present invention. Any product identical or similar to the present invention obtained by anyone under the inspiration of the present invention or by combining the features of the present invention with other prior arts shall fall within the protection scope of the present invention.

[0041] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0042] Phi29 DNA polymerase is derived from Bacillus subtilis. Phi29 DNA polymerase is widely used in rolling circle replication or multiple displacement amplification techniques. However, when Phi29 DNA polymerase is used in Mg 2+ When ion catalysis is used, it is difficult to use artificially modified substrates for DNA extension and amplification. The artificially modified substrates are modified natural substrates, and the natural substrates are A: deoxyadenine nucleotide (abbreviated as deoxyadenosine), T: deoxythymidine nucleotide (abbreviated as deoxythymidine), C: deoxycytidine nucleotide (abbreviated as deoxycytidine), and G: deoxyguanine nucleotide (abbreviated as deoxyguanosine).

[0043] To this end, an embodiment of the present invention provides a protein selected from at least one of the following:

[0044] (A), the protein is an amino acid sequence compared to the wild-type phi29 DNA polymerase, comprising at least one of the following mutation sites: M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L;

[0045] (B) The protein has at least one palm domain compared to the amino acid sequence of the wild-type phi29 DNA polymerase, thereby obtaining a protein with DNA polymerase activity.

[0046] In some embodiments, the protein has at least 1 amino acid mutation, at least 2 amino acid mutations, at least 3 amino acid mutations, at least 4 amino acid mutations, at least 5 amino acid mutations, at least 6 amino acid mutations, at least 7 amino acid mutations, at least 8 amino acid mutations, at least 9 amino acid mutations, at least 10 amino acid mutations, at least 11 amino acid mutations, at least 12 amino acid mutations, at least 13 amino acid mutations, at least 14 amino acid mutations, at least 15 amino acid mutations, or at least 16 amino acid mutations, which is a range value between any one of the amino acid mutations or any two of the amino acid mutations compared to the amino acid sequence of the wild-type phi29 DNA polymerase. The above-mentioned amino acid mutations include at least one of the following: M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L.

[0047] Further, in some embodiments, the protein is an amino acid sequence compared to the wild-type phi29 DNA polymerase, exemplified by any one amino acid mutation among M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L.

[0048] Further, in some embodiments, the protein is an amino acid sequence compared to the wild-type phi29 DNA polymerase, exemplary including but not limited to: M97K and L253A, M97K and T368M, M97K and Y369E, M97K and E375D, M97K and Q380L, M97K and A382L, M97K and A484R, M97K and A484E, M97K and E508F, M97K and D510M, M97K and V514Q, M97K and V514D, M97K and V514S, L253A and T368M, L253A and Y369E, L253A and E375D, L253A and Q380L, L253A and A382L, L253A and A484R, L253A and A484E, L253A and E508F, L253A and D510M, L253A and V514Q, L253A and V514D, L253A and V514S, T368M and Y369E, T368M and E375D, T368M and Q380L, T368M and A382L, T368M and A484R, T368M and A484E, T368M and E508F, T368M and D510M, T368M and V514Q, T368M and V514D, T368M and V514S, Y369E and E375D, Y369E and Q380L, Y369E and A382L, Y369E and A484R, Y369E and A484E, Y369E and E508F, Y369E and D510M, Y369E and V514Q, Y369E and V514D, Y369E and V514S, E375D and Q380L, E375D and A382L, E375D and A484R, E375D and A484E, E375D and E508F, E375D and D510M, E375D and V514Q, E375D and V514D, E375D and V514S, Q380L and A382L, Q380L and A484R, Q380L and A484E, Q380L and E508F, Q380L and D510M, Q380L and V514Q, Q380L and V514D, Q380L and V514S, A382L and A484R, A382L and A484E, A382L and E508F, A382L and D510M, A382L and V514Q, A382L and V514D, A382L and V514S, A484R and E508F, A484R and D510M, A484R and V514Q, A484R and V514D, A484R and V514S, A484E and E508F, A484E and D510M, A484E and V514Q, A484E and V514D,Any one of the amino acid mutations in A484E and V514S, E508F and D510M, E508F and V514Q, E508F and V514D, E508F and V514S, D510M and V514Q, D510M and V514D, D510M and V514S. ,

