Aptamer for identifying c-MET and application thereof

Abstract

The invention discloses a nucleic acid aptamer for identifying c-MET and application of the nucleic acid aptamer. The invention provides a nucleic acid aptamer. The nucleic acid aptamer is a single-stranded univalent nucleic acid aptamer formed by intramolecular folding of a DNA single-stranded molecule and a bivalent double-stranded nucleic acid aptamer formed by self-assembly of two single-stranded DNA molecules through complementary paired nucleotides. The nucleic acid aptamer disclosed by the invention has the capability of identifying c-MET, and the bivalent double-chain nucleic acid aptamer has the same biological function as HGF (Hepatocyte Growth Factor) and can promote the diphosphorylation of c-MET so as to activate a downstream pathway, thereby promoting the dispersion, migration and proliferation of cells.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and relates to a nucleic acid aptamer for recognizing c-MET and an application thereof, and specifically relates to a nucleic acid aptamer for recognizing c-MET, which can be used to recognize and bind to c-MET protein and cells expressing c-MET protein, activate c-MET protein on the cell surface, promote cell dispersion and migration, and help promote the proliferation and migration of vascular endothelial cells. Background Art

[0002] Hepatocyte growth factor (HGF, also known as Scatter Factor) is a pleiotropic growth factor, named for its ability to promote the division and growth of hepatocytes. The main receptor of HGF is c-MET (cellular-mesenchymal epithelial transition factor, c-MET), a member of the receptor tyrosine kinase family, which plays a key role in invasive growth during embryonic development and postnatal organ regeneration. The HGF / c-Met signaling axis participates in the development of epithelial organs in a paracrine manner, plays an epithelial regeneration role, and promotes the regression of fibrosis in many organs. Overactivation or abnormal expression of the HGF / c-Met signaling pathway is associated with the occurrence, progression and metastasis of cancer. At the same time, the HGF / c-Met signaling pathway is closely related to cell proliferation, differentiation, migration, etc., and is closely related to angiogenesis and neural and immunobiological functions.

[0003] First, HGF and its receptor c-MET have been proven to be effective targets for protecting vascular endothelial cells. The combination of the two can activate related signaling pathways, specifically promote and maintain the proliferation and related functions of endothelial cells, promote angiogenesis, and then promote angiogenesis to form collateral circulation. Secondly, HGF plays a powerful role as a neurotrophic and angiogenic factor in the nervous system, promoting the survival of neurons and the regeneration of injured nerves, and can also act as a target-derived axon chemotactic factor to guide axons to their targets. HGF plays an important role in promoting angiogenesis, anti-fibrosis, anti-inflammation, immunoregulation and neural regeneration. However, due to the existence of the blood-brain barrier, there are major obstacles to the application of HGF in vivo. Although the preclinical treatment effect of some diseases has been achieved to a certain extent by local injection of recombinant HGF protein, or by using hydrogel carriers, stem cell transplantation, gene transfer delivery, ultrasound-mediated gene transfer overexpression, viral vector gene delivery of HGF, etc., at the same time, the extremely short half-life of HGF itself limits its application to a greater extent. Therefore, there is still an urgent need for new molecules that can replace HGF in organisms.

[0004] Aptamers are single-stranded oligonucleotides (ssDNA or RNA) with a length of about 10-150 bases that are screened by the systematic evolution of ligands by exponential enrichment (SELEX) technology and have specific interactions with target substances. Aptamers can form thermodynamically stable three-dimensional structures such as stem-loops, hairpins, and G-quadruplexes, and can recognize and bind to target molecules with high affinity and high specificity through non-covalent interactions such as hydrogen bonds, hydrophobic interactions, van der Waals forces, and ionic bonds. Aptamers are called "chemical antibodies" that can be synthesized artificially. Based on the excellent properties of aptamers, they have broad application prospects in biosensors, molecular devices, imaging and diagnosis, targeted therapy, etc. Therefore, the development of new aptamers that can bind to or activate c-MET on the cell surface is of great significance for the treatment and diagnosis of related diseases. Summary of the invention

[0005] The technical problem to be solved by the present invention is to propose a nucleic acid aptamer that recognizes c-MET. The nucleic acid aptamer can be a single-stranded nucleic acid aptamer or a bivalent double-stranded nucleic acid aptamer with a double-stranded structure obtained by self-assembly of two nucleic acid aptamers containing a certain number of complementary nucleotides. The nucleic acid aptamer has the function of recognizing and binding to c-MET on cells, and has the function of promoting dimerization and phosphorylation of c-MET on cells, as well as the biological function caused by the nucleic acid aptamer activating the dimerization and phosphorylation of c-MET.

[0006] In order to solve the above technical problems, the first aspect of the present invention provides a nucleic acid aptamer, which is any one of the following A1)-A11):

[0007] A1) The single-stranded DNA molecule shown in sequence 3;

[0008] A2) The single-stranded DNA molecule shown in sequence 4;

[0009] A3) The single-stranded DNA molecule shown in sequence 5;

[0010] A4) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 1 and the single-stranded DNA molecule shown in sequence 2 by complementary pairing;

[0011] A5) deleting, adding and / or replacing one or more nucleotides of the nucleic acid aptamer shown in any one of A1) to A4) to obtain a derivative of the nucleic acid aptamer having the same function as the nucleic acid aptamer;

[0012] A6) performing nucleotide substitution or modification on the nucleic acid aptamer shown in any one of A1) to A5) to obtain a derivative of the nucleic acid aptamer having the same function as the nucleic acid aptamer;

[0013] A7) transforming the backbone of the nucleic acid aptamer shown in any one of A1) to A6) into a phosphothioate backbone to obtain a derivative of the nucleic acid aptamer having the same function as the nucleic acid aptamer;

[0014] A8) obtaining an RNA molecule encoded by any one of the aptamers shown in A1) to A7) to obtain a aptamer derivative having the same function as the aptamer;

[0015] A9) a peptide nucleic acid encoded by a nucleic acid aptamer as shown in any one of A1) to A8) to obtain a derivative of a nucleic acid aptamer having the same function as the nucleic acid aptamer;

[0016] A10) connecting a signal molecule and / or an active molecule and / or a functional group and / or a radioactive nuclide and / or a modifying group to one end or the middle of the nucleic acid aptamer shown in any one of A1) to A9) to obtain a derivative of the nucleic acid aptamer having the same function as the nucleic acid aptamer;

[0017] A11) self-assembles two complementary nucleic acid aptamers among any of the nucleic acid aptamers shown in A1) to A10) to form a nucleic acid aptamer.

[0018] In the nucleic acid aptamer described above,

[0019] The modification is phosphorylation, methylation, amination, thiolation, isotopization or polyethylene glycol modification;

[0020] Or, the functional group is a fluorescent group, a biotin group, a radioactive substance, a therapeutic substance, digoxin, a nanoluminescent material or an enzyme label;

[0021] Alternatively, the modifying group is polyethylene glycol.

[0022] In the nucleic acid aptamer described above,

[0023] The nucleic acid aptamer shown in A5)-A11) is any one of the following:

[0024] B1) a single-stranded DNA molecule represented by any one of sequences 6-11, 13, 14, 17-28, 48, and 49;

[0025] B2) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 30 and the single-stranded DNA molecule shown in sequence 31 by complementary pairing,

[0026] B3) The nucleic acid aptamer obtained by modifying B2) as follows: the nucleotides 1-14 in the single-stranded DNA molecule shown in sequence 30 and the nucleotide residues 27-40 in the single-stranded DNA molecule shown in sequence 31 that can complementarily pair therewith are replaced with nucleotide fragments of any length in the range of 7-30 nt that can complementarily pair therewith; the other nucleotide residues may remain unchanged, or one or more nucleotides may be deleted, added and / or replaced;

[0027] B4) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 32 and the single-stranded DNA molecule shown in sequence 33,

[0028] B5) The nucleic acid aptamer obtained by modifying B4) as follows: the nucleotide residues at positions 27-40 in the single-stranded DNA molecule shown in sequence 32 and the nucleotide residues at positions 27-40 in the single-stranded DNA molecule shown in sequence 33 that can complementarily pair therewith are replaced with nucleotide fragments of any length in the range of 7-30 nt that can complementarily pair therewith; the other nucleotide residues may remain unchanged, or one or more nucleotides may be deleted, added and / or replaced;

[0029] B6) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 34 and the single-stranded DNA molecule shown in sequence 35,

[0030] B7) The nucleic acid aptamer obtained by modifying B6) as follows: the nucleotides 23-40 in the single-stranded DNA molecule shown in sequence 34 and the nucleotides 23-40 in the single-stranded DNA molecule shown in sequence 35 that can complementarily pair therewith are replaced with nucleotide fragments of any length in the range of 7-30 nt that can complementarily pair therewith; the other nucleotide residues may remain unchanged, or one or more nucleotides may be deleted, added and / or replaced;

[0031] B8) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 36 and the single-stranded DNA molecule shown in sequence 37,

[0032] B9) The nucleic acid aptamer obtained by modifying B8) as follows: the nucleotides 26-43 in the single-stranded DNA molecule shown in sequence 36 and the nucleotides 26-43 in the single-stranded DNA molecule shown in sequence 37 that can complementarily pair therewith are replaced with nucleotide fragments of any length in the range of 7-30 nt that can complementarily pair therewith; the other nucleotide residues may remain unchanged, or one or more nucleotides may be deleted, added and / or replaced;

[0033] B10) B8) is transformed as follows to obtain a nucleic acid aptamer:

[0034] The nucleotides 26-43 in the single-stranded DNA molecule shown in sequence 36 and the nucleotides 26-43 in the single-stranded DNA molecule shown in sequence 37 that can complementarily pair therewith are replaced by nucleotide fragments of any length within the range of 7-30 nt that can complementarily pair therewith;

[0035] and deleting and / or adding and / or replacing one or several nucleotides from nucleotides 1 to 25 in the single-stranded DNA molecule shown in sequence 36 or sequence 37 and / or deleting and / or adding and / or replacing one or several nucleotides from nucleotides 44 to 50 in the single-stranded DNA molecule shown in sequence 36 or sequence 37;

[0036] Other nucleotide residues may remain unchanged, or one or several nucleotides may be deleted, added and / or replaced;

[0037] B11) The nucleic acid aptamer obtained by modifying B8) as follows: the nucleotide residues in the single-stranded DNA molecule shown in sequence 36 are modified by thiolation and / or polyethylene glycol (PEG), and the nucleotide residues in the single-stranded DNA molecule shown in sequence 37 are modified by thiolation and / or polyethylene glycol.

[0038] In the above-mentioned nucleic acid aptamer,

[0039] The nucleic acid aptamer shown in B10) is any one of the following:

[0040] C1) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 38 and the single-stranded DNA molecule shown in sequence 39,

[0041] C2) The nucleic acid aptamer obtained by modifying C1) as follows: the nucleotides 26-39 of the nucleic acid aptamer 39 and the nucleotides 26-39 of the single-stranded DNA molecule shown in the sequence 38 that can complementarily pair with it are replaced by nucleotide fragments of any size in the range of 7-30 nt in length that can complementarily pair with it.

[0042] In the above-mentioned nucleic acid aptamer,

[0043] The nucleic acid aptamer shown in C2) is any of the following:

[0044] D1) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule represented by sequence 40 and the single-stranded DNA molecule represented by sequence 41,

[0045] D2) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 42 and the single-stranded DNA molecule shown in sequence 43,

[0046] D3) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule represented by sequence 44 and the single-stranded DNA molecule represented by sequence 45,

[0047] D4) A nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule represented by sequence 46 and the single-stranded DNA molecule represented by sequence 47 by complementary pairing.

[0048] In the above-mentioned nucleic acid aptamer,

[0049] The nucleic acid aptamer shown in B11) is any one of the following:

[0050] C3) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule represented by sequence 50 and the single-stranded DNA molecule represented by sequence 51,

[0051] C4) A nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule represented by sequence 52 and the single-stranded DNA molecule represented by sequence 53 by complementary pairing.

[0052] In the above, each nucleic acid aptamer formed by the complementary pairing and self-assembly of two single-stranded DNA molecules is a bivalent double-stranded nucleic acid aptamer with a double-stranded structure. The structure of each bivalent double-stranded nucleic acid aptamer is shown in the secondary structure diagram of the double strand formed by the bivalent double-stranded nucleic acid aptamer in the corresponding figure of the specification.

[0053] In the above, the bivalent double-stranded nucleic acid aptamer is a nucleic acid aptamer composition, which is a nucleic acid aptamer with a double-stranded structure formed by the complementary pairing self-assembly of the nucleic acid aptamers of two single-stranded DNA molecules. The complementary pairing self-assembly is to mix the corresponding two single-stranded DNA molecules with PBS buffer to obtain a mixed solution, and the concentration of each single-stranded DNA molecule in the mixed solution is 10μM; then the mixed solution is subjected to denaturation-renaturation operation: that is, heating at 95℃ for 5min, placing on ice for 10min, and placing at room temperature for 30min to form a stable spatial structure, realize complementary pairing self-assembly to form a nucleic acid aptamer, and obtain a bivalent double-stranded nucleic acid aptamer with a double-stranded structure.

[0054] In a second aspect, the present invention provides a reagent containing the nucleic acid aptamer described in the first aspect.

[0055] In a third aspect, the present invention provides the use of the nucleic acid aptamer described in the first aspect or the reagent described in the second aspect in any of the following:

[0056] E1) Enrichment and extraction of c-MET;

[0057] E2) Identify or assist in identifying c-MET;

[0058] E3) binds to or assists in binding to c-MET;

[0059] E4) activates or assists in the activation of c-MET;

[0060] E5) detecting or assisting in detecting whether the sample to be tested contains c-MET;

[0061] E6) detecting or assisting in detecting the c-MET content in the sample to be tested;

[0062] E7) detecting or assisting in detecting tumors or tumor cells expressing c-MET;

[0063] E8) Identify or assist in identifying tumors or tumor cells;

[0064] E9) binding or assisting in binding to tumors or tumor cells;

[0065] E10) targeting c-MET;

[0066] E11) Diagnosis or treatment of c-MET related diseases;

[0067] E12) promotes the dimerization phosphorylation of c-MET;

[0068] E13) activates the c-MET downstream pathway;

[0069] E14) promotes the dispersion of tumor cells;

[0070] E15) promotes the migration of tumor cells;

[0071] E16) promotes the proliferation of tumor cells;

[0072] E17) preparing a product for enriching and extracting c-MET;

[0073] E18) preparing products that recognize or assist in the recognition of c-MET;

[0074] E19) preparing a product that binds or assists in binding to c-MET;

[0075] E20) preparing a product that activates or assists in activating c-MET;

[0076] E21) preparing a product for detecting or assisting in detecting whether a sample to be tested contains c-MET;

[0077] E22) preparing a product for detecting or assisting in detecting the content of c-MET in a sample to be tested;

[0078] E23) preparing products for detecting or assisting in detecting tumors or tumor cells expressing c-MET;

[0079] E24) preparing products that recognize or assist in recognizing tumors or tumor cells;

[0080] E25) preparing products that bind or assist in binding to tumors or tumor cells;

[0081] E26) preparing a product targeting c-MET;

[0082] E27) Preparation of products for diagnosis or treatment of diseases related to c-MET;

[0083] E28) preparing a product that promotes dimerization phosphorylation of c-MET;

[0084] E29) preparing products that activate c-MET downstream pathways;

[0085] E30) preparing a product that promotes the dispersion of tumor cells;

[0086] E31) preparing a product that promotes the migration of tumor cells;

[0087] E32) preparing products that promote the proliferation of tumor cells;

[0088] E33) preparing probes for animal imaging targeting c-MET;

[0089] E34) preparing a therapeutic product for targeting c-MET;

[0090] E35) preparing an agonist for a signaling pathway associated with c-MET;

[0091] E36) preparing agonists for the biological functions of c-MET-related signaling pathways.

[0092] In a fourth aspect, the present invention provides a product, comprising an active ingredient and a carrier for fixing or coupling the active ingredient, wherein the active ingredient is the nucleic acid aptamer described in the first aspect or the reagent described in the second aspect.