[0049] Further, in some embodiments, the protein is an amino acid sequence compared to the wild-type phi29 DNA polymerase, exemplary of which include but are not limited to any group of amino acid mutations among M97K, L253A and T368M, Y369E, E375D and Q380L, A382L, A484R and E508F, E508F, D510M and V514Q, M97K, L253A and V514D, Y369E, E375D and V514S, M97K, E375D and E508F, Y369E, A382L and E508F, L253A, E375D and D510M, etc.

[0050] Further, in some embodiments, the protein is an amino acid sequence compared to the wild-type phi29 DNA polymerase, exemplary of which include but are not limited to any group of amino acid mutations including M97K, L253A, T368M, Y369E and E375D, M97K, V514Q, T368M, A484R and E375D, A484R, E508F, T368M, Y369E and Q380L, A484E, A382L, T368M, Y369E and V514Q, M97K, L253A, A382L, D510M and E375D.

[0051] Further, in some embodiments, the protein is an amino acid sequence compared to the wild-type phi29 DNA polymerase, exemplary of which include but are not limited to M97K, L253A, T368M, Y369E, E375D, Q380L, A382L, A484E, E508F, D510M and V514Q, M97K, L253A, T368M, Y369E, E375D, Q380L, A382L, A484R, E508F, D510M, and V514D, any group of amino acid mutations among M97K, L253A, T368M, Y369E, E375D, Q380L, A382L, A484R, E508F, D510M and V514S.

[0052] Furthermore, in some embodiments, the protein has at least one palm domain compared to the amino acid sequence of the wild-type phi29 DNA polymerase.

[0053] Further, in some embodiments, the protein is an amino acid sequence compared to the wild-type phi29 DNA polymerase, and can have both amino acid mutations and palm domains. The above-mentioned amino acid mutations can be at least 1 amino acid mutation, at least 2 amino acid mutations, at least 3 amino acid mutations, at least 4 amino acid mutations, at least 5 amino acid mutations, at least 6 amino acid mutations, at least 7 amino acid mutations, at least 8 amino acid mutations, at least 9 amino acid mutations, at least 10 amino acid mutations, at least 11 amino acid mutations, at least 12 amino acid mutations, at least 13 amino acid mutations, at least 14 amino acid mutations, at least 15 amino acid mutations, at least 16 amino acid mutations, any one amino acid mutation or the range value between any two amino acid mutations. The above-mentioned palm domain can be at least 1 palm domain.

[0054] Furthermore, in some embodiments, the amino acid sequence of the palm domain may be KTVFSKGAPYQTVTDVEE.

[0055] Furthermore, in some embodiments, the palm domain is located between positions 86 and 87 of the wild-type phi29 DNA polymerase.

[0056] Further, in some embodiments, the amino acid sequence of the wild-type phi29 DNA polymerase has the amino acid sequence shown in SEQ ID NO.21.

[0057] Further, in a preferred embodiment, the protein can be phi29 DNA polymerase Ion_1 (mutation sites are: N62D, M97K, L253A, T368M, Q380L, A382F, A484R, E508F, D510M, F526L), phi29 DNA polymerase Ion_3 (mutation sites are: N62D, M97K, L253A, T368M, Q380L, A382F, A484R, E508F, V514S, F526L), phi29 DNA polymerase Ion_4 (mutation sites are: N62D, M97K, L253A, T368M, Q380L, A382F, A484R, E508F, V514D, F526L), phi29 DNA polymerase Ion_5 (mutation sites are: N62D, M97K, L253A, T368M, Q380L, A382F, A484R, E508F, V514Q, F526L), phi29 DNA polymerase Ion_6 (mutation sites are: N62D, M97K, L253A, T368M, Q380L, A382F, A484R, E508F, F526L), phi29 DNA polymerase Ion_7 (mutation sites are: N62D, L253A, T368M, Q380L, A382F, A484R, F526L), phi29 DNA polymerase Ion_8 (mutation sites are: N62D, L253A, T368M, Y369E, E375D, Q380L, A382F, A484R, F526L), phi29 DNA polymerase Ion_9 (mutation sites are: N62D, L253A, T368M, Q380L, A382L, A484R, F526L), phi29 DNA polymerase Ion_10 (relative to wild-type phi29 DNA polymerase, mutation sites are: M8R, D12A, (sequence between 86 and 87 KTVFSKGAPYQTVTDVEE), M97K, G197D, F526L, E508F, V514Q), phi29 DNA polymerase Ion_11 (mutation sites are: M8R, D12A, M97K, G197D, F526L, E508F, V514Q). Further, the protein has an amino acid sequence as shown in any of SEQ ID NOs. 1 to 10, and the gene sequence encoding the protein is shown in SEQ ID NOs. 11 to 20.

[0058] Further, in some embodiments, the protein may further substitute, delete and / or add at least one amino acid on the basis of the amino acid sequence above, and the resulting enzyme has enzyme activity, in addition to the amino acid mutation and / or palm domain. The number of the substituted, deleted or added amino acids may be any number, such as 1, 3, 5, 7, 10 and above, so that the sequence identity of the amino acid sequence after the change and its corresponding original sequence may be 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or above.

[0059] Further, in some embodiments, the protein is also fused with a tag. In some embodiments, the fusion is at the end of the protein. In some embodiments, the fusion is at the C-terminus. In some embodiments, the tag includes but is not limited to a His tag (such as 6 consecutive histidine residues).

[0060] The present invention provides a biomaterial, which is any one of the following:

[0061] 1) A nucleic acid molecule encoding the protein; optionally, the nucleic acid molecule comprises a DNA molecule or an RNA molecule;

[0062] 2) A vector containing the nucleic acid molecule described in 1).

[0063] As used herein, the terms "polynucleotide" and "nucleic acid molecule" are used interchangeably and include DNA molecules or RNA molecules. DNA molecules can be single-stranded or double-stranded.

[0064] Due to the degeneracy of the genetic code, a large number of polynucleotides that can be used to encode the enzyme of the present invention can be obtained. Therefore, in the case of a specific amino acid sequence having been identified, those skilled in the art can prepare any number of different nucleic acids by simply modifying the sequence of one or more codons in a manner that does not change the amino acid sequence of the encoded protein. A more preferred polynucleotide can be selected through codon optimization according to the preference of the host cell used in the actual preparation process.

[0065] The polynucleotide can be obtained by conventional methods, such as PCR amplification or artificial synthesis, etc. Currently, the polynucleotide sequence can be obtained completely by chemical synthesis.

[0066] In some embodiments, the vector may be a recombinant vector or an expression vector, and the vector may be transformed into a host cell to express the nucleic acid molecule or the enzyme.

[0067] As used in the present invention, "vector" refers to a construct capable of delivering one or more target genes or sequences to a host cell, preferably expressed in a host cell. Vectors include, but are not limited to, viral vectors, naked DNA or RNA expression vectors, plasmids, cosmids, or phage vectors, DNA or RNA expression vectors combined with cationic condensing agents, and DNA or RNA expression vectors encapsulated in liposomes.