[0093] Among the products described above, the product has any of the following functions:

[0094] E1) Enrichment and extraction of c-MET;

[0095] E2) Identify or assist in identifying c-MET;

[0096] E3) binds to or assists in binding to c-MET;

[0097] E4) activates or assists in the activation of c-MET;

[0098] E5) detecting or assisting in detecting whether the sample to be tested contains c-MET;

[0099] E6) detecting or assisting in detecting the c-MET content in the sample to be tested;

[0100] E7) detecting or assisting in detecting tumors or tumor cells expressing c-MET;

[0101] E8) Identify or assist in identifying tumors or tumor cells;

[0102] E9) binding or assisting in binding to tumors or tumor cells;

[0103] E10) targeting c-MET;

[0104] E11) Diagnosis or treatment of c-MET related diseases;

[0105] E12) promotes the dimerization phosphorylation of c-MET;

[0106] E13) activates the c-MET downstream pathway;

[0107] E14) promotes the dispersion of tumor cells;

[0108] E15) promotes the migration of tumor cells;

[0109] E16) promotes the proliferation of tumor cells.

[0110] In the above, the tumor cells are human tumor cells.

[0111] The human tumor cells can be all tumor cells that can express c-MET, such as human prostate cancer cells, human ovarian cancer paclitaxel-resistant strains, human gastric cancer cells or human lung cancer cells.

[0112] The sample to be tested is a cell, and the cell is the above-mentioned tumor cell or a normal cell such as a vascular endothelial cell and an epithelial cell that can express c-MET.

[0113] In the above, the c-MET-related diseases may specifically be liver cancer, lung cancer, gastric cancer, kidney cancer, breast cancer, prostate cancer or cellular fibrosis and the like.

[0114] In the above, the product may be a kit or a probe, a targeting substance, a drug, a composition or other biological product.

[0115] In the above products, the carrier that fixes or couples the active ingredient is a pharmaceutically acceptable carrier, and the pharmaceutically acceptable carrier includes but is not limited to water-soluble carrier materials (such as polyethylene glycol, polyvinyl pyrrolidone, organic acid, etc.), poorly soluble carrier materials (such as ethyl cellulose, cholesterol stearate, etc.), enteric carrier materials (such as cellulose acetate phthalate and carboxymethyl ethyl cellulose, etc.). These materials can be made into a variety of dosage forms, including but not limited to tablets, capsules, dripping pills, aerosols, pills, powders, solutions, suspensions, emulsions, granules, liposomes, transdermal agents, buccal tablets, suppositories, freeze-dried powder injections, etc. It can be a common preparation, a sustained-release preparation, a controlled-release preparation, and various microparticle delivery systems. In order to make a unit dosage form into a tablet, various carriers known in the art can be widely used. Examples of carriers include diluents and absorbents, such as starch, dextrin, calcium sulfate, lactose, mannitol, sucrose, sodium chloride, glucose, urea, calcium carbonate, kaolin, microcrystalline cellulose, aluminum silicate, etc.; wetting agents and binders, such as water, glycerol, polyethylene glycol, ethanol, propanol, starch paste, dextrin, syrup, honey, glucose solution, acacia paste, gelatin paste, sodium carboxymethylcellulose, shellac, methylcellulose, potassium phosphate, polyvinyl pyrrolidone, etc.; disintegrants. , such as dry starch, alginate, agar powder, brown algae starch, sodium bicarbonate and citric acid, calcium carbonate, polyoxyethylene, sorbitan fatty acid esters, sodium lauryl sulfate, methyl cellulose, ethyl cellulose, etc.; disintegration inhibitors, such as sucrose, tristearate, cocoa butter, hydrogenated oil, etc.; absorption promoters, such as quaternary ammonium salts, sodium lauryl sulfate, etc.; lubricants, such as talc, silicon dioxide, corn starch, stearate, boric acid, liquid paraffin, polyethylene glycol, etc. The tablets can also be further made into coated tablets, such as sugar-coated tablets, film-coated tablets, enteric-coated tablets, or double-layer tablets and multi-layer tablets. In order to make the unit dosage form into a pill, various carriers known in the art can be widely used. Examples of carriers include diluents and absorbents, such as glucose, lactose, starch, cocoa butter, hydrogenated vegetable oil, polyvinyl pyrrolidone, kaolin, talc, etc.; binders such as gum arabic, tragacanth, gelatin, ethanol, honey, liquid sugar, rice paste or flour paste, etc.; disintegrants such as agar powder, dry starch, alginate, sodium dodecyl sulfate, methyl cellulose, ethyl cellulose, etc. In order to prepare the unit dosage form into a suppository, various carriers known in the art can be widely used. Examples of carriers include, for example, polyethylene glycol, lecithin, cocoa butter, higher alcohols, esters of higher alcohols, gelatin, semi-synthetic glycerides, etc. In order to prepare the unit dosage form into an injectable preparation, such as a solution, emulsion, freeze-dried powder injection and suspension, all diluents commonly used in the art can be used, for example, water, ethanol, polyethylene glycol, 1,3-propylene glycol, ethoxylated isostearyl alcohol, polyoxyethylene sorbitol fatty acid esters, etc.In addition, in order to prepare isotonic injections, an appropriate amount of sodium chloride, glucose or glycerol may be added to the injection preparations, and conventional cosolvents, buffers, pH adjusters, etc. may also be added. In addition, colorants, preservatives, spices, flavoring agents, sweeteners or other materials may also be added to the pharmaceutical preparations as needed.

[0116] The present invention performs a splitting treatment on the structure of the original c-MET nucleic acid aptamer HF3-58 (application number 202210573556.4) to obtain two nucleic acid aptamers 1 and 2. The two nucleic acid aptamers cannot bind to c-MET alone, but when the two nucleic acid aptamers exist at the same time (sequence 1+2), they can bind to the target c-MET. On this basis, the nucleic acid aptamer HF3-58 is reconstructed to obtain a brand-new nucleic acid aptamer 3. This nucleic acid aptamer, like the original nucleic acid aptamer, can still bind to c-MET. The new nucleic acid aptamer 3 is further rationally transformed, optimized and modified to obtain a group of new nucleic acid aptamers. The recognition performance of the new nucleic acid aptamer is similar to that of the original nucleic acid aptamer HF3-58, and it has better recognition and binding characteristics and better stability at 37°C. The new nucleic acid aptamer is a single-stranded nucleic acid aptamer or a bivalent double-stranded nucleic acid aptamer, and it has the same biological function as HGF, which can promote the dimerization phosphorylation of c-MET, thereby activating downstream pathways, thereby promoting cell dispersion, migration and proliferation. BRIEF DESCRIPTION OF THE DRAWINGS

[0117] Figure 1 The diagram shows the optimization method of nucleic acid aptamer HF3-58. Figure 1 A is the splitting of nucleic acid aptamer HF3-58 to obtain two complementary pairs of nucleic acid aptamer 1 and nucleic acid aptamer 2; Figure 1 B represents nucleic acid aptamer 3 obtained by cleaving and reconstructing nucleic acid aptamer HF3-58 between the 23rd and 24th nucleotides, and nucleic acid aptamers 4 and 5 obtained by optimization.

[0118] Figure 2 Flow cytometric analysis of the combined nucleic acid aptamer formed by nucleic acid aptamer 1 and nucleic acid aptamer 2 and nucleic acid aptamer 3-5 and MKN-45 cells and gel electrophoresis images after denaturation and stabilization for different time periods of 0.5 h and 24 h; Figure 2 A is a flow cytometric analysis of the combined nucleic acid aptamer formed by nucleic acid aptamer 1 and nucleic acid aptamer 2, as well as the optimized nucleic acid aptamers 3-5 and HF3-58 and MKN-45 cells at 4°C; Figure 2 B is the gel electrophoresis diagram of nucleic acid aptamer 3-5 and HF3-58 after denaturation and stabilization for different time periods of 0.5 h and 24 h.

[0119] Figure 3 HF3-58 and HGF compete for the binding of aptamer 5 to MKN-45 cells; Figure 3A is the flow cytometry analysis result of nucleic acid aptamer 3 competing with HF3-58 for binding to MKN-45 cells at 4°C; Figure 3 B is the flow cytometry analysis result of HGF protein competing with nucleic acid aptamer 5 and HF3-58 for binding to MKN-45 cells.

[0120] Figure 4 This is the polyacrylamide gel electrophoresis of aptamer 5 and c-MET. Figure 4 A is the gel electrophoresis diagram of aptamer 3 at different concentrations; Figure 4 B is a gel shift experiment of aptamer 5 with a final concentration of 20 nM and c-MET protein with different concentrations.

[0121] Figure 5 The secondary structure diagrams of all modified nucleic acid aptamers 6-12; Figure 5 A is a secondary structure diagram of aptamer 6 and aptamer 7 obtained by replacing or lengthening the S1 region with aptamer 5; Figure 5 B is the secondary structure diagram of sequence 8-12 obtained by cleaving the S1 region of nucleic acid aptamer 5.

[0122] Figure 6 Flow cytometry and polyacrylamide gel electrophoresis analysis of aptamer 6-12 binding to MKN-45 cells; Figure 6 A is a flow cytometric analysis of aptamer 5-12 binding to MKN-45 cells at 4°C; Figure 6 B is the gel electrophoresis result of nucleic acid aptamer 3-12 at 1 μM.

[0123] Figure 7 is the secondary structure diagram of the dimer of nucleic acid aptamer 5 and nucleic acid aptamers 13-15; Figure 7 A is a dimer diagram of aptamer 5; Figure 7 B is the secondary structure diagram of nucleic acid aptamer 13-15.

[0124] Figure 8 is the secondary structure diagram of nucleic acid aptamer 16-26; Figure 8 A is the secondary structure diagram of aptamer 16-24; Figure 8 B is the secondary structure diagram of nucleic acid aptamers 25 and 26.

[0125] Fig. 9 Figure 2 is a flow cytometric analysis of aptamer 13-26 binding to MKN-45 cells at 4°C.

[0126] Fig.10 The figure shows the gel electrophoresis result of nucleic acid aptamer 13-26 at a final concentration of 1 μM.

[0127] Fig.11 The relationship between the self-dimerization of the sequence 27-29 nucleic acid aptamer and its affinity to cells; Fig.11 A is the secondary structure diagram of nucleic acid aptamer 27-29; Fig.11 B is a flow cytometric analysis of aptamer 27-29 binding to MKN-45 cells at 4°C; Fig.11 C is the gel electrophoresis result of nucleic acid aptamer 27-29 with a final concentration of 1 μM.

[0128] Fig.12 The nucleic acid aptamer 30 and the nucleic acid aptamer 31 form a bivalent double-stranded nucleic acid aptamer that binds to c-MET; Fig.12 A is the result of the bivalent double-stranded nucleic acid aptamer 30 and the bivalent double-stranded nucleic acid aptamer 31 forming a double strand; Fig.12 B is a flow cytometric analysis of the binding of the bivalent double-stranded nucleic acid aptamers 30 and 31 to MKN-45 cells at 4°C.

[0129] Fig.13 It is the flow cytometry analysis diagram of the bivalent double-stranded nucleic acid aptamer structure and its binding to MKN-45 cells; Fig.13 (1) The secondary structure of the bivalent double-stranded nucleic acid aptamer formed by nucleic acid aptamers 32+33 and 34+35 respectively; Fig.13 (2) A is a flow cytometric analysis of the mixed sequences of two nucleic acid aptamers in the combinations of nucleic acid aptamers 32 and 33, 34 and 35, and 36 and 37 at different concentration ratios binding to MKN-45 cells at 4°C; Fig.13 (2) B is a flow cytometric analysis of the bivalent double-stranded aptamers formed by aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47, and aptamer 5 binding to MKN-45 cells at 4°C; Fig.13 (2) C is a flow cytometric analysis of the bivalent double-stranded aptamers formed by aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, and 46 and 47 binding to MKN-45 cells at 37°C.

[0130] Fig.14 This is a polyacrylamide gel electrophoresis experiment of the binding of bivalent double-stranded nucleic acid aptamers to MKN-45 cells; Fig.14 A is a graph showing the gel electrophoresis results of the mixed sequences of two nucleic acid aptamers in the combinations of nucleic acid aptamers 32 and 33, 34 and 35, and 36 and 37 at different concentration ratios, and nucleic acid aptamer 5; Fig.14 B is the gel electrophoresis diagram of the bivalent double-stranded nucleic acid aptamer formed by nucleic acid aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47, and nucleic acid aptamers 36, 38, 40, 42, 44, and 46 labeled with fluorescence.

[0131] Fig.15Flow cytometric analysis of bivalent double-stranded nucleic acid aptamers formed by nucleic acid aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, and 46 and 47 binding to A549 / DDP cells at 4°C and 37°C, respectively.

[0132] Fig.16 The nucleic acid aptamer promotes the dimerization phosphorylation of c-MET and the phosphorylation of c-MET downstream proteins; Fig.16 A is a Western blot analysis of A549 / DDP cells treated with aptamers 4, 5, 8 and bivalent double-stranded aptamers formed by aptamers 32 and 33, 34 and 35, 36 and 37; Fig.16 B is a Western blot analysis of A549 / DDP cells treated with bivalent double-stranded aptamers formed by aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, and 46 and 47; Fig.16 C is the ratio of the phosphorylation level of c-MET in A549 / DDP cells treated with the bivalent double-stranded nucleic acid aptamers formed by sequences 4, 5, 36 and 37, and 42 and 43 at a final concentration of 10 nM to the phosphorylation level of c-MET in cells treated with HGF at a final concentration of 1 nM; Fig.16 D is a Western blot analysis of the c-MET downstream signaling pathway activated by the bivalent double-stranded nucleic acid aptamer formed by nucleic acid aptamers 36 and 37 and sequences 42 and 43 with final concentrations of 10, 1, and 0.1 nM, respectively.

[0133] Fig.17 Flow cytometric analysis of the binding of bivalent double-stranded nucleic acid aptamers formed by nucleic acid aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 to DU145 cells at 4°C and 37°C.

[0134] Fig.18 Schematic representation of the bivalent double-stranded aptamer formed by HGF and aptamers 3, 4, 5, 8, 34 and 35, 32 and 33, 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 promoting DU145 cell scattering.

[0135] Fig.19 Schematic representation of the bivalent double-stranded aptamer formed by aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, and 46 and 47 promoting the migration of DU145 cells.

[0136] Fig. 20Flow cytometric analysis of bivalent double-stranded aptamers formed by aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 binding to mouse cells 4T1, ATDC5, RAW264.7, MC38, and MS1.

[0137] Fig.21 The binding of aptamers 5, 48, and 49 to MKN-45 cells and their serum stability; Fig.21 A is a flow cytometric analysis of aptamer 48 and 49 obtained by thio-modification and PEG-modification of aptamer 5 binding to MKN-45 cells at 4°C; Fig.21 B-21D are electrophoretic diagrams showing the degradation of nucleic acid aptamers 5, 48 and 49 in 90% FBS at different time points.

[0138] Fig. 22 Flow cytometric analysis and serum stability test for the binding of bivalent double-stranded nucleic acid aptamers 36+37 and 42+43 to MKN-45 cells; Fig. 22 A is a flow cytometric analysis of the binding of bivalent double-stranded nucleic acid aptamers formed by nucleic acid aptamers 50 and 51, 52 and 53 after nucleic acid aptamers 36 and 37 and sequences 42 and 43 were modified by thio and PEG, respectively, to MKN-45 cells at 4°C and 37°C; Fig. 22 B is a diagram showing the serum degradation of aptamer 36 and aptamer 50; Fig. 22 C is the serum stability test of bivalent double-stranded nucleic acid aptamer. DETAILED DESCRIPTION

[0139] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0140] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels.

[0141] Unless otherwise specified, the quantitative tests in the following examples were performed three times and the results were averaged.

[0142] The nucleic acid aptamers in the following examples were all synthesized by Sangon Biotechnology (Shanghai) Co., Ltd.

[0143] The PBS buffer (pH=7.4) in the following examples includes: 137 mM NaCl, 2.7 mM KCl, 2 mM KH2PO4, 10 mM Na2HPO4, and the balance is water.

[0144] The washing buffer (pH=7.4) in the following examples includes: 137 mM NaCl, 5 mM MgCl2, 2.7 mM KCl, 2 mM KH2PO4, 10 mM Na2HPO4, 25 mM glucose, and the balance is water.

[0145] The binding buffer (pH=7.4) in the following examples includes: 137 mM NaCl, 5 mM MgCl2, 2.7 mM KCl, 2 mM KH2PO4, 10 mM Na2HPO4, 25 mM glucose, 1 mg / mL BSA and 0.1 mg / mL herring sperm DNA, and the balance is water.

[0146] The human gastric cancer cells (MKN-45) in the following examples (Type Culture Collection Committee of the Chinese Academy of Sciences), human prostate cancer cells DU145 (Cell Bank of Type Culture Collection Committee of the Chinese Academy of Sciences; 1101HUM-PUMC000006), human lung adenocarcinoma cisplatin-resistant strain (A549 / DDP), mouse breast cancer cells (4T1), mouse chondroblasts (ATDC5), mouse pancreatic endothelial cells (MS1), mouse colon cancer cells (MC38), etc. were cultured in RPMI 1640 medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin); mouse mononuclear macrophage leukemia cells (RAW264.7) (Chinese Academy of Sciences), all cells were routinely cultured in a constant temperature biochemical incubator (37° C., 5% CO2) and passaged every two days.

[0147] Unless otherwise specified, the reactions of nucleic acid aptamers in the following examples all use denatured and renatured nucleic acid aptamers. The denatured and renatured nucleic acid aptamers are prepared by dissolving the nucleic acid aptamers in PBS, heating them at 95°C for 5 min, placing them on ice for 10 min, and placing them at room temperature (25°C) for 30 min to obtain denatured and renatured nucleic acid aptamers.

[0148] Example 1. Modification and optimization of c-MET-targeting nucleic acid aptamer HF3-58

[0149] Nucleic acid aptamer HF3-58 (i.e., nucleic acid aptamer 55, nucleotide sequence is TTGGAGCAGCGTGGAGGATATGCTTTCCGACCGTGTTCGTTTGTTATAACGCTGCTCC (sequence 55), see Figure 1A) is a c-MET-specific nucleic acid aptamer obtained by SELEX technology screening, which has good specificity and high affinity. In the early stage, the original nucleic acid aptamer HF3-58 was further optimized, transformed and modified to obtain a series of new nucleic acid aptamers with different properties (application number 202210573556.4).

[0150] In order to improve the binding force of nucleic acid aptamer HF3-58 and discover new aptamer functions, nucleic acid aptamer HF3-58 was further modified and optimized.

[0151] 1. Sequence design of aptamers 1 to 5

[0152] The results of previous studies showed that the structure of nucleic acid aptamer 55 (HF3-58) has a lower diameter S1 and an upper left stem-loop structure SL2 ( Figure 1 A) both play a supporting role in maintaining the secondary structure and ensuring the stability of the nucleic acid aptamer HF3-58 structure, but are not the direct binding region. Considering that the longer the nucleic acid aptamer is, the lower the synthesis yield is, HF3-58 is split to obtain nucleic acid aptamer 1 and nucleic acid aptamer 2. The results show that nucleic acid aptamer 1 and nucleic acid aptamer 2 do not have the ability to bind to the target when they exist alone, but they still have the ability to bind when they exist at the same time ( Figure 2 A). On this basis, HF3-58 was reassembled to obtain aptamer 3, and aptamer 4 and aptamer 5 were obtained by cutting the end and the right hairpin structure of aptamer 3. The nucleotide sequences of aptamers 1-5 correspond to sequences 1-5, and the detailed information is as follows:

[0153] Nucleic acid aptamer 1 (also known as split A): The nucleotide sequence is 5'-TGAGCAGCGTGGAGAGATACAGCGAC-3' (sequence 1), which is the 5' part of the nucleotide sequence of nucleic acid aptamer HF3-58 after disconnecting from the 23C and 24T positions, replacing the first three nucleotides at its 5' end from TTG to T (retaining the 4th to 16th nucleotides of HF3-58), and extending 12 nucleotides AGATACAGCGAC at its 3' end to obtain a nucleic acid aptamer.

[0154] Nucleic acid aptamer 2 (also known as split B): the nucleotide sequence is 5'-GTCGCTGTATCTCGACCGTGTTCGTTTGTTATAACGCTGCTC-3' (sequence 2), which is the 3' part of the nucleotide sequence of nucleic acid aptamer HF3-58 disconnected between positions 23C and 24T, and the bases 24-27 of HF3-58 are replaced with 12 bases GTCGCTGTATCT that complement the 12 bases at the 3' end of nucleic acid aptamer 1, and the bases 28 to 57 of HF3-58 are retained.

[0155] Nucleic acid aptamer 3 (also known as nucleic acid aptamer RHF-56): the nucleotide sequence is 5′-TTTCCGACCGTGTTCGTTTGTTATAACGCTGCTCCGGAGCAGCGTGGAGGAAATGC-3′ (sequence 3), which is a nucleic acid aptamer obtained by deleting the 1st and 2nd nucleotides of the HF3-58 nucleotide sequence, connecting the 3rd and 58th nucleotides, and disconnecting from the 23rd and 24th nucleotides. The new nucleic acid aptamer 3 has the 24th nucleotide T of the nucleic acid aptamer HF3-58 as the first nucleotide at the 5′ end, the 23rd nucleotide C as the 3′ end, that is, the 56th nucleotide, and the 19th nucleotide T of HF3-58 is replaced by A, and the other nucleotides remain unchanged.

[0156] Nucleic acid aptamer 4 (also known as RHF-53): The nucleotide sequence is 5′-TTTCCGACCGTGTTCGTTTGTTATAACGCTGCTCCGGAGCAGCGTGGAGGAAA-3′ (sequence 4), which is a nucleic acid aptamer obtained by deleting three nucleotides TGC from the 5′ end of the nucleotide sequence of nucleic acid aptamer 3 (RHF-56), while keeping the other nucleotides unchanged.

[0157] Nucleic acid aptamer 5 (also known as RHF-48), the nucleotide sequence is 5′-TATGCCGACCGTGTTCGTTTGTTATAACGCTGCGCAGCGTGGAGGCAT-3′ (sequence 5), which is a nucleic acid aptamer obtained by deleting positions 33 to 38 of the nucleotide sequence of nucleic acid aptamer 4, replacing the first T nucleotide at the 5′ end with an A nucleotide, the third T nucleotide with a G nucleotide, the A nucleotide at position 51 with a C nucleotide, the T nucleotide at position 52 with a T nucleotide, adding a T nucleotide at the 5′ end, and keeping the other nucleotides unchanged.

[0158] Aptamer 1 and aptamer 2 can form a new aptamer through complementary pairing and self-assembly, which is recorded as split aptamer 1+2. Figure 1 As shown in A. The secondary structure of aptamer 3-5 was inferred by IDT calculation, as shown in Figure 1 As shown in B.

[0159] 2. Flow cytometry and polyacrylamide gel electrophoresis of aptamers 1-5 and HF3-58 binding to MKN-45 cells and apparent equilibrium dissociation constant (K d ) determination

[0160] The affinity of aptamer to cells is determined by K d In this application, K dThe determination methods all use flow cytometry analysis, that is, the K is calculated by measuring the binding curve of nucleic acid aptamer and c-MET on the cell surface. d .

[0161] 1. Preparation and processing of nucleic acid aptamers

[0162] The 5′ ends of aptamer 1, aptamers 3, 4, 5 and aptamer HF3-58 are all labeled with fluorescein (6-FAM), while aptamer 2 has no fluorescent label. All of them were synthesized by Sangon Biotech (Shanghai) Co., Ltd.

[0163] The synthesized FAM-labeled aptamer 1 and the unlabeled aptamer 2 were dissolved in PBS buffer, and the concentrations were calculated according to the absorbance at 260 nm and finally prepared into 20 μM corresponding aptamer solutions. Then, the aptamer 1 solution and the aptamer 2 solution were mixed at equal concentrations to make the final concentration of each aptamer 10 μM, thereby obtaining a mixed solution of aptamers 1 and 2. The FAM-labeled aptamers 3, 4, 5 and the aptamer HF3-58 were dissolved in PBS buffer, and the concentrations were calibrated according to the absorbance at 260 nm and finally prepared into 10 μM solutions. The mixed solution of the aptamers 1 and 2 and the solutions of the aptamers 3, 4, 5 were subjected to denaturation-renaturation operation: heating at 95°C for 5 minutes, placing on ice for 10 minutes, and placing at room temperature (25°C) for 30 minutes to form a stable spatial structure. The mixed solution of aptamers 1 and 2, aptamer 3, aptamer 4, aptamer 5 and aptamer HF3-58 after denaturation and renaturation were stored in a -20°C refrigerator for later use. The mixed solution of aptamers 1 and 2, aptamer 3, aptamer 4, aptamer 5 and aptamer HF3-58 after denaturation and renaturation were diluted with binding buffer to prepare solutions with concentration gradients of 0, 0.006, 0.012, 0.024, 0.049, 0.098, 0.195, 0.391, 0.781, 1.562, 3.125, 6.25, 12.5, 25, 50, 100 and 200 nM.

[0164] 2. Binding of FAM-labeled aptamers to human gastric cancer cell MKN-45

[0165] Cell line pretreatment: Take a dish of human gastric cancer cells MKN-45 in the logarithmic growth phase, digest it with PBS solution containing 5mM EDTA, blow it into a monodisperse cell suspension, wash it twice with washing buffer, and resuspend it with binding buffer to a monodisperse cell suspension (cell concentration is 1×10 6 / mL) and divided into several equal portions.

[0166] The cell suspension was mixed with the mixed solution of the denatured and renatured aptamers 1 and 2, aptamer 3, aptamer 4, aptamer 5 and aptamer HF3-58 at different concentrations, respectively, and incubated at 4°C and 37°C for 30 min, respectively, washed twice with washing buffer, and the fluorescence intensity of the cell surface was measured using a FACS Calibur flow cytometer (BD Company).

[0167] The saturation binding curves were plotted using the average fluorescence intensity of the cell surface and the concentrations of the mixed solution of FAM-labeled aptamers 1 and 2, aptamers 3-5, and aptamer HF3-58. The formula Y = BmaxX / (K d +X)+NX to calculate the K of nucleic acid aptamer d .

[0168] The binding of the mixed solution of aptamers 1 and 2 (FAM sequence 1 + sequence 2) to MKN-45 cells is shown in Figure 2 As shown in A, only when two nucleic acid aptamers exist at the same time, the FAM fluorescence signal will appear on the cell surface at 4°C, indicating that after HF3-58 is split into two sequences, it still has the ability to bind to the target when two nucleic acid aptamers exist at the same time.

[0169] Based on this, the SL2 position of aptamer HF3-58 was cleaved and the sequence was rearranged to obtain aptamer 3, and aptamer 4 was optimized based on aptamer 3, and the stem S1 below was shortened based on aptamer 4 to obtain aptamer 5. The binding of aptamers 3-5 and aptamer HF3-58 to human gastric cancer cell MKN-45 at 4°C is shown in Figure 2. Figure 2 As shown in A, their fluorescence values ​​on the surface of MKN-45 cells are almost the same.

[0170] K values ​​of aptamers 1-5 binding to c-MET on the surface of MKN-45 cells at different temperatures d As shown in Table 1. As can be seen from Table 1, the K d reached 0.56nM, but increased by about 10 times at 37℃. After nucleic acid aptamers 1 and 2 were mixed and denatured, the K d The value increases. Nucleic acid aptamer 3-5, at 4℃K d The value is similar to that of HF3-58, and the K d The values ​​all increased, but the affinity increased compared with HF3-58.

[0171] K of aptamers 1-5 dThe data further showed that the stem S1 below the aptamer HF3-58 and the stem-loop region SL2 on the left serve as structural support regions, stabilizing the aptamer structure and not participating in binding. The aptamers 1 and 2 obtained by splitting and lengthening the complementary pairing region of the left stem-loop region SL2 still maintain the property of binding to the target. The affinity of the aptamers 3-5 obtained by further re-splicing and truncating the split-type aptamers at 37°C was improved to a certain extent. The high affinity of aptamers at 37°C is conducive to the application of aptamers in organisms.

[0172] 3. Polyacrylamide gel electrophoresis experiment

[0173] A 6% polyacrylamide gel was prepared, and the sample was loaded and electrophoresed for 1.5 h at a voltage of 200 V. After the electrophoresis, the gel was scanned and imaged using a multifunctional laser scanning imager (Cytiva Amersham Typhoon RGB).

[0174] The specific steps for loading samples are as follows:

[0175] ① The final concentration of aptamer 3 solution is 1 μM. After the sample is denatured and stabilized for 0.5 h, it is immediately loaded;

[0176] ② The final concentration of aptamer 3 solution is 1 μM. The sample is denatured and stabilized for 24 hours before loading;

[0177] ③ The final concentration of aptamer 4 solution is 1 μM. After the sample is denatured and stabilized for 0.5 h, it is immediately loaded;

[0178] ④ The final concentration of aptamer 4 solution is 1 μM. The sample is denatured and stabilized for 24 hours before loading;

[0179] ⑤ The final concentration of aptamer 5 solution is 1 μM. After the sample is denatured and stabilized for 0.5 h, it is immediately loaded;

[0180] ⑥ The final concentration of aptamer 5 solution is 1 μM. The sample is denatured and stabilized for 24 hours before loading;

[0181] ⑦ The final concentration of the nucleic acid aptamer HF3-58 solution is 1 μM. After the sample is denatured and stabilized for 0.5 h, it is immediately loaded;

[0182] ⑧ The final concentration of the nucleic acid aptamer HF3-58 solution is 1 μM. The sample is denatured and stabilized for 24 hours before loading;

[0183] The results are as follows Figure 2 B, it can be found that the optimized nucleic acid aptamers 3-5 all have two bands. The initial guess is that dimerization occurs between molecules, and the degree of dimerization increases with the stability time of the sample after denaturation.

[0184] 3. Competition experiment between HF3-58 and aptamer 5 on MKN-45 cells

[0185] Aptamer 5 was obtained on the basis of HF3-5. In order to prove that the target of aptamer 5 has not changed, a competitive binding cell experiment between aptamer 5 and HF3-58 was conducted.

[0186] 1. Preparation and processing of nucleic acid aptamers

[0187] The treatment of fluorescently labeled and unlabeled nucleic acid aptamers 5 and HF3-58 was as described above, and the following 3 used the nucleic acid aptamer after denaturation and renaturation.

[0188] 2. Pretreatment of cell lines

[0189] MKN-45 cells were treated as described previously.

[0190] 3. Competition between aptamer 5 and HF3-58

[0191] The sample addition method is as follows:

[0192] Take 1.5mL plastic centrifuge tubes, labeled ①-⑥, add 100μL of the pre-cooled MKN-45 cells pretreated in the above steps, and then perform the following treatments:

[0193] Cells were added to tube ① as the blank group;

[0194] To tube ②, cells were first added, and then FAM-labeled control nucleic acid aptamer 54 (TGGAGCAGCGTTATAACAAACGAACACGGTCGGAAAGCATATCCTCCACGCTGCTCC, sequence 54) (final concentration of 200 nM) was added as a negative control group (represented as nucleic acid aptamer 54 in the figure).

[0195] Cells were first added to tube ③, followed by unlabeled aptamer HF3-58 (final concentration of 1 μM), and 10 min later, FAM-labeled aptamer 5 shown in sequence 5 was added (final concentration of 200 nM), serving as the experimental group (denoted as un-aptamer HF3-58+aptamer 5 in the figure).

[0196] Cells were first added to tube ④, followed by unlabeled aptamer 5 (final concentration of 1 μM), and 10 min later, FAM-labeled aptamer HF3-58 (final concentration of 200 nM) was added to serve as the experimental group (denoted as un-aptamer 5 + aptamer HF3-58 in the figure).

[0197] In tube ⑤, cells were first added, and then FAM-labeled aptamer 5 (final concentration was 200 nM) was added to serve as a positive control group (denoted as aptamer 5 in the figure).

[0198] Cells were first added to tube ⑥, and then FAM-labeled nucleic acid aptamer HF3-58 (final concentration was 200 nM) was added to serve as a positive control group (denoted as nucleic acid aptamer HF3-58 in the figure).

[0199] According to the streaming results Figure 3 A shows that aptamer 5 and HF3-58 can compete with each other, indicating that their targets are both c-MET.

[0200] IV. HGF competes with aptamer 5 and HF3-58 for binding to MKN-45 cells

[0201] According to the above experiments, it has been preliminarily proved that the target of nucleic acid aptamer 5 is consistent with that of HF3-58. HGF is the only known ligand of c-MET and can promote the phosphorylation of c-MET to activate the downstream signaling pathway to perform biological functions. In order to explore whether nucleic acid aptamer 5 can be competed by HGF like HF3-58, it was verified on MKN-45 cells.