[0068] The embodiments of the present invention provide that the protein and the biomaterial have any of the following uses:

[0069] B1. catalyze DNA replication and / or catalyze DNA amplification;

[0070] B2, catalyzing rolling circle amplification or catalyzing multiple strand displacement amplification;

[0071] B3. Perform DNA sequencing, RNA sequencing or whole genome sequencing;

[0072] B4, construct sequencing library;

[0073] B5. preparing products that catalyze DNA replication and / or catalyze DNA amplification;

[0074] B6. preparing products that catalyze rolling circle amplification or catalyze multiple strand displacement amplification;

[0075] B7. Prepare products for DNA sequencing, RNA sequencing or whole genome sequencing;

[0076] B8. Prepare products for constructing sequencing libraries.

[0077] In some embodiments, the use includes: using Mg 2+ Catalyze artificially modified substrates for DNA synthesis, replication or amplification, or increase Mg 2+ Selectivity for catalyzing artificially modified substrates for DNA synthesis, replication or amplification.

[0078] The artificially modified substrate refers to a deoxyribonucleotide modified with an oligonucleotide or its analog. The deoxyribonucleotide modified with an oligonucleotide or its analog includes at least one of natural A, T, C, and G modified with an oligonucleotide or its analog. The oligonucleotide or its analog modification includes, but is not limited to, oligomer modification with 10, 20, 30, or 40 deoxyribonucleic acid linkages, polyphosphate modification, base-free oligonucleotide modification, sugar modification at the 2' position, pyrimidine modification at the 5' position, purine modification at the 8' position, modification of exocyclic amines, substitution of 4-thiouridine, substitution of 5-bromo or 5-iodo-uracil, backbone modification, phosphorothioate or alkyl phosphate modification, methylation, and unusual base pairing combinations such as isobases isocytidine and isouridine; 3' and 5' modifications such as capping; and phosphate backbone modification, etc. For example, T40HA, D8G, A30A, N045, N036, N050, and N033.

[0079] The present invention provides an enzyme preparation comprising the protein. In some embodiments, the enzyme preparation is used as a polymerase; optionally, as a DNA polymerase; optionally, as a 2+ Catalyze artificially modified substrates for DNA synthesis, replication or amplification or increase Mg 2+ Ion pairs catalyze the synthesis, replication or amplification of DNA by selective DNA polymerases on artificially modified substrates.

[0080] The embodiment of the present invention provides a kit for catalyzing DNA replication, catalyzing DNA amplification, library construction or library sequencing, comprising the protein or the biological material.

[0081] In some embodiments, the library sequencing includes but is not limited to nanopore sequencing.

[0082] In some embodiments, the catalytic DNA amplification includes but is not limited to strand displacement reaction, polymerase chain reaction. The isothermal amplification reaction includes but is not limited to at least one of loop-mediated amplification (LAMP), rolling circle amplification (RCA), strand displacement amplification (SDA), multiple displacement amplification (MDA) and cross primer amplification (CPA).

[0083] In some embodiments, the kit includes, but is not limited to, at least one of a reaction buffer, a magnesium ion solution, a nucleotide substrate, dithiothreitol (DTT), and potassium chloride.

[0084] In some embodiments, the nucleotide substrate includes at least one of natural A, T, C, and G modified by an oligonucleotide or an analog thereof.

[0085] In some embodiments, in the kit, the final concentration of potassium chloride is 50 mM, 100 mM, 150 mM, 200 mM or more.

[0086] Example 1 Preparation of phi29 DNA polymerase mutants

[0087] This example provides the preparation of a phi29 DNA polymerase mutant, comprising the following steps:

[0088] 1. Design genes encoding phi29 DNA polymerase mutants. The names of the encoding genes are as follows:

[0089] Table 1

[0090]

[0091]

[0092] 2. Connect the gene expression sequence to the gene expression vector pET-30a+;

[0093] The construction of the coding genes in Table 1 and the recombinant plasmids into which the coding genes are inserted was completed by GenScript. The recombinant plasmid map after construction is shown in FIG. Figure 4 The exemplary sequence of the constructed recombinant plasmid is shown in SEQ ID NO. 23. The difference between the other recombinant plasmids is that the inserted target gene is replaced.

[0094] 3. Induced expression, collection and purification of polymerase

[0095] The recombinant plasmids with the DNA polymerase gene expression sequence inserted were transformed into Escherichia coli ER2566 super competent cells (Biyuntian Biotechnology, D1039S) and inoculated into kanamycin resistance medium at 37°C and 5% CO. 2 After 12 hours of culture, 5 μL of the strain was inoculated into 5 mL of LB liquid medium and cultured at 37°C overnight. Then it was transferred into 10 mL of LB liquid medium and cultured at 37°C for 3 hours. The OD 600nm =0.6, the bacterial solution was taken out and cooled at 4°C. After cooling, IPTG with a final concentration of 0.6 mM was added for induction, and the shaking culture was continued at 16°C for 20 h. 2+Column affinity chromatography purification, using different imidazole concentrations of elution solution to elute the polymerase protein. The elution solution components are 50mM Tris, 200mM KCl, 0.5% Tween-20, 5mM TCEP (tris (2-chloroethyl) phosphate), different concentrations of imidazole (100mM, 150mM, 200mM, and 300mM). The protein of the eluate of 150mM and 200mM imidazole concentration components is combined, and the ultrafiltration column AMICONULTRA15mL 50K (Millipore, catalog number: UFC905024) is used to concentrate the polymerase and replace the storage solution. The solution used for replacement is 50mM Tris, 200mM KCl, 0.5% Tween-20, 5mM TCEP, 10% glycerol. The phi29 DNA polymerase (68 kD) obtained above was subjected to SDS-PAGE protein electrophoresis to identify the purity of the DNA polymerase protein. The results are as follows: Figure 1 , Figure 2 and Figure 3 As shown, it indicates that Ion_1~Ion_11 are expressed successfully and with high purity.

[0096] Example 2 Testing the ability of DNA polymerase to amplify using modified non-natural substrates

[0097] 1. Prepare the reaction system

[0098] Table 2. Reaction system

[0099]

[0100] The single-stranded circular template sequence in the above table is:

[0101] 5-AGGTCGCCAGTTACTTGTTCTCGATGAGTGCCGTACTTGGTTTA ATACCCGTTCTTGGAATGATAAGGAAAGACAGCCGATTATTGATTGGTTTCTACATGCTCGTAAATTAGGATGGGATATTATTTTTCTTGTTCAGGACTTATCTATTGTTGATAAACAGGCGCGTTCTGCATTAGCTGAACATGTGTCGCCAGCCC-3; (see SEQ ID NO. 24).

[0102] Primer: CTGGCGACCTGGGCTGGCGAC; (see SEQ ID NO. 25).

[0103] The substrates in Table 1 above are as follows:

[0104] The artificially modified substrates A, T, C, and G were all selected from “Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on ananopore array” (Contributed by George M. Church, March 18, 2016 (sent for review February 4, 2016; reviewed by Cynthia J. Burrows, Xiaohua Huang, and Andre Marziali, https: / / doi.org / 10.1073 / pnas.1601782113) Figure 2 The four artificially modified bases (A, T, C, G) in the sequence are dA6P-Cy3-dT 4 -FldT-dT-FldT-dT 23 -C3, dT6P-Cy3-dT 2 -dSp 8 -dT 20 -C3, dC6P-Cy3-dT 4 -dSp 3 -dT 23 -C3, dG6P-Cy3-dT 30 -C3. The structural formulas are as follows:

[0105]

[0106] The polymerase and template primer complex were mixed (5 μL), reacted at 25° C. for 10 min, and then other components (see Table 2) were added to obtain a total reaction volume of 10 μL, and then reacted at 30° C. for 2 h.