[0202] 1. Preparation and processing of nucleic acid aptamers

[0203] The treatment of fluorescently labeled and unlabeled nucleic acid aptamers 5 was as described above, and the following 4 used the nucleic acid aptamers after denaturation and renaturation.

[0204] 2. Pretreatment of cell lines

[0205] MKN-45 cells were treated as described previously.

[0206] 3. HGF protein preparation

[0207] HGF protein (Sino Biological, Cat. No. 10463-HNAS) was dissolved in water to a final concentration of 5 μM and stored at -80°C.

[0208] 4. Competitive binding of aptamer 5 and HGF to cells

[0209] The sample addition method is as follows:

[0210] Take 1.5mL plastic centrifuge tubes, labeled ①-⑥, add 100μL of the pre-cooled MKN-45 cells pretreated in the above steps, and then perform the following treatments:

[0211] Cells were added to tube ① as the blank group;

[0212] In tube ②, cells were first added, and then FAM-labeled control nucleic acid aptamer 54 (final concentration was 20 nM) was added as a negative control group.

[0213] In tube ③, cells were first added, and then HGF (final concentration was 20 nM) was added. After 10 min, FAM-labeled aptamer 5 (final concentration was 20 nM) was added to serve as the experimental group.

[0214] In tube ④, cells were first added, and then FAM-labeled aptamer 5 (final concentration was 200 nM) was added as a positive control group.

[0215] In tube ⑤, cells were first added, and then HGF (final concentration was 20 nM) was added. After 10 min, FAM-labeled nucleic acid aptamer HF3-58 (final concentration was 20 nM) was added to serve as the experimental group.

[0216] In tube ⑥, cells were first added, and then FAM-labeled nucleic acid aptamer HF3-58 (final concentration was 20 nM) was added as a positive control group.

[0217] The streaming results are as follows Figure 3 B shows that HGF can compete with aptamer 5 and HF3-58 for binding to cells, which once again proves that the target of aptamer 5 is c-MET, and the binding of aptamer 5 and HF3-58 to c-MET is affected by HGF.

[0218] Example 2: Polyacrylamide gel electrophoresis experiment of nucleic acid aptamer 5 and c-MET

[0219] Since aptamers 3-5 can form intermolecular aggregates, the factors affecting the intermolecular aggregation of aptamer 5 and its binding with the target were preliminarily explored.

[0220] 1. Gel electrophoresis of gradient concentrations of aptamer 5

[0221] 1. Preparation and treatment of nucleic acid aptamer 5

[0222] The steps for treating FAM-labeled aptamer 5 are as described above.

[0223] A concentration gradient of aptamer 5 solution was prepared by diluting with PBS to a final concentration of 10, 5, 2.5, 1.25, 0.63, and 0.31 μM.

[0224] 2. Polyacrylamide gel electrophoresis of concentration gradient aptamer 5

[0225] A 20% polyacrylamide denaturing gel was prepared, and the above-mentioned nucleic acid aptamer 5 with a concentration gradient was mixed with a DNA loading buffer before loading, and then electrophoresed for 2 hours at a voltage of 150 V. After the electrophoresis, the gel was scanned and imaged using a multifunctional laser scanning imager (CytivaAmersham Typhoon RGB).

[0226] like Figure 4A, The gel results show that aptamer 5 can form intermolecular dimers, and the degree of dimerization has no obvious correlation with concentration.

[0227] 2. Gel electrophoresis of the complex of c-MET protein and nucleic acid aptamer 5 at gradient concentrations

[0228] 1. Preparation and treatment of nucleic acid aptamer 5

[0229] The treatment procedure of the FAM-labeled nucleic acid aptamer 5 is as described above, and the following 2 uses the nucleic acid aptamer after denaturation and renaturation.

[0230] 2. Binding experiment of aptamer 5 and c-MET at concentration gradient

[0231] A series of concentration gradients of c-MET protein (Sino Biological, Cat. No. 10692-H03H) with concentrations of 0, 0.19, 0.39, 0.78, 1.56, 3.13, 6.25, 12.5, 25, 50, 100 and 200 nM were incubated with FAM-labeled aptamer 5 (final concentration 20 nM) on ice for 30 min.

[0232] 3. Polyacrylamide gel electrophoresis

[0233] A 6% polyacrylamide denaturing gel was prepared, and the sample was mixed with DNA loading buffer before loading, and electrophoresed for 0.5 h at a voltage of 120 V. After the electrophoresis, the gel was scanned and imaged using a multifunctional laser scanning imager (Cytiva Amersham Typhoon RGB).

[0234] As shown in the gel result figure 4B, the dimer formed by nucleic acid aptamer 5 can bind to the c-MET protein, and when the c-MET concentration is low, the dimer formed by nucleic acid aptamer 5 preferentially binds to c-MET, but as the c-MET concentration increases, the monomer of nucleic acid aptamer 5 will transform into a dimer and then bind to c-MET.

[0235] Example 3: Modification and optimization of the stem portion of the nucleic acid aptamer 5 structure

[0236] According to the results of Example 2 above, aptamer 5 binds to the target only in the case of dimerization. Based on this, aptamer 5 is modified to reduce the formation of dimers so that it binds to the target in the form of monomers. The optimized sequence is shown below. The secondary structures of all the modified aptamers 6-12 are as follows: Figure 5 As shown in A, 5B.

[0237] 1. Structural design of aptamers 6 to 12

[0238] Nucleic acid aptamer 6: (also known as RHF-yly), the nucleotide sequence is 5'-TAGCGCAGGACCGTGTTCGTTTGTTATAACGCTGCGCAGCGTGGACTGCGCT-3' (sequence 6), which is a nucleic acid aptamer obtained by replacing the 6 nucleotides of TATGCC at the 5' end of the nucleotide sequence of nucleic acid aptamer 5 with 8 nucleotides of TAGCGCAG, and replacing the 5 nucleotides of GGCAT at the 3' end with 7 nucleotides of CTGCGCT, while keeping the other nucleotides unchanged.

[0239] Nucleic acid aptamer 7 (also known as RHF+T+GC), the nucleotide sequence is 5'-TATCGCTCGACCGTGTTCGTTTGTTATAACGCTGCGCAGCGTGGAGGCGAT-3' (sequence 7), which is a nucleic acid aptamer obtained by adding nucleotide C between the nucleotides at positions 3 and 4 at the 5' end of the nucleotide sequence of nucleic acid aptamer 5, adding nucleotide T between the nucleotides at positions 5 and 6, adding nucleotide G between positions 46 and 47 at the 3' end, and keeping the other nucleotides unchanged.

[0240] Aptamer 8 (also known as aptamer RHF-48-GC) has a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACGCTGCGCAGCGTGGAGGAT-3' (sequence 8), which is obtained by deleting the 4th nucleotide G and the 46th nucleotide C of aptamer 5, while keeping the other nucleotides unchanged.

[0241] Aptamer 9 (also known as aptamer RHF-48-2GC) has a nucleotide sequence of 5'-TATCGACCGTGTTCGTTTGTTATAACGCTGCGCAGCGTGGAGAT-3' (sequence 9), which is a nucleic acid aptamer obtained by deleting the 4th nucleotide G, the 5th nucleotide C, the 46th nucleotide C and the 47th nucleotide G of the nucleotide sequence of aptamer 5, while keeping the other nucleotides unchanged.

[0242] Nucleic acid aptamer 10 (also known as nucleic acid aptamer RHF-48-3GC), the nucleotide sequence is 5'-TATGACCGTGTTCGTTTGTTATAACGCTGCGCAGCGTGGAAT-3' (sequence 10), which is a nucleic acid aptamer obtained by deleting the nucleotide G at the 4th position, the nucleotide C at the 5th position, the nucleotide C at the 6th position, the nucleotide G at the 44th position, the nucleotide G at the 45th position, and the nucleotide C at the 46th position of the nucleotide sequence of nucleic acid aptamer 5, and keeping the other nucleotides unchanged.

[0243] Nucleic acid aptamer 11 (also known as nucleic acid RHF-42), the nucleotide sequence is 5'-TCCGACCGTGTTCGTTTGTTATAACGCTGCGCAGCGTGGAGG-3' (sequence 11), which is a nucleic acid aptamer obtained by deleting the nucleotide A at the 2nd position, the nucleotide T at the 3rd position, the nucleotide G at the 4th position, the nucleotide C at the 46th position, the nucleotide A at the 47th position, and the nucleotide T at the 48th position of the nucleotide sequence of nucleic acid aptamer 5, and keeping the other nucleotides unchanged.

[0244] Aptamer 12 (also known as aptamer RHF-39) has a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACGCTGCGCAGCGT-3' (sequence 12), which is a nucleic acid aptamer obtained by deleting nucleotides GGAGGCAT from positions 41 to 48 of the nucleotide sequence of aptamer 5, while keeping other nucleotides unchanged.

[0245] II. Flow cytometry and polyacrylamide gel electrophoresis analysis of aptamer 6-12 binding to MKN-45 cells

[0246] 1. Preparation and treatment of nucleic acid aptamer 6-12

[0247] The processing steps of FAM-labeled aptamers 6-12 are as described above, and the following uses the denatured and renatured aptamers.

[0248] Flow cytometry was used to determine K d , the preparation of concentration gradient solution was consistent with the above method.

[0249] 2. Binding of nucleic acid aptamers to human gastric cancer cell MKN-45

[0250] The sample preparation and detection process were as described above.

[0251] The results of flow cytometry experiments with MKN-45 cells are shown in Figure 6 As shown in A, the fluorescence values ​​of aptamers 9-12 binding to cells were significantly lower than those of aptamer 5. According to previous results, the modified stem portion can stabilize the structure of aptamers HF3-58 but does not participate in direct binding. For aptamers 6 and 7, the length of the stem increased, and the Kd at 4℃ and 37℃ increased compared with 5. However, the fluorescence value of aptamer 8 obtained by deleting a pair of GC bases in the stem portion was almost the same as that of 5, and the Kd at 4℃ and 37℃ was d There is almost no difference, and even the fluorescence value of aptamer 8 is stronger than that of aptamer 5, which may be due to the reduced steric hindrance when binding to the target. However, by further shortening the stem part, aptamers 9 and 10 have a lower K value at 4°C and 37°C. dThe results show that the further reduction of the stem part affects the structural stability of the aptamer. Similarly, the affinity of aptamers 11 and 12 decreases due to the reduction of the number of complementary nucleotides.

[0252] Aptamer K 6-12 d The data (Table 1) show that as the number of complementary paired nucleotides in the terminal double-stranded region increases, the aptamer structure becomes more stable, but the affinity decreases, and the affinity is greatly affected by temperature. When a pair of complementary GC base sequences in the terminal double-stranded region is deleted, its affinity is not significantly different from that of aptamer 5, but further deletion of the number of complementary paired nucleotides greatly reduces its affinity. This indicates that the terminal double-stranded part does not directly participate in the binding with the target, and the best sequences are aptamers 5 and 8.

[0253] 3. Polyacrylamide gel electrophoresis experiment

[0254] The preparation process is as described above.

[0255] Detection Figure 6 As shown in B, these modified aptamers do not solve the problem of aptamer dimerization.

[0256] Example 4: Sequence modification to reduce dimerization of aptamer 5

[0257] According to the polyacrylamide gel electrophoresis results of Examples 1-3, all sequences have the problem of dimerization. This may be due to the large number of nucleotides in the two stems of aptamer 5 that are complementary to each other, resulting in the formation of intermolecular dimers between the two aptamers. The dimer sequence is speculated to be as follows: Figure 7 As shown in A, in order to reduce intermolecular dimerization, the complementary nucleotides in the sequence are mutated, partially deleted and inserted. The secondary structures of all the following aptamers 13-26 are as follows Figure 7 B and 8A, 8B.

[0258] 1. Design of Aptamers 13 to 24

[0259] Nucleic acid aptamer 13 (also known as nucleic acid aptamer RHF-48C 33 G 34 / P), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTGnCAGCGTGGAGGCAT-3' (SEQ ID NO: 13), n is iSp18, i.e. PEG modification, the 33rd and 34th nucleotides CG of the aptamer 5 nucleotide sequence are replaced with polyethylene glycol (PEG) modification, and the other nucleotides remain unchanged to obtain the aptamer.

[0260] Aptamer 14 (also known as aptamer RHF-48 2GC (32-34) / P), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTnAGCGTGGAGGCAT-3' (SEQ ID NO: 14), n is iSp18, i.e. PEG modification, wherein the 32-35 nucleotides GCGC of the aptamer 5 nucleotide sequence are replaced with PEG modification, and the other nucleotides remain unchanged to obtain the aptamer.

[0261] Aptamer 15: (also known as aptamer RHF-44), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTAGCGTGGAGGCAT-3' (sequence 15), which is a nucleic acid aptamer obtained by deleting nucleotides 32-35 of the nucleotide sequence of aptamer 5, while keeping the other nucleotides unchanged.

[0262] Nucleic acid aptamer 16 (also known as nucleic acid aptamer RHF-48-G 32 T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTTCGCAGCGTGGAGGCAT-3' (SEQ ID NO: 16), which is a nucleic acid aptamer obtained by replacing the nucleotide G at position 32 of the nucleic acid aptamer 5 nucleotide sequence with nucleotide T, while keeping the other nucleotides unchanged.

[0263] Nucleic acid aptamer 17 (also known as nucleic acid aptamer RHF-48-C 33 T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTGTGCAGCGTGGAGGCAT-3' (SEQ ID NO: 17), which is a nucleic acid aptamer obtained by replacing the 33rd nucleotide C in the nucleotide sequence of nucleic acid aptamer 5 with nucleotide T, while keeping the other nucleotides unchanged.

[0264] Nucleic acid aptamer 18 (also known as nucleic acid aptamer RHF-48-G 34 T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTGCTCAGCGTGGAGGCAT-3' (SEQ ID NO: 18), which is a nucleic acid aptamer obtained by replacing the 34th nucleotide G in the nucleotide sequence of nucleic acid aptamer 5 with nucleotide T, while keeping other nucleotides unchanged.

[0265] Nucleic acid aptamer 19 (also known as nucleic acid aptamer RHF-48-C 35 T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTGCGTAGCGTGGAGGCAT-3' (SEQ ID NO: 19), which is a nucleic acid aptamer obtained by replacing the 35th nucleotide C in the nucleotide sequence of nucleic acid aptamer 5 with nucleotide T, while keeping other nucleotides unchanged.

[0266] Nucleic acid aptamer 20 (also known as nucleic acid aptamer RHF-48-A 36 T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTGCGCTGCGTGGAGGCAT-3' (SEQ ID NO: 20), which is a nucleic acid aptamer obtained by replacing the 36th nucleotide A in the nucleotide sequence of nucleic acid aptamer 5 with nucleotide T, while keeping the other nucleotides unchanged.

[0267] Nucleic acid aptamer 21 (also known as nucleic acid aptamer RHF-48-G 32,34 2T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTTCTCAGCGTGGAGGCAT-3' (sequence 21), which is a nucleic acid aptamer obtained by replacing the nucleotides G at positions 32 and 34 of the nucleic acid aptamer 5 nucleotide sequence with nucleotide T, while keeping the other nucleotides unchanged.

[0268] Nucleic acid aptamer 22 (also known as nucleic acid aptamer RHF-48-C 33,35 2T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTGTGTAGCGTGGAGGCAT-3' (SEQ ID NO: 22), which is a nucleic acid aptamer obtained by replacing the nucleotide C at positions 33 and 35 of the nucleic acid aptamer 5 nucleotide sequence with nucleotide T, while keeping the other nucleotides unchanged.

[0269] Nucleic acid aptamer 23 (also known as nucleic acid aptamer RHF-48-C 33 G 34 2T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTGTTCAGCGTGGAGGCAT-3' (SEQ ID NO: 23), which is a nucleic acid aptamer obtained by replacing the nucleotides CG at positions 33 and 34 of the nucleic acid aptamer 5 nucleotide sequence with nucleotides TT, while keeping the other nucleotides unchanged.

[0270] Nucleic acid aptamer 24 (also known as nucleic acid aptamer RHF-48-G 32 C 33 G 34 C 35 4T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTTTTTAGCGTGGAGGCAT-3' (SEQ ID NO: 24), which is a nucleic acid aptamer obtained by replacing the nucleotides GCGC at positions 32-35 of the nucleic acid aptamer 5 nucleotide sequence with the nucleotides TTTT, while keeping the other nucleotides unchanged.

[0271] Nucleic acid aptamer 25 (also known as nucleic acid aptamer RHF-48+32T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTTGCGCAGCGTGGAGGCAT-3' (sequence 25), which is a nucleic acid aptamer obtained by adding a nucleotide T between the 31st nucleotide T and the 32nd nucleotide G in the nucleotide sequence of nucleic acid aptamer 5, and keeping the other nucleotides unchanged.

[0272] Nucleic acid aptamer 26 (also known as nucleic acid aptamer RHF-48+T3), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTGCTTTGCAGCGTGGAGGCAT-3' (sequence 26), which is a nucleic acid aptamer obtained by adding three nucleotides T between the 34th nucleotide C and the 35th nucleotide G of the nucleic acid aptamer 5 nucleotide sequence, while keeping the other nucleotides unchanged.

[0273] II. Flow cytometric analysis and polyacrylamide gel electrophoresis analysis of the binding of nucleic acid aptamer 13-26 to MKN-45 cells

[0274] 1. Preparation and treatment of nucleic acid aptamers 13-26

[0275] The processing steps of FAM-labeled aptamers 13-26 are as described above, and the following uses the denatured and renatured aptamers.

[0276] Their K d The assay method was as described above.

[0277] 2. Binding of nucleic acid aptamers to human gastric cancer cell MKN-45

[0278] The preparation process was as described above.

[0279] Flow cytometry analysis ( Fig. 9 ) showed that there was no significant difference in the fluorescence intensity of all the sequences tested when binding to MKN-45 cells, but their K d The values ​​(Table 1) show that these modified sequences still maintain a certain target binding ability at 4°C, but the affinity at 37°C is greatly reduced. Among them, nucleic acid aptamers 13 and 14 use PEG to replace some nucleotides, but as the number of replaced nucleotides increases, the affinity gradually decreases. Nucleic acid aptamer 15 has a greatly reduced affinity due to the deletion of more nucleotides. Nucleic acid aptamers 16-20 reduce dimerization by mutating one or two nucleotides, but their affinity is also greatly reduced. Nucleic acid aptamers 25 and 26 add nucleotides to the sequence to cause mismatches, and their affinity is also reduced.

[0280] 2. Polyacrylamide gel electrophoresis

[0281] The preparation process was as described above.

[0282] Gel electrophoresis results ( Fig.10 ) showed that, except for aptamer 23, the dimers of the other aptamers 13-22, 24 and 25 were greatly reduced or even disappeared, and the binding K d The data of the above values ​​indicate that the less the dimers formed between nucleic acid aptamer molecules, the weaker the binding force between nucleic acid aptamer and c-MET.

[0283] Example 5: Sequence modification to further study the relationship between aptamer self-dimerization and affinity

[0284] The above results indicate that the less dimerization the sequence of aptamer 5 is modified, the smaller the affinity is. Therefore, it is planned to further modify the aptamer based on aptamer 5 to confirm the relationship between the dimerization of the aptamer itself and the affinity.

[0285] Nucleic acid aptamer 27 (also known as nucleic acid aptamer RHF-48TA-GC), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAGCGCTGCGCAGCGCGGAGGCAT-3' (sequence 27), which is a nucleic acid aptamer obtained by replacing the nucleotide A at position 27 with nucleotide G, the nucleotide T at position 40 with nucleotide C, and keeping the other nucleotides unchanged in the nucleotide sequence of nucleic acid aptamer 5.

[0286] Nucleic acid aptamer 28 (also known as nucleic acid aptamer RHF-48+34T), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAACGCTGCtGCAGCGTGGAGGCAT-3' (sequence 28), which is a nucleic acid aptamer obtained by adding a nucleotide T between the 33rd nucleotide C and the 35th nucleotide G in the nucleotide sequence of nucleic acid aptamer 5, while keeping the other nucleotides unchanged.

[0287] Aptamer 29 (also known as aptamer RHF-38) has a nucleotide sequence of 5'-TTTCCGACCGTGTTCGTTTGTTATAATGGAGGAAATGC-3' (sequence 29), which is obtained by deleting nucleotides from positions 27 to 44 of the nucleotide sequence of aptamer 5, while keeping other nucleotides unchanged.

[0288] The secondary structures of all the optimized nucleic acid aptamers 27-29 are shown in Fig.11 As shown in A.

[0289] II. Flow cytometry and polyacrylamide gel electrophoresis experiments of aptamer 27-29 binding to MKN-45 cells

[0290] 1. Preparation and treatment of nucleic acid aptamers 27-29

[0291] The steps for treating the FAM-labeled aptamers 27-29 were as described above, and the following steps used the denatured and renatured aptamers.

[0292] K of FAM-labeled aptamer 27-29 d Detection was as described previously.

[0293] 2. Binding of nucleic acid aptamers to human gastric cancer cell MKN-45

[0294] The preparation process was as described above.

[0295] Combined by flow Fig.11 B, Only aptamer 29 lost its ability to bind to cells.

[0296] K of aptamer 27 d The values ​​at 4°C and 37°C were the same as those of aptamer 5, and the affinity of aptamer 28 did not decrease significantly at 4°C, but decreased at 37°C. Aptamer 29 lost its ability to bind to the target protein.

[0297] 3. Polyacrylamide gel electrophoresis

[0298] The preparation process was as described above.

[0299] Gel results Fig.11 As shown in Figure C, aptamer 27 mainly exists in the form of dimer, while aptamers 28 and 29 are mainly in the form of monomers. Aptamer 27 increases the number of complementary GC base pairs, which increases the tendency to form dimers. Aptamer 28 adds nucleotide T at position 34, which adds a pair of unpaired bases in the middle of the double-stranded part of the molecule, reducing the ability to form intermolecular dimers. Aptamer 29 does not form a double-stranded part in the middle of the molecule, resulting in its inability to form dimers. Binding K d The data showed that the aptamer dimer was more likely to bind to the target.

[0300] Example 6: Determination of the binding site between the nucleic acid aptamer 5 dimer and c-MET

[0301] Based on the above experimental results and previous studies, it is speculated that the aptamer dimer consists of Figure 7 The intermediate sequence shown is complementary and paired to form a bivalent double-stranded nucleic acid aptamer, and two target binding sites are formed at both ends of the bivalent double-stranded nucleic acid aptamer. In order to prove this speculation, the bivalent double-stranded nucleic acid aptamer was modified, the binding site sequence at one end of the bivalent double-stranded nucleic acid aptamer was deleted, two sequences that can complement each other to form a double strand and retain the inferred binding site at one end were designed, and its binding ability and binding site with the target were explored.

[0302] The sequence of the bivalent double-stranded nucleic acid aptamer is Fig.12 As shown in A, the nucleic acid aptamer 5 is split between the 33rd nucleotide C and the 34th nucleotide G to form two complementary chains, and 7 pairs of complementary nucleotides are extended at the ends of the double chains to obtain nucleic acid aptamers 30 and 31, whose specific sequences are as follows:

[0303] Nucleic acid aptamer 30 (also known as nucleic acid aptamer RHF-22), the nucleotide sequence is 5'-TGAGACAGCAGCGTGGAGGCAT-3' (sequence 30), starting from the 5' end of the nucleic acid aptamer 5 nucleotide sequence, retaining nucleotides from positions 34 to 48, and extending TGAGACA 7 nucleotides at the 5' end, while keeping the other nucleotides unchanged to obtain the nucleic acid aptamer.

[0304] Nucleic acid aptamer 31 (also known as nucleic acid aptamer RHF-40), the nucleotide sequence is 5′-TATGCCGACCGTGTTCGTTTGTTATAACGCTGCTGTCTCA-3′ (sequence 31), which is a nucleic acid aptamer obtained by retaining nucleotides 1 to 33 from the 5′ end of the nucleic acid aptamer 5 nucleotide sequence, and extending TGTCTCA at the 3′ end to 7 nucleotides complementary to the 5′ end of nucleic acid aptamer 30, while keeping the other nucleotides unchanged.

[0305] II. Flow cytometry experiment of aptamer 30+31 binding to MKN-45 cells

[0306] 1. Preparation and processing of nucleic acid aptamers 30,31

[0307] The 5' end of the nucleic acid aptamer 31 was labeled with FAM and the unlabeled nucleic acid aptamer 30 was dissolved to a certain concentration, and stored in a -20°C refrigerator after denaturation and renaturation. The specific preparation process was as described above.

[0308] The synthesized FAM-labeled aptamer 31 and the unlabeled aptamer 30 were dissolved in PBS buffer, and the concentration was calibrated according to the absorbance at 260 nm and finally prepared into a 20 μM solution. Then, the FAM-labeled aptamer 30 solution and the aptamer 31 solution were mixed with equal concentrations to a final concentration of 10 μM. The remaining experimental steps were as described above to obtain the bivalent double-stranded aptamer 30+31.

[0309] 2. Binding of Aptamer 30+31 to Human Gastric Cancer Cell MKN-45

[0310] The preparation process was as described above.

[0311] Flow cytometry analysis results ( Fig.12 B), FAM-labeled aptamer 31 does not bind to MKN-45 cells. When aptamer 30 and aptamer 31 coexist, the fluorescence intensity of MKN-45 cells increases.d The value is larger than that of aptamer 5 with two binding sites, indicating that the two form a bivalent double-stranded nucleic acid aptamer that binds to cells. Since there is only one binding site for c-MET, the affinity is slightly weaker than that of aptamer 5.

[0312] Example 7: Optimization of bivalent double-stranded nucleic acid aptamers

[0313] After HGF binds to c-MET, it can promote the dimerization of c-MET and lead to the phosphorylation of c-MET, thereby activating related signaling pathways and promoting cell proliferation, migration and dispersion. In addition, HGF and its receptors have been shown to be related to neurological diseases, immunity, and the regeneration of blood vessels. However, due to the short half-life of HGF, although some researchers have used strategies to directly introduce the HGF gene through viral vectors, or to replace HGF with antibody drugs to exert biological functions in vivo. However, there are still defects such as loading the HGF gene and not guaranteeing the immediate expression of HGF protein and batch differences in the production of antibodies. Therefore, it is necessary to develop new molecules that can replace HGF to exert biological functions in vivo.

[0314] Since the bivalent double-stranded nucleic acid aptamer has two binding sites for c-MET, it may have the function of causing c-MET dimerization. Therefore, the bivalent double-stranded nucleic acid aptamer was further sequenced and the sequence with HGF physiological function was explored.

[0315] The double-stranded structures 32+33 and 34+35 formed by the modified sequences are as follows Fig.13 As shown in (1), the sequence of the middle stem of aptamer 5 (i.e., nucleotides 27-40 at the 5' end), the sequence of the middle stem of 8 (i.e., nucleotides 29-38 at the 5' end), and the sequence of the middle stem of 11 (i.e., nucleotides 26-35 at the 5' end) are mutated and extended to find the best bivalent double-stranded aptamer. The specific aptamer sequences are as follows:

[0316] Nucleic acid aptamer 32 (also known as nucleic acid aptamer di48-A), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATATCTCTGCTTTCTCTGGAGGCAT-3' (sequence 32), which is a nucleic acid aptamer obtained by replacing 14 nucleotides from positions 27 to 40 of the nucleic acid aptamer 5 nucleotide sequence with 14 nucleotides TCTCTGCTTTCTCT, while keeping the other nucleotides unchanged.

[0317] Nucleic acid aptamer 33 (also known as nucleic acid aptamer di48-B), the nucleotide sequence is 5'-TATGCCGACCGTGTTCGTTTGTTATAAGAGAAAGCAGAGAGGAGGCAT-3' (sequence 33), which is a nucleic acid aptamer obtained by replacing the 14 nucleotides AGAGAAAGCAGAGA at positions 27 to 40 of the nucleic acid aptamer 5 nucleotide sequence, and the replaced nucleotides are complementary to the replacement sequence of di48-A, and the other nucleotides remain unchanged.

[0318] Nucleic acid aptamer 34 (also known as nucleic acid aptamer BVBS-18-5A), the nucleotide sequence is 5'-CCGACCGTGTTCGTTTGTTATAACGTGCTGCGCGCTCTGTGGAGG-3' (sequence 34), which is obtained by replacing 10 nucleotides from positions 26 to 35 of the nucleotide sequence of nucleic acid aptamer 11 with 14 nucleotides GTGCTGCGCGCTCT, and deleting the first nucleotide T at the 5' end of nucleic acid aptamer 11, while keeping the other nucleotides unchanged.

[0319] Nucleic acid aptamer 35 (also known as nucleic acid aptamer BVBS-18-5B), the nucleotide sequence is 5'-CCGACCGTGTTCGTTTGTTATAACAGAGCGCGCAGCACGTGGAGG-3' (sequence 35), which is a nucleic acid aptamer obtained by replacing 10 nucleotides from positions 26 to 35 of the nucleotide sequence of nucleic acid aptamer 11 with 14 nucleotides AGAGCGCGCAGCAC, and deleting the first nucleotide T at the 5' end of nucleic acid aptamer 11, while keeping the other nucleotides unchanged.

[0320] Nucleic acid aptamer 36 (also known as nucleic acid aptamer BVBS18A), the nucleotide sequence is 5'-TATCCGACCGTGTTCGTTTGTTATAACGTGCTGCGCGCTCTGTGGAGGAT-3' (sequence 36), which is based on nucleic acid aptamer 8, retaining its nucleotides 1-28, adding two nucleotides TG between the nucleotides 28-29, retaining the nucleotides 29-34, deleting the A nucleotide at position 35, retaining the nucleotides at positions 36 and 37, and adding three nucleotides TCT between the nucleotides 37 and 38, and keeping the other nucleotides unchanged to obtain a nucleic acid aptamer.

[0321] Nucleic acid aptamer 37 (also known as nucleic acid aptamer BVBS18B), the nucleotide sequence is 5'-TATCCGACCGTGTTCGTTTGTTATAACAGAGCGCGCAGCACGTGGAGGAT-3' (sequence 37), which is based on nucleic acid aptamer 8, retaining its 1-27 nucleotides, replacing the 28-30 nucleotides with 3 nucleotides AGA, retaining the 31-34 nucleotides, and adding 2 nucleotides GC between the 34 and 35 nucleotides, retaining the 35-37 nucleotides, and adding 2 nucleotides AC between the 37 and 38 nucleotides, and keeping the other nucleotides unchanged to obtain a nucleic acid aptamer, the 26-43 nucleotides of nucleic acid aptamer 36 and the 26-43 nucleotides of nucleic acid aptamer 37, a total of 18 pairs of nucleotides, are reversely complementary and self-assembled to form a bivalent double-stranded nucleic acid aptamer 36+37.

[0322] Aptamer 38 (also known as aptamer BVBS14A), with a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACGGCGCGCTCTGTGGAGGAT-3' (sequence 38), is a aptamer obtained by deleting nucleotides 29-32 from the nucleotide sequence of aptamer 36, while keeping other nucleotides unchanged.

[0323] Nucleic acid aptamer 39 (also known as nucleic acid aptamer BVBS14B), with a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACAGAGCGCGCCGTGGAGGAT-3' (sequence 39), is a nucleic acid aptamer obtained by deleting nucleotides 37-40 on the basis of the nucleotide sequence of nucleic acid aptamer 37, while keeping other nucleotides unchanged. Nucleotides 26-39 of nucleic acid aptamer 39 and 14 pairs of nucleotides 26-39 of nucleic acid aptamer 38 are reversely complementary and self-assembled to form a bivalent double-stranded nucleic acid aptamer 38+39.

[0324] Aptamer 40 (also known as aptamer BVBS16A), with a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACGCTGCGCGCTCTGTGGAGGAT-3' (sequence 40), is a aptamer obtained by deleting nucleotides 29 and 30 from the nucleotide sequence of aptamer 36, while keeping other nucleotides unchanged.

[0325] Nucleic acid aptamer 41 (also known as nucleic acid aptamer BVBS16B), with a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACAGAGCGCGCAGCGTGGAGGAT-3' (sequence 41), is a nucleic acid aptamer obtained by deleting nucleotides 39 and 40 on the basis of the nucleotide sequence of nucleic acid aptamer 37, while keeping other nucleotides unchanged. Nucleotides 26-43 of nucleic acid aptamer 41 and 16 pairs of nucleotides 26-41 of nucleic acid aptamer 40 are reversely complementary and self-assembled to form a bivalent double-stranded nucleic acid aptamer 40+41.