[0107] The final reaction product was subjected to electrophoresis. Figure 5 and Figure 6 shown. Figure 5 The middle lane L1 is a negative control (a complex mixture of only circular template and primers); L2 to L10 are the extension product detections of Ion_1 to Ion_9, respectively. Among them, Ion_2 is the wild-type phi29. Figure 5 Except for L4, which had almost no amplification, all others were amplified, indicating that the site mutations of M97K, L253A, T368M, Y369E, E375D, Q380L, A382L, A484E, A484R, E508F, V514Q, and V514D contribute to the activation of phi29 polymerase in Mg 2+DNA amplification using non-natural substrates under different conditions. Figure 6 The middle lane NC is a negative control (a complex mixture of only the circular template and primers). Ion_10 is a protein mutant carrying a "palm" domain, and Ion_11 is a protein without a special domain. Ion_11 has almost no amplification. Figure 6 The palm domain is shown to help facilitate polymerase activity in Mg 2+ DNA amplification using non-natural substrates under different conditions.

[0108] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the invention.

Claims

1. A protein, characterized in that Select at least one of the following: (A), the protein is an amino acid sequence compared to the wild-type phi29 DNA polymerase, comprising at least one of the following mutation sites: M8R, D12A, N62D, M97K, G197D, L253A, T368M, Y369E, E375D, Q380L, A382L, A382F, A484R, A484E, E508F, D510M, V514Q, V514D, V514S, and / or F526L; (B) The protein has at least one palm domain compared to the amino acid sequence of the wild-type phi29 DNA polymerase, thereby obtaining a protein with DNA polymerase activity.

2. The protein according to claim 1, characterized in that The palm domain is located between positions 86 and 87 of the wild-type phi29 DNA polymerase; And / or, the amino acid sequence of the palm domain is KTVFSKGAPYQTVTDVEE.

3. The protein according to claim 1 or 2, characterized in that The protein has an amino acid sequence as shown in any of SEQ ID NOs. 1 to 10.

4. Biomaterial, characterized in that Any of the following: 1) A nucleic acid molecule encoding the protein according to any one of claims 1 to 3; optionally, the nucleic acid molecule comprises a DNA molecule or an RNA molecule; 2) A vector containing the nucleic acid molecule described in 1).

5. The protein according to any one of claims 1 to 3 and the biomaterial according to claim 4 have any of the following uses: B1. catalyze DNA replication and / or catalyze DNA amplification; B2, catalyzing rolling circle amplification or catalyzing multiple strand displacement amplification; B3. Perform DNA sequencing, RNA sequencing or whole genome sequencing; B4, constructing a sequencing library; B5. preparing products that catalyze DNA replication and / or catalyze DNA amplification; B6. preparing products that catalyze rolling circle amplification or catalyze multiple strand displacement amplification; B7. Prepare products for DNA sequencing, RNA sequencing or whole genome sequencing; B8. Prepare products for constructing sequencing libraries.

6. The use according to claim 5, characterized in that The use includes: using Mg 2+ Catalyze artificially modified substrates for DNA synthesis, replication or amplification, or increase Mg 2+ Selectivity for catalyzing artificially modified substrates for DNA synthesis, replication or amplification.

7. The use according to claim 6, characterized in that: The artificially modified substrate refers to a deoxyribonucleotide modified with an oligonucleotide or an analog thereof.

8. An enzyme preparation, characterized in that Comprising the protein according to any one of claims 1 to 3.

9. The enzyme preparation according to claim 8, characterized in that The enzyme preparation is used as a polymerase; optionally, as a DNA polymerase; optionally, as a 2+ Catalyze artificially modified substrates for DNA synthesis, replication or amplification or increase Mg 2+ Ion pairs catalyze the synthesis, replication or amplification of DNA by selective DNA polymerases on artificially modified substrates.

10. A kit for catalyzing DNA replication, catalyzing DNA amplification, library construction or library sequencing, characterized in that: Comprising the protein according to any one of claims 1 to 3 or the biological material according to claim 4.

Images