[0326] Aptamer 42 (also known as aptamer BVBS20A), with a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACGTGTGCTGCGCGCTCTGTGGAGGAT-3' (sequence 42), is obtained by adding two nucleotides TG between the 28th and 29th nucleotides of the aptamer 36 nucleotide sequence, while keeping the other nucleotides unchanged.

[0327] Nucleic acid aptamer 43 (also known as nucleic acid aptamer BVBS20B), with a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACAGAGCGCGCAGCACACGTGGAGGAT-3' (sequence 43), is a nucleic acid aptamer obtained by adding two nucleotides CA between the 40th and 41st nucleotides of the nucleic acid aptamer 37 nucleotide sequence, while keeping the other nucleotides unchanged. The 26th to 45th nucleotides of nucleic acid aptamer 43 and the 26th to 45th nucleotides of nucleic acid aptamer 42, a total of 20 pairs of nucleotides, are reversely complementary and self-assembled to form a bivalent double-stranded nucleic acid aptamer 42+43.

[0328] Nucleic acid aptamer 44 (also known as nucleic acid aptamer BVBS22A), with a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACGTGTGTGCTGCGCGCTCTGTGGAGGAT-3' (sequence 44), is a nucleic acid aptamer obtained by adding 4 nucleotides TGTG between the 28th and 29th nucleotides of the nucleic acid aptamer 36 nucleotide sequence, while keeping the other nucleotides unchanged.

[0329] Aptamer 45 (also known as aptamer BVBS22B) has a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACAGAGCGCGCAGCACACACGTGGAGGAT-3' (sequence 45). It is a nucleic acid aptamer obtained by adding four nucleotides CACA between the 40th and 41st nucleotides on the basis of the nucleotide sequence of aptamer 37, while keeping the other nucleotides unchanged. The 26th to 45th nucleotides of aptamer 45 and the 26th to 47th nucleotides of aptamer 44, a total of 22 pairs of nucleotides, are reversely complementary and self-assembled to form a bivalent double-stranded nucleic acid aptamer 44+45.

[0330] Nucleic acid aptamer 46 (also known as nucleic acid aptamer BVBS24A), with a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACGTGTGTGTGCTGCGCGCTCTGTGGAGGAT-3' (sequence 46), is a nucleic acid aptamer obtained by adding 6 nucleotides TGTGTG between the 28th and 29th nucleotides based on the nucleotide sequence of nucleic acid aptamer 36, while keeping the other nucleotides unchanged.

[0331] Nucleic acid aptamer 47 (also known as nucleic acid aptamer BVBS24B), with a nucleotide sequence of 5'-TATCCGACCGTGTTCGTTTGTTATAACAGAGCGCGCAGCACACACACGTGGAGGAT-3' (sequence 47), is a nucleic acid aptamer obtained by adding 6 nucleotides CACACA between the 40th and 41st nucleotides of the nucleic acid aptamer 37 nucleotide sequence, while keeping the other nucleotides unchanged. The 26th to 45th nucleotides of nucleic acid aptamer 47 and the 26th to 45th nucleotides of nucleic acid aptamer 46, a total of 24 pairs of nucleotides, are reversely complementary and self-assembled to form a bivalent double-stranded nucleic acid aptamer 46+47.

[0332] The above-mentioned nucleic acid aptamers 32 and 33, 34 and 35, 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 are denatured and renatured according to the above method, and can be self-assembled to form corresponding bivalent double-stranded nucleic acid aptamers 32+33, 34+35, 36+37, 38+39, 40+41, 42+43, 44+45, 46+47 respectively.

[0333] 2. Flow cytometry and polyacrylamide gel electrophoresis experiments of the binding of bivalent double-stranded nucleic acid aptamers to MKN-45 cells

[0334] 1. Preparation and treatment of bivalent double-stranded nucleic acid aptamers

[0335] The 5′ end of the DNA represented by nucleic acid aptamers 32, 34, 36, 38, 40, 42, 44, and 46 was labeled with FAM, and nucleic acid aptamers 33, 35, 37, 39, 41, 43, 45, and 47 were not labeled.

[0336] The synthesized nucleic acid aptamers 32 and 33, 34 and 35, 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 solutions were mixed and dissolved in a ratio of 1:1, 1:2 or 2:1 to prepare solutions with a final concentration of 10 μM for each nucleic acid aptamer, and stored in a -20°C refrigerator after denaturation and renaturation to obtain mixed solutions of each nucleic acid aptamer, namely, bivalent double-stranded nucleic acid aptamers 32+33, 34+35, 36+37, 38+39, 40+41, 42+43, 44+45, 46+47.

[0337] Determination of K of bivalent double-stranded nucleic acid aptamers d The concentration gradient of the bivalent double-stranded nucleic acid aptamer obtained after mixing is prepared as described above.

[0338] 2. Binding of bivalent double-stranded aptamers to human gastric cancer cell MKN-45

[0339] The specific experimental steps are as described above.

[0340] Streaming results Fig.13 (2) A shows that the bivalent double-stranded aptamers 32 and 33, 34 and 35, 36 and 37 can bind to MKN-45 cells only when two complementary aptamers are present at the same time, and the binding strength is independent of the concentration ratio of the two complementary chains. d The values ​​show that the number of complementary paired bases in the two complementary paired sequences does not have a significant effect on their affinity at 4°C, but as the number of complementary paired bases increases, the affinity of the mixture of aptamers 36 and 37 is the strongest at 37°C, indicating that its ability to bind to the target at 37°C has not decreased and its secondary structure is relatively stable. On the basis of aptamers 36 and 37, when the number of complementary paired nucleotides in the middle part is increased or decreased, the fluorescence intensity of the two chains binding to MKN-45 cells at 4°C and 37°C did not change at all when the final concentration of the two chains was 200nM and the ratio was 1:1 ( Fig.13 (2) B, 13 (2) C), and the affinities of the optimized bivalent double-stranded nucleic acid aptamers 40+41, 42+43, 44+45, and 46+47 were not much different (Table 1), indicating that the number of complementary paired nucleotides in the middle part has little effect on the binding of the bivalent double-stranded nucleic acid aptamer to the target protein.

[0341] 3. Polyacrylamide gel electrophoresis

[0342] Aptamers 32 and 33, 34 and 35, 36 and 37 were mixed and dissolved at a concentration ratio of 1:1 / 2:1 / 1:2, respectively, to prepare a final concentration of 1 μM for aptamers 32, 34, and 36, and a concentration of 0.5, 1, and 2 μM for aptamers 33, 35, and 37, respectively, as required. After mixing, the mixture was denatured and subjected to gel electrophoresis.

[0343] The specific experimental steps are as described above.

[0344] Gel electrophoresis results Fig.14 As shown in A, it shows that the A and B chains of the bivalent double-stranded nucleic acid aptamer will form a bivalent double-stranded nucleic acid aptamer at different concentration ratios. Due to the cost of raw materials, 1:1 is conventionally selected for experiments.

[0345] Aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 were mixed and dissolved in a ratio of 1:1, respectively, to prepare a final concentration of 1 μM for aptamers 36, 38, 40, 42, 44, 46, and a final concentration of 2 μM for aptamers 37, 39, 41, 43, 45, 47, and denatured after mixing. At the same time, gel electrophoresis was performed using a FAM-labeled aptamer as a negative control.

[0346] Fig.14 B indicates that nucleic acid aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, and 46 and 47 form bivalent double-stranded nucleic acid aptamers in a ratio of 1:1.

[0347] Example 8: Bivalent double-stranded nucleic acid aptamers promote phosphorylation of c-MET and activation of downstream signaling pathways

[0348] In order to explore whether the bivalent double-stranded nucleic acid aptamer has similar biological functions to HGF, the bivalent double-stranded nucleic acid aptamer modified in Example 7 was subjected to functional studies.

[0349] 1. Binding of bivalent double-stranded nucleic acid aptamers to A549 / DDP cells

[0350] 1. Pretreatment of A549 / DDP cell line

[0351] A549 / DDP cells were prepared as described previously, as were MKN-45.

[0352] 2. Preparation of bivalent double-stranded nucleic acid aptamers

[0353] The 5′ end of the DNA represented by nucleic acid aptamers 36, 38, 40, 42, 44, and 46 was labeled with FAM, while nucleic acid aptamers 37, 39, 41, 43, 45, and 47 were not labeled.

[0354] The synthesized nucleic acid aptamers 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 were mixed and dissolved in a 1:1 ratio to prepare a final concentration of each nucleic acid aptamer of 10 μM, and stored in a -20°C refrigerator after denaturation and renaturation to obtain bivalent double-stranded nucleic acid aptamers 36+37, 38+39, 40+41, 42+43, 44+45, 46+47.

[0355] The nucleic acid aptamers 4, 5, and 8 were prepared according to the above method, dissolved to a certain concentration, and stored in a -20°C refrigerator after denaturation and renaturation.

[0356] 3. Binding of A549 / DDP to bivalent double-stranded nucleic acid aptamers

[0357] The pretreatment steps of A549 / DDP cells were as described above. The bivalent double-stranded nucleic acid aptamers 36+37, 38+39, 40+41, 42+43, 44+45, and 46+47 with a final concentration of 200 nM were combined with A549 / DDP cells at 4°C and 37°C. Other treatments were as described above.

[0358] Flow cytometric analysis Fig.15 As shown, the bivalent double-stranded nucleic acid aptamer can bind to A549 / DDP cells at both 4°C and 37°C, indicating that c-MET protein is expressed on the cell surface.

[0359] 2. Nucleic acid aptamers have the function of promoting the dimerization phosphorylation of c-MET

[0360] 1. Preparation of nucleic acid aptamers

[0361] The 5′ end of the DNA represented by nucleic acid aptamers 4, 5, 8, 32, 34, 36, 38, 40, 42, 44, and 46 was labeled with FAM, and nucleic acid aptamers 33, 35, 37, 39, 41, 43, 45, and 47 were not labeled.

[0362] The synthesized nucleic acid aptamers 32 and 33, 34 and 35, 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 were mixed and dissolved in a ratio of 1:1 to prepare a mixed solution with a final concentration of 10 μM for each nucleic acid aptamer, i.e., a bivalent double-stranded nucleic acid aptamer. Nucleic acid aptamers 4, 5, and 8 were prepared according to the above method and dissolved to a certain concentration. They were all stored in a -20°C refrigerator after denaturation and renaturation.

[0363] 2. Pretreatment of cell lines

[0364] Take the following logarithmic growth phase A549 / DDP cells, digest them with trypsin, and count the cells for 10 6 / mL, 10 per well of a 12-well plate 6After culturing at 37°C for 12 h, the cells were starved for 24 h using culture medium without fetal bovine serum.

[0365] 3. Extraction of phosphorylated c-MET protein

[0366] (1) After starvation, the cells were washed twice with PBS and 1 mL of the corresponding nucleic acid aptamer was added as follows:

[0367] The aptamer was diluted to 10 nM in 1640 medium without FBS.

[0368] ① Add 1640 medium without FBS as a negative control group;

[0369] ② Add nucleic acid aptamer 4 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0370] ③ Add aptamer 5 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0371] ④ Add nucleic acid aptamer 8 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0372] ⑤ Add bivalent double-stranded nucleic acid aptamer 34+35 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0373] ⑥ Add bivalent double-stranded nucleic acid aptamer 32+33 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0374] ⑦ Add bivalent double-stranded nucleic acid aptamer 36+37 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0375] ⑧ Add bivalent double-stranded nucleic acid aptamer 38+39 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0376] ⑨ Add bivalent double-stranded nucleic acid aptamer 40+41 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0377] ⑩ Add bivalent double-stranded nucleic acid aptamer 42+43 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0378] The bivalent double-stranded nucleic acid aptamer 44+45 was added at a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0379] The bivalent double-stranded nucleic acid aptamer 46+47 was added at a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0380] (2) The samples in step ① were incubated at 37°C for 20 min, washed twice with PBS precooled at 4°C, and 70 μL of lysis buffer containing protease and phosphatase inhibitors precooled at 4°C was added to each well. The cells were placed on ice for 3 min, and then the cells were scraped into a centrifuge tube. The cells were centrifuged at 12,000 rpm at 4°C for 8 min and the supernatant was collected.

[0381] (3) Quantification of extracted proteins by BCA method

[0382] (4) The quantified protein sample was added to a sample loading buffer containing SDS and heated at 95°C for 10 minutes. 20 μg of the protein sample was loaded onto a 10% polyacrylamide gel containing SDS and electrophoresed at 120 V for 120 minutes.

[0383] (5) After electrophoresis, the proteins in the gel were transferred to a methanol-activated PVDF membrane. After blocking with 5% bovine serum albumin (BSA) for 60 min, Phospho-Met (Tyr1234 / 1235) (D26) XP@Rabbit mAb (CST, Catalog No.: 3077S) (dilution ratio: 1:1000) was added and incubated for 12 h. After washing, the secondary antibody Anti-rabbit IgG, HRP-linked Antibody (CST, Catalog No.: 7074S) was added and incubated at room temperature for 60 min. After washing, the luminescent solution (Thermo Fisher, Catalog No.: 34577) was added and luminescent imaging was performed using a chemiluminescence imaging system (Shanghai Tianneng Technology Co., Ltd., Tanon 5200Multi).

[0384] (6) After the luminescence was completed, the PVDF membrane was recovered and washed with restore membrane washing solution (Thermo Fisher, Catalog No.: 622999) at room temperature for 15 minutes to remove the bound Phospho-Met (Tyr1234 / 1235) primary antibody and secondary antibody. After blocking with 5% BSA for 60 minutes, Anti-Met (c-Met) antibody (ABCAM: Catalog No. ab51067) (dilution ratio: 1:1000) was added and incubated for 8 hours. After washing, Anti-mouse IgG, HRP-linked Antibody (CST, Catalog No.: 7076s) was added and incubated at room temperature for 60 minutes. After washing, luminescence solution (Thermo Fisher, Catalog No.: 34577) was added and luminescence imaging was performed using a chemiluminescence imaging system (Shanghai Tianneng Technology Co., Ltd., Tanon 5200Multi).

[0385] (7) After the luminescence is completed, the PVDF membrane is recovered and the specific membrane washing steps are as shown in (6). After the PVDF membrane is re-sealed, β-Actin antibody (C4) (sc-47778) is added and incubated at room temperature for 2 hours. After washing, Anti-mouse IgG, HRP-linked Antibody (CST, Catalog No.: 7076s) is added and incubated at room temperature for 60 minutes. After washing, imaging is performed.

[0386] like Fig.16 As shown in A, aptamer 4 and bivalent double-stranded aptamer 36+37 can promote the dimerization and phosphorylation of c-MET protein. Fig.16 B shows that the bivalent double-stranded nucleic acid aptamers 42+43 and 44+45 obtained by adding or deleting the number of middle complementary bases on the basis of the bivalent double-stranded nucleic acid aptamer 36+37 have a significant effect on promoting the phosphorylation of c-MET. Among them, the bivalent double-stranded nucleic acid aptamers 36+37 and 42+43 have the strongest ability to promote the phosphorylation of c-MET at the same concentration, and the other bivalent double-stranded nucleic acid aptamers have no obvious function of promoting phosphorylation, indicating that the number of complementary paired bases in the middle stem part of the bivalent double-stranded nucleic acid aptamer will affect its function, which may be related to the distance between the monomers of the c-MET dimer under physiological conditions. Fig.16 C is the relative value of the c-MET phosphorylation level promoted by aptamers 4, 5 and bivalent double-stranded aptamers 36+37, 42+43 at a final concentration of 10 nM relative to 1 nM HGF. It can be seen that the phosphorylation level of bivalent double-stranded aptamer 42+43 is the highest.

[0387] 3. Nucleic acid aptamers have the function of promoting the phosphorylation of c-MET downstream proteins

[0388] 1. Preparation of nucleic acid aptamers

[0389] The 5′ end of the DNA represented by nucleic acid aptamers 4, 5, 8, 32, 34, 36, 38, 40, 42, 44, and 46 was labeled with FAM, and nucleic acid aptamers 33, 35, 37, 39, 41, 43, 45, and 47 were not labeled.

[0390] The synthesized nucleic acid aptamers 32 and 33, 34 and 35, 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 were mixed and dissolved in a ratio of 1:1 to prepare bivalent double-stranded nucleic acid aptamers with a final concentration of 10 μM for each nucleic acid aptamer, and the remaining steps were as described above.

[0391] 2. Pretreatment of cell lines

[0392] The steps are as described above.

[0393] 3. Protein extraction

[0394] (1) After starvation, the cells were washed twice with PBS and 1 mL of the corresponding nucleic acid aptamer was added as follows:

[0395] The aptamer was diluted to 10, 1, and 0.1 nM in 1640 medium without FBS.

[0396] ① Add 1640 medium without FBS as a negative control group;

[0397] ② Add bivalent double-stranded nucleic acid aptamer 36+37 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0398] ③ Add bivalent double-stranded nucleic acid aptamer 36+37 with a final concentration of 1 nM and a volume of 1 mL as the experimental group;

[0399] ④ Add bivalent double-stranded nucleic acid aptamer 36+37 with a final concentration of 0.1 nM and a volume of 1 mL as the experimental group;

[0400] ⑤ Add bivalent double-stranded nucleic acid aptamer 42+43 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0401] ⑥ Add bivalent double-stranded nucleic acid aptamer 42+43 with a final concentration of 1 nM and a volume of 1 mL as the experimental group;

[0402] ⑦ Add bivalent double-stranded nucleic acid aptamer 42+43 with a final concentration of 0.1 nM and a volume of 1 mL as the experimental group;

[0403] (2) The samples in step ① were incubated at 37°C for 20 min, washed twice with PBS precooled at 4°C, and 70 μL of lysis buffer containing protease and phosphatase inhibitors precooled at 4°C was added to each well. The cells were placed on ice for 3 min, and then the cells were scraped into a centrifuge tube. The cells were centrifuged at 12,000 rpm at 4°C for 8 min and the supernatant was collected.

[0404] (3) Quantification of extracted proteins by BCA method

[0405] (4) The samples were subjected to gel electrophoresis using the same method as above.

[0406] (5) After transfer, the membrane was blocked and 60 min later, Phospho-Gab1 (Tyr627) (CST, Catalog No.: 3233S), Phospho-p44142 MAPK (Erk1 / 2) (Thr202 / Tyr204) (CST, Catalog No.: 4370S), Phospho-Akt (Ser473) (CST, Catalog No.: 4060S) (dilution ratio of 1:1000), and β-Actin antibody (santacruze, Catalog No.: sc-47778) were added and incubated for 12 h. After washing, the corresponding secondary antibodies, rabbit antibody or mouse antibody, were added and incubated at room temperature for 60 min. After washing, the luminescent solution was added and luminescent imaging was performed using a chemiluminescence imaging system (Shanghai Tianneng Technology Co., Ltd., Tanon 5200Multi).

[0407] Fig.16 D Western-plot results showed that the bivalent double-stranded nucleic acid aptamer at a concentration as low as 1 nM could induce the activation of c-MET downstream signaling.

[0408] Example 9: Effects of nucleic acid aptamers on binding to DU145 cells and on the dispersion function of the cells

[0409] 1. Preparation of nucleic acid aptamers

[0410] The 5′ end of the DNA represented by nucleic acid aptamers 3, 4, 5, 8, 32, 34, 36, 38, 40, 42, 44, and 46 was labeled with FAM, and nucleic acid aptamers 33, 35, 37, 39, 41, 43, 45, and 47 were not labeled.

[0411] The synthesized nucleic acid aptamers 32 and 33, 34 and 35, 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 were mixed and dissolved in a ratio of 1:1 to prepare a bivalent double-stranded nucleic acid aptamer with a final concentration of 10 μM, and stored in a -20°C refrigerator after denaturation and renaturation. Nucleic acid aptamers 3, 4, 5, and 8 were prepared according to the above method, dissolved to a certain concentration, and stored in a -20°C refrigerator after denaturation and renaturation.

[0412] 2. Binding of nucleic acid aptamers to DU145 cells

[0413] The pretreatment steps of DU145 cells were as described above. The bivalent double-stranded nucleic acid aptamers 32+33, 34+35, 36+37, 38+39, 40+41, 42+43, 44+45, and 46+47 with a final concentration of 200 nM were combined with DU145 cells at 4°C and 37°C. Other treatments were as described above.

[0414] like Fig.17As shown, the bivalent double-stranded nucleic acid aptamer can bind to DU145 cells at both 4°C and 37°C.

[0415] 3. Dispersion experiment of DU145

[0416] Take the DU145 cells in the logarithmic growth phase, digest them with trypsin, count the cells at 2000 / mL, and seed 2000 cells in each well of a 6-well plate. After incubation at 37°C for 3 days, starve the cells for 24 hours. After starvation for 24 hours, wash the cells twice with PBS, and add each nucleic acid aptamer and 1nM HGF in a volume of 1mL with a final concentration of 10nM prepared by 1640 medium without FBS to each well. The specific samples are as follows:

[0417] ① Add 1640 medium without FBS as a negative control group;

[0418] ② Add HGF with a final concentration of 1 nM and a volume of 1 mL as a positive control group;

[0419] ③ Add aptamer 3 with a final concentration of 10 nM and a volume of 1 mL as the experimental group

[0420] ④ Add aptamer 4 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0421] ⑤ Add aptamer 5 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0422] ⑥ Add nucleic acid aptamer 8 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0423] ⑦ Add bivalent double-stranded nucleic acid aptamer 34+35 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0424] ⑧ Add bivalent double-stranded nucleic acid aptamer 32+33 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0425] ⑨ Add bivalent double-stranded nucleic acid aptamer 38+39 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0426] ⑩ Add bivalent double-stranded nucleic acid aptamer 40+41 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0427] The bivalent double-stranded nucleic acid aptamer 36+37 was added at a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0428] The bivalent double-stranded nucleic acid aptamer 42+43 was added at a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0429] The bivalent double-stranded nucleic acid aptamer 44+45 was added at a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0430] The bivalent double-stranded nucleic acid aptamer 46+47 was added at a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0431] After adding the corresponding samples, the cells were photographed at time points 0h and 24h using an OLYMPUSIX71 camera.

[0432] Fig.18 The figure shows the dispersion of DU145 cells 24 hours after adding the above samples. The results show that HGF, aptamers 3, 4, and bivalent double-stranded aptamers 36+37, 42+43 have obvious promoting dispersion effects on DU145 cells, bivalent double-stranded aptamer 44+45 has a slightly poorer promoting dispersion effect on cells, and other aptamers have no biological function of promoting cell dispersion. This result is consistent with the phosphorylation result in Example 8 above.

[0433] Example 10: Nucleic acid aptamers have the function of promoting cell migration

[0434] 1. Preparation of nucleic acid aptamers

[0435] The 5′ end of the DNA represented by nucleic acid aptamers 32, 34, 36, 38, 40, 42, 44, and 46 was labeled with FAM, and nucleic acid aptamers 33, 35, 37, 39, 41, 43, 45, and 47 were not labeled.

[0436] The synthesized nucleic acid aptamers 32 and 33, 34 and 35, 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 were mixed and dissolved in a 1:1 ratio, and the final concentration of each nucleic acid aptamer was 10 μM. The bivalent double-stranded nucleic acid aptamers 32+33, 34+35, 36+37, 38+39, 40+41, 42+43, 44+45, 46+47 were prepared by denaturation-renaturation, and stored in a -20°C refrigerator after denaturation-renaturation.

[0437] 2. Pretreatment of cell lines

[0438] Take the cells DU145 in the logarithmic growth phase, digest them with trypsin, and count the cells for 10 6 / mL, 10 seeds per well of a 6-well plate 6 After incubation at 37°C for 24 h, the cells were starved for 24 h.

[0439] 3. Migration experiment of DU145

[0440] After starvation for 24 hours, the cells were washed twice with PBS, and each bivalent double-stranded nucleic acid aptamer was added to each well at a final concentration of 10 nM and a volume of 1 mL in 1640 medium without FBS. The specific samples are as follows:

[0441] ① Add bivalent double-stranded nucleic acid aptamer 38+39 with a final concentration of 10 nM and a volume of 1 mL as a negative control group;

[0442] ② Add bivalent double-stranded nucleic acid aptamer 40+41 with a final concentration of 10 nM and a volume of 1 mL as a negative control group;

[0443] ③ Add bivalent double-stranded nucleic acid aptamer 36+37 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0444] ④ Add bivalent double-stranded nucleic acid aptamer 42+43 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0445] ⑤ Add bivalent double-stranded nucleic acid aptamer 44+45 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0446] ⑥ Add bivalent double-stranded nucleic acid aptamer 46+47 with a final concentration of 10 nM and a volume of 1 mL as the experimental group;

[0447] After adding the corresponding samples, the cells were photographed at time points 0h and 24h using an OLYMPUSIX71 camera.

[0448] like Fig.19 As shown, only bivalent double-stranded nucleic acid aptamers 36+37 and 42+43 have a significant effect on promoting migration of DU145 cells, while bivalent double-stranded nucleic acid aptamer 44+45 has no significant effect on promoting migration, and other bivalent double-stranded nucleic acid aptamers have no biological function of promoting cell migration. This result is consistent with the result of promoting cell dispersion in Example 9 above.

[0449] Example 11: Binding of nucleic acid aptamers to mouse cells

[0450] 1. Preparation of nucleic acid aptamers

[0451] The 5′ end of the DNA represented by nucleic acid aptamers 32, 34, 36, 38, 40, 42, 44, and 46 was labeled with FAM, and nucleic acid aptamers 33, 35, 37, 39, 41, 43, 45, and 47 were not labeled.

[0452] The synthesized nucleic acid aptamers 32 and 33, 34 and 35, 36 and 37, 38 and 39, 40 and 41, 42 and 43, 44 and 45, 46 and 47 were mixed and dissolved in a 1:1 ratio, and the final concentration of each nucleic acid aptamer was 10 μM. The bivalent double-stranded nucleic acid aptamers were prepared by denaturation and renaturation and stored in a -20°C refrigerator.

[0453] 2. Pretreatment of cell lines

[0454] Take one dish of mouse cells 4T1, ATDC45, RAW264.7, MS1 (pancreatic endothelial cell line), MC38 (mouse colon adenocarcinoma cell line) in logarithmic growth phase, and the specific processing steps are as described above. Then mix with the above-mentioned bivalent double-stranded nucleic acid aptamer, incubate for 30 minutes at 4°C, wash twice with washing buffer, and measure the fluorescence intensity of the cell surface with FACS Calibur flow cytometer (BD company). Use nucleic acid aptamer 5 and nucleic acid aptamer 54 as controls.

[0455] Stream Fig. 20 As shown, the bivalent double-stranded nucleic acid aptamer cannot bind to mouse cells.

[0456] Example 12, Serum stability test of nucleic acid aptamer 5 and K d Determination of

[0457] In the practical application of nucleic acid aptamers, such as clinical serum sample detection and drug research, the anti-nuclease stability of nucleic acid aptamers is crucial. Thio-modification is one of the methods to enhance the nuclease stability of nucleic acid aptamers. In this example, nucleic acid aptamer 5 was modified by thio and polyethylene glycol (PEG) to obtain nucleic acid aptamer 48 and nucleic acid aptamer 49, and the serum stability of thio-modified nucleic acid aptamers 48, 49 and original nucleic acid aptamer 5 in different concentrations of fetal bovine serum (FBS) was tested. This example also tested the K binding of thio-modified nucleic acid aptamers 48 and 49 to MKN-45 cells. d Assays were performed to examine the effect of thiolation modification on the affinity of the original aptamer.

[0458] 1. Design of thiolated and polyethylene glycol-modified aptamers

[0459] The phosphodiester bonds in some nucleotides of aptamer 5 were thiolated to obtain aptamer 48. The thiolation method and aptamer are shown below, with sA, sT, sG, and sC representing thiolated modified nucleotides:

[0460] Nucleic acid aptamer 48 (also known as nucleic acid aptamer RHF-48 / S): The nucleotide sequence is 5′-TATGCCGACCGTGTTCGTTTGTTAsTsAsACGCTGCGCAGCGTGGAsGsGsCsAsT-3′ (sequence 48), which is a nucleic acid aptamer obtained by thiolation-modifying the phosphodiester bond between the 25th to 27th nucleotides from the 5′ end and the phosphodiester bond between the 1st to 5th nucleotides from the 3′ end of the nucleic acid aptamer 5 nucleotide sequence, while keeping the other nucleotides unchanged.

[0461] Nucleic acid aptamer 49 (also known as nucleic acid aptamer RHF-48 / S / PEG): Its nucleotide sequence is 5′-TATGCCGACCGTGTTCGTTTGTTAsTsAsACGCTGCGCAGCGTGGAsGsGsCsAsT-iSp18-3′ (sequence 49, iSp18 is PEG-modified), which is a nucleic acid aptamer obtained by thio-modifying the phosphodiester bond between the 25th to 27th nucleotides from the 5′ end of the nucleic acid aptamer 5 nucleotide sequence and the phosphodiester bond between the 1st to 5th nucleotides from the 3′ end, and modifying the 3′ end with polyethylene glycol PEG, while keeping the other nucleotides unchanged.

[0462] II. Binding of Aptamers 5, 48, and 49 to MKN-45 Cells and Their K d Determination of

[0463] 1. Preparation of nucleic acid aptamers

[0464] The 5′ of aptamers 5, 48, and 49 were labeled with FAM. The specific experimental steps were as described in step 2 of Example 1 and synthesized by Sangon Biotech (Shanghai) Co., Ltd. The specific preparation steps were as described above. The denatured and renatured aptamers used were as follows.

[0465] 2. Binding of nucleic acid aptamers to MKN-45 cells

[0466] MKN-45 cells were pretreated as described previously.

[0467] The preparation of nucleic acid aptamers in concentration gradient was as described above.

[0468] K d The calculation method of is as described above.

[0469] like Fig.21 As shown in A, the apparent fluorescence intensity of aptamers 48, 49 and aptamer 5 modified with thiolation and PEG addition on the surface of MKN-45 cells was not significantly different. As shown in Table 1, the K values ​​of aptamers 48 and 49 modified with thiolation and PEG addition at 4°C and 37°C were calculated. dIt is not much different from the original nucleic acid aptamer 5, indicating that these thiolation modifications do not affect the binding ability of the nucleic acid aptamer.

[0470] 2. Serum stability test of nucleic acid aptamers

[0471] 1. Preparation of nucleic acid aptamers

[0472] The 5′ of nucleic acid aptamers 5, 48, and 49 were labeled with FAM, and the specific experimental steps were as described above.

[0473] 2. Incubation and treatment of nucleic acid aptamers with fetal bovine serum

[0474] Fetal bovine serum (FBS) was diluted to 90% with pure 1640 medium, and 5′-labeled FAM aptamers 5, 48, and 49 were diluted to a concentration of 1 μM with 90% FBS. After mixing, 20 μL was immediately removed to a new centrifuge tube and 1 μL of 0.5M EDTA solution was added. Then, the solution was placed at 95°C for 10 minutes and stored in a -20°C refrigerator. The remaining solution was placed in a 37°C water bath. At 5 minutes, 30 minutes, 1 hour, 2 hours, 3 hours, 4 hours, 8 hours, and 24 hours, 20 μL was removed, and the above process of adding EDTA, denaturing at 95°C for 10 minutes, and storing at -20°C was repeated.

[0475] 3. Urea-polyacrylamide gel electrophoresis

[0476] Prepare 20% urea-polyacrylamide denaturing gel, take out the sample and thaw it before loading, mix it with DNA loading buffer containing saturated urea (7M), denature it at 95℃ for 10min, cool it on ice, centrifuge and mix it, and electrophoresed it at 200V for 1.5h after loading. After the electrophoresis, scan the gel with a multi-function laser scanning imager (Cytiva Amersham TyphoonRGB).

[0477] The results are as follows Fig.21 As shown in B-21D, the stability of nucleic acid aptamer 5 in 90% FBS can reach 8 hours, while the serum stability of aptamer 48 and aptamer 49 modified by thio and PEG can reach 24 hours, indicating that thio and PEG can significantly improve the stability of nucleic acid aptamers.

[0478] Example 13. Serum stability test of bivalent double-stranded nucleic acid aptamers 36+37 and 42+43 and their relationship with K d Determination

[0479] The optimization purpose of the nucleic acid aptamer is the same as that of Example 12, that is, the serum stability of the bivalent double-stranded nucleic acid aptamer is improved by thiolation and modification of PEG at the 3' end.

[0480] 1. Design of thio- and PEGyl-modified aptamers

[0481] The phosphodiester bonds in some nucleotides of aptamers 36, 37, 42, and 43 were modified by thiolation and PEG to obtain aptamers 50, 51, 52, and 53, which are represented by sA, sT, sG, and sC in the sequence as thiolated modified nucleotides:

[0482] Nucleic acid aptamer 50 (also known as nucleic acid aptamer BVBS18A / S / PEG): the nucleotide sequence is 5′-TATCCGACCGTGTTCGTTTGTTATAACGTGCTGCGCGCTCTGTGGsAsGsGsAsT-iSp18-3′ (sequence 50, iSp18 is PEG-modified), which is a nucleic acid aptamer obtained by thio-modifying the phosphodiester bond between the 1st to 5th nucleotides from the 3′ end of the nucleic acid aptamer 36 nucleotide sequence, modifying PEG at the 3′ end, and keeping the other nucleotides unchanged.

[0483] Nucleic acid aptamer 51 (also known as nucleic acid aptamer BVBS18B / S / PEG): the nucleotide sequence is 5′-TATCCGACCGTGTTCGTTTGTTATAACAGAGCGCGCAGCACGTGGsAsGsGsAsT-iSp18-3′ (sequence 51, iSp18 is PEG-modified). It is a nucleic acid aptamer obtained by thio-modifying the phosphodiester bond between the 1st to 5th nucleotides from the 3′ end of the nucleic acid aptamer 37 nucleotide sequence, modifying the 3′ end with polyethylene glycol PEG, and keeping the other nucleotides unchanged.

[0484] Nucleic acid aptamer 52 (also known as nucleic acid aptamer BVBS20A / S / PEG): the nucleotide sequence is 5′-TATCCGACCGTGTTCGTTTGTTATAACGTGTGCTGCGCGCTCTGTGGsAsGsGsAsT-iSp18-3′ (sequence 52, iSp18 is PEG modification), which is a nucleic acid aptamer obtained by thio-modifying the phosphodiester bond between the 1st to 5th nucleotides from the 3′ end of the nucleic acid aptamer 42 nucleotide sequence, modifying PEG at the 3′ end, and keeping the other nucleotides unchanged.

[0485] Nucleic acid aptamer 53 (also known as nucleic acid aptamer BVBS20B / S / PEG): the nucleotide sequence is 5′-TATCCGACCGTGTTCGTTTGTTATAACAGAGCGCGCAGCACACGTGGsAsGsGsAsT-iSp18-3′ (sequence 53, iSp18 is PEG-modified), which is a nucleic acid aptamer obtained by thio-modifying the phosphodiester bond between the 1st to 5th nucleotides from the 3′ end of the nucleic acid aptamer 43 nucleotide sequence, modifying PEG at the 3′ end, and keeping the other nucleotides unchanged.

[0486] 2. Sulfate-modified bivalent double-stranded nucleic acid aptamers 50+51, 52+53, 36+37 and 42+43K d Determination of

[0487] 1. Preparation of nucleic acid aptamers

[0488] The 5′ ends of aptamers 36, 42, 50, and 52 were labeled with FAM, while aptamers 37, 43, 51, and 53 were not labeled. Aptamers FAM-36, 42, 50, and 52 were mixed with aptamers 37, 43, 51, and 53 in a ratio of 1:2, respectively, with a final concentration of 10 μM, and denatured and renatured to obtain bivalent double-stranded aptamers 36+37, 42+43, 50+51, and 52+53. The remaining steps were as described above.

[0489] 2. Binding of nucleic acid aptamers to human gastric cancer cell MKN-45 cells

[0490] The specific steps are as shown above.

[0491] K d The calculation method of is as described above. Fig. 22 As shown in A, the apparent binding fluorescence values ​​of the bivalent double-stranded nucleic acid aptamers 36+37, 42+43, 50+51, and 52+53 binding to MKN-45 cells at 4°C and 37°C were not significantly different. d The K values ​​of the bivalent double-stranded nucleic acid aptamers 50+51 and 52+53 modified with thio and PEG at 4°C and 37°C were found to be d The values ​​were not significantly different from those of the unmodified bivalent double-stranded aptamer, indicating that these thiolation modifications did not affect the binding ability of the aptamer.

[0492] 3. Serum stability test of nucleic acid aptamers

[0493] 1. Preparation of nucleic acid aptamers

[0494] The 5′ end of aptamers 36, 42, 50, 52 was labeled with FAM, while aptamers 37, 43, 51, 53 were not labeled. Aptamers FAM-36, 42, 50, 52 were mixed with aptamers 37, 43, 51, 53 in a ratio of 1:2, and the final concentration of the two was 10 μM. The bivalent double-stranded aptamers 36+37, 42+43, 50+51, 52+53 were obtained by denaturation and renaturation. The 5′ end labeled FAM aptamers 36, 42, 50, 52 were prepared into a solution with a final concentration of 10 μM. The remaining steps were as shown above.

[0495] 2. Incubation and treatment of nucleic acid aptamers with fetal bovine serum

[0496] FBS was diluted to 90% with pure 1640 medium, and the 5′-end labeled FAM nucleic acid aptamers 36, 50 and bivalent double-stranded nucleic acid aptamers 36+37, 42+43, 50+51, 52+53 were diluted to a concentration of 1 μM with 90% FBS. The rest of the method was the same as Example 12.

[0497] 3. Urea-polyacrylamide gel electrophoresis

[0498] The specific steps are the same as before.

[0499] like Fig. 22 As shown in B, aptamer 36 can be maintained in 90% fetal bovine serum for up to 120 min, but aptamer 50 obtained after thiolation and PEG modification can be stable in 90% fetal bovine serum for up to 24 h, indicating that thiolation and polyethylene glycol can significantly improve the stability of aptamers. Fig. 22 C shows that the bivalent double-stranded nucleic acid aptamers 36+37 and 42+43 and the bivalent double-stranded nucleic acid aptamers obtained by thio and PEG modification of 50+51 and 52+53 have high serum stability in 10% FBS, and the stability of the bivalent double-stranded nucleic acid aptamers obtained by 50+51 and 52+53 in 90% FBS at 4 h is significantly higher than that of the unmodified bivalent double-stranded nucleic acid aptamers 36+37 and 42+43.

[0500] Table 1 shows the K values ​​of aptamers binding to MKN-45 cells. d

[0501]

[0502]

[0503] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be implemented in a wide range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the present invention and without the need for unnecessary experimentation. Although the present invention provides specific embodiments, it should be understood that further improvements may be made to the present invention. In short, according to the principles of the present invention, this application intends to include any changes, uses or improvements to the present invention, including changes made by conventional techniques known in the art that depart from the scope disclosed in this application. Applications of some of the basic features may be made within the scope of the following appended claims.

Claims

1. A nucleic acid aptamer, which is any one of the following A1) to A11): A1) The single-stranded DNA molecule shown in sequence 3; A2) The single-stranded DNA molecule shown in sequence 4; A3) The single-stranded DNA molecule shown in sequence 5; A4) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 1 and the single-stranded DNA molecule shown in sequence 2 by complementary pairing; A5) deleting, adding and / or replacing one or more nucleotides of the nucleic acid aptamer shown in any one of A1) to A4) to obtain a derivative of the nucleic acid aptamer having the same function as the nucleic acid aptamer; A6) performing nucleotide substitution or modification on the nucleic acid aptamer shown in any one of A1) to A5) to obtain a derivative of the nucleic acid aptamer having the same function as the nucleic acid aptamer; A7) transforming the backbone of the nucleic acid aptamer shown in any one of A1) to A6) into a thiophosphate backbone to obtain a derivative of the nucleic acid aptamer having the same function as the nucleic acid aptamer; A8) obtaining an RNA molecule encoded by any one of the nucleic acid aptamers shown in A1) to A7) to obtain a nucleic acid aptamer derivative having the same function as the nucleic acid aptamer; A9) a peptide nucleic acid encoded by a nucleic acid aptamer as shown in any one of A1) to A8) to obtain a derivative of a nucleic acid aptamer having the same function as the nucleic acid aptamer; A10) connecting a signal molecule and / or an active molecule and / or a functional group and / or a radioactive nuclide and / or a modifying group to one end or the middle of the nucleic acid aptamer shown in any one of A1) to A9) to obtain a derivative of the nucleic acid aptamer having the same function as the nucleic acid aptamer; A11) self-assembles two nucleic acid aptamers that can complement each other among any of the nucleic acid aptamers shown in A1) to A10) to form a nucleic acid aptamer.

2. The nucleic acid aptamer according to claim 1, characterized in that: The modification is phosphorylation, methylation, amination, thiolation, isotopization or polyethylene glycol modification; Or, the functional group is a fluorescent group, a biotin group, a radioactive substance, a therapeutic substance, digoxin, a nanoluminescent material or an enzyme label; Alternatively, the modifying group is polyethylene glycol.

3. The nucleic acid aptamer according to claim 1 or 2, characterized in that: The nucleic acid aptamer shown in A5)-A11) is any one of the following: B1) a single-stranded DNA molecule represented by any one of sequences 6-11, 13, 14, 17-28, 48 and 49; B2) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 30 and the single-stranded DNA molecule shown in sequence 31 by complementary pairing, B3) The nucleic acid aptamer obtained by modifying B2) as follows: the nucleotides 1-14 in the single-stranded DNA molecule shown in sequence 30 and the nucleotide residues 27-40 in the single-stranded DNA molecule shown in sequence 31 that can complementarily pair therewith are replaced with nucleotide fragments of any length in the range of 7-30 nt that can complementarily pair therewith; B4) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 32 and the single-stranded DNA molecule shown in sequence 33, B5) The nucleic acid aptamer obtained by modifying B4) as follows: the nucleotides 27-40 in the single-stranded DNA molecule shown in sequence 32 and the nucleotide residues 27-40 in the single-stranded DNA molecule shown in sequence 33 that can complementarily pair therewith are replaced with nucleotide fragments of any length in the range of 7-30 nt that can complementarily pair therewith; B6) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 34 and the single-stranded DNA molecule shown in sequence 35, B7) The nucleic acid aptamer obtained by modifying B6) as follows: the nucleotides 23-40 in the single-stranded DNA molecule shown in sequence 34 and the nucleotides 23-40 in the single-stranded DNA molecule shown in sequence 35 that can complementarily pair therewith are replaced with nucleotide fragments of any length in the range of 7-30 nt that can complementarily pair therewith; B8) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 36 and the single-stranded DNA molecule shown in sequence 37, B9) The nucleic acid aptamer obtained by modifying B8) as follows: the nucleotides 26-43 in the single-stranded DNA molecule shown in sequence 36 and the nucleotides 26-43 in the single-stranded DNA molecule shown in sequence 37 that can complementarily pair therewith are replaced with nucleotide fragments of any length in the range of 7-30 nt that can complementarily pair therewith; B10) B8) is transformed as follows to obtain a nucleic acid aptamer: The nucleotides 26-43 in the single-stranded DNA molecule shown in sequence 36 and the nucleotides 26-43 in the single-stranded DNA molecule shown in sequence 37 that can complementarily pair therewith are replaced by nucleotide fragments of any length within the range of 7-30 nt that can complementarily pair therewith; and deleting and / or adding and / or replacing one or several nucleotides from nucleotides 1 to 25 in the single-stranded DNA molecule shown in sequence 36 or sequence 37 and / or deleting and / or adding and / or replacing one or several nucleotides from nucleotides 44 to 50 in the single-stranded DNA molecule shown in sequence 36 or sequence 37; B11) A nucleic acid aptamer obtained by modifying B8) as follows: the nucleotide residues in the single-stranded DNA molecule shown in sequence 36 are modified by thiolation and / or polyethylene glycol, and the nucleotide residues in the single-stranded DNA molecule shown in sequence 37 are modified by thiolation and / or polyethylene glycol.

4. The nucleic acid aptamer according to claim 3, characterized in that: The nucleic acid aptamer shown in B10) is any one of the following: C1) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 38 and the single-stranded DNA molecule shown in sequence 39 by complementary pairing, C2) The nucleic acid aptamer obtained by modifying C1) as follows: the nucleotides 26-39 of the nucleic acid aptamer 39 and the nucleotides 26-39 of the single-stranded DNA molecule shown in the sequence 38 that can complementarily pair with it are replaced by nucleotide fragments of any size in the range of 7-30 nt in length that can complementarily pair with it.

5. The nucleic acid aptamer according to claim 4, characterized in that: The nucleic acid aptamer shown in C2) is any of the following: D1) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule represented by sequence 40 and the single-stranded DNA molecule represented by sequence 41, D2) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule shown in sequence 42 and the single-stranded DNA molecule shown in sequence 43, D3) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule represented by sequence 44 and the single-stranded DNA molecule represented by sequence 45, D4) A nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule represented by sequence 46 and the single-stranded DNA molecule represented by sequence 47 by complementary pairing.

6. The nucleic acid aptamer according to claim 3, characterized in that: The nucleic acid aptamer shown in B11) is any one of the following: C3) a nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule represented by sequence 50 and the single-stranded DNA molecule represented by sequence 51, C4) A nucleic acid aptamer formed by self-assembly of the single-stranded DNA molecule represented by sequence 52 and the single-stranded DNA molecule represented by sequence 53 by complementary pairing.

7. A reagent containing the nucleic acid aptamer according to any one of claims 1 to 6.

8. Use of the nucleic acid aptamer according to any one of claims 1 to 6 or the reagent according to claim 7 in any of the following: E1) Enrichment and extraction of c-MET; E2) Identify or assist in identifying c-MET; E3) binds to or assists in binding to c-MET; E4) activates or assists in the activation of c-MET; E5) detecting or assisting in detecting whether the sample to be tested contains c-MET; E6) detecting or assisting in detecting the c-MET content in the sample to be tested; E7) detecting or assisting in detecting tumors or tumor cells expressing c-MET; E8) Identify or assist in identifying tumors or tumor cells; E9) binding or assisting in binding to tumors or tumor cells; E10) targeting c-MET; E11) Diagnosis or treatment of c-MET related diseases; E12) promotes the dimerization phosphorylation of c-MET; E13) activates the c-MET downstream pathway; E14) promotes the dispersion of tumor cells; E15) promotes the migration of tumor cells; E16) promotes the proliferation of tumor cells; E17) preparing a product for enriching and extracting c-MET; E18) preparing products that recognize or assist in the recognition of c-MET; E19) preparing a product that binds or assists in binding to c-MET; E20) preparing a product that activates or assists in activating c-MET; E21) preparing a product for detecting or assisting in detecting whether a sample to be tested contains c-MET; E22) preparing a product for detecting or assisting in detecting the content of c-MET in a sample to be tested; E23) preparing products for detecting or assisting in detecting tumors or tumor cells expressing c-MET; E24) preparing products that recognize or assist in recognizing tumors or tumor cells; E25) preparing products that bind or assist in binding to tumors or tumor cells; E26) preparing a product targeting c-MET; E27) preparing products for diagnosis or treatment of diseases related to c-MET; E28) preparing a product that promotes dimerization phosphorylation of c-MET; E29) preparing products that activate c-MET downstream pathways; E30) preparing a product that promotes the dispersion of tumor cells; E31) preparing a product that promotes the migration of tumor cells; E32) preparing products that promote the proliferation of tumor cells; E33) preparing probes for animal imaging targeting c-MET; E34) preparing therapeutic products for targeting c-MET; E35) preparing an agonist for a signaling pathway associated with c-MET; E36) preparing agonists for the biological functions of c-MET-related signaling pathways.

9. A product comprising an active ingredient and a carrier for fixing or coupling the active ingredient, wherein the active ingredient is the nucleic acid aptamer according to any one of claims 1 to 6 or the reagent according to claim 7.

10. The product according to claim 9, characterized in that: The product has any of the following functions: E1) Enrichment and extraction of c-MET; E2) Identify or assist in identifying c-MET; E3) binds to or assists in binding to c-MET; E4) activates or assists in the activation of c-MET; E5) detecting or assisting in detecting whether the sample to be tested contains c-MET; E6) detecting or assisting in detecting the c-MET content in the sample to be tested; E7) detecting or assisting in detecting tumors or tumor cells expressing c-MET; E8) Identify or assist in identifying tumors or tumor cells; E9) binding or assisting in binding to tumors or tumor cells; E10) targeting c-MET; E11) Diagnosis or treatment of c-MET related diseases; E12) promotes the dimerization phosphorylation of c-MET; E13) activates the c-MET downstream pathway; E14) promotes the dispersion of tumor cells; E15) promotes the migration of tumor cells; E16) promotes the proliferation of tumor cells.

Images