Expression vector of Noggin protein and application thereof

Abstract

The invention belongs to the field of biology, and particularly relates to an expression vector of Noggin protein and application of the expression vector. According to the invention, a plasmid containing a cell expression strong promoter is constructed, an efficient and stable expression 293 cell strain is obtained through screening, and meanwhile, a downstream purification process is optimized, so that the mass production of Noggin recombinant protein is realized. The 293 stable transfection expression cell line obtained by the technical scheme of the invention can be subjected to suspension culture, growth, expression and production of cell factors in a serum-free culture medium, and the influence of components in serum on the straightness of a product is eliminated. Meanwhile, the production volume can be enlarged to 2L, 10L and even 300L, and the limitation that a pore plate culture system is small is broken. In addition, the operations of plasmid extraction and transfection are omitted in production, so that the batch difference of factor expression can be reduced, and a basis is provided for mass expression.

Description

Technical Field

[0001] The invention belongs to the biological field, and specifically relates to an expression vector of Noggin protein and application thereof. Background Art

[0002] Noggin is a secreted homodimeric glycoprotein. Secreted Noggin is close to the cell surface due to binding to heparin-containing proteoglycans and is an antagonist of bone morphogenetic proteins (BMPs). It is very conserved in vertebrates, so mature human Noggin has a high homology with species such as mice, rats, cattle, horses and chickens. It is located on chromosome 17q22 in human genes and on chromosome 11 in rats and mice. Noggin was first discovered in 1992 in the study of African clawed frog embryonic development. The new polypeptide encoded by it can affect the development of the head of African clawed frogs and was named Noggin. Later, it was found that Noggin was highly expressed in the study of the dorsal and notochord of African clawed frogs, so it has a certain effect on the development of the back. Later, Noggin was also significantly expressed in the development of the mammalian nervous system. In-depth studies have found that Noggin can specifically bind to and inhibit BMPs, playing an important role in early embryonic development, limb formation and nervous system development. At the same time, it antagonizes BMPs and affects the normal development of the body's bones, cartilage and joints.

[0003] Due to the joint action of multiple signaling pathways, stem cells will differentiate in multiple directions to maintain the body's homeostasis and play a stem cell role. Common regulatory signaling pathways involved in Noggin include the Wnt signaling pathway, the BMP signaling pathway, and the Shh signaling pathway. The Noggin gene has a feedback inhibition mechanism on the BMP signaling pathway, and a feedback activation mechanism on the Wnt signaling pathway. The inhibitor Noggin in the BMP signaling pathway mediates the inhibition of BMP expression and causes Shh signal expression.

[0004] Noggin is a secretable protein that binds to ligands of the TGF-α family and regulates their activity by inhibiting their access to signaling receptors. As BMPs and their respective tissue targets are better understood, the function of Noggin is also being understood. Noggin was originally identified as a BMP-4 antagonist and plays an important role in the correct formation of the head and other dorsal structures. Therefore, Noggin has a high affinity for certain BMPs such as BMP-4, but a lower affinity for BMP-7, and a high correlation with BMP-2, BMP-13 and BMP-14. During skeletal development, Noggin prevents chondrocyte proliferation and thus regulates the normal formation of joints. When human embryonic stem cells (hESCs) or neural stem cells are cultured under certain conditions in the adult central nervous system and peripheral tissues (such as the lung), the addition of Noggin to antagonize BMP activity can allow stem cells to proliferate while maintaining their undifferentiated state, or differentiate into dopaminergic neurons. In Noggin-deficient mice, enhanced BMP activity causes a series of developmental abnormalities, including failure of neural tube formation, delayed hair follicle development, axial skeletal malformations and joint lesions.

[0005] The most classic cytokine culture scheme in organoid culture is WNER (respectively stands for: Wnt-3a, Noggin, EGF and R-Spondins). The combination of increase and decrease of these four factors can be applied to almost all organoid culture experiments. Noggin, as an important regulator of Wnt signaling pathway and BMP signaling, plays a role in many aspects. Noggin is one of the most basic organoid culture factors in the culture of small intestinal organoids, gastric organoids, liver organoids, lung organoids, pancreatic organoids, prostate organoids, breast organoids, brain organoids, etc. Its high activity, batch-to-batch stability and no contamination are the keys to the success of organoid experiments, so high-quality cytokines are essential for the culture of organoids. In order to assist scientific research and pharmaceutical personnel in the study of Noggin in organoid formation and the clinical application of target proteins in antibody drugs, Noggin high-activity protein products will help the study of Noggin mechanism or the exploration of its potential clinical value. Summary of the invention

[0006] The present invention aims to construct a plasmid containing a strong promoter for cell expression, obtain a highly efficient and stably expressing 293 cell line through screening, and optimize the downstream purification process, thereby achieving mass production of Noggin recombinant protein.

[0007] The first aspect of the present invention is a nucleic acid molecule Noggin. According to the Noggin reference sequence SEQ ID NO: 1 provided by NCBI, codon optimization is performed according to 293 hosts to obtain a nucleic acid molecule with a nucleotide sequence as shown in SEQ ID NO: 5.

[0008] The second aspect of the present invention discloses a method for constructing a recombinant plasmid Noggin-pCDNA3.1, wherein the nucleic acid molecule of the above nucleotide sequence as shown in SEQ ID NO: 5 is synthesized and inserted into the expression plasmid V02 to obtain the plasmid V02-Noggin-V3, and then the plasmid V02-Noggin-V3 and pCDNA3.1 are simultaneously subjected to HindIII / EcoRI double enzyme digestion, run on a gel, and the corresponding target fragments are recovered, and the recombinant plasmid Noggin-pCDNA3.1 is obtained after ligation.

[0009] The third aspect of the present invention discloses a cell strain expressing Noggin protein. The cell strain is constructed by linearizing the recombinant plasmid Noggin-pCDNA3.1 with PvuI and then transfecting 293 cells to obtain a cell strain expressing Noggin protein.

[0010] Preferably, the obtained positive cell population is inoculated in a multi-well plate, and when the cell confluence reaches 80-90%, multiple passages are performed, and the supernatant is taken for protein quantitative detection to screen for cell lines that highly express Noggin protein.

[0011] Preferably, the obtained cell line Expi293-Noggin47-P6 OPM-RD2104 has a registration number of CGMCC NO.46023 in the General Microbiological Center of China National Microbiological Culture Collection Administration.

[0012] The fourth aspect of the present invention discloses a method for culturing the above cell line, and the specific method is as follows: S1: The cells are revived and cultured in culture medium, and inoculated after three or more passages; S2: After the cells were diluted after passage, they were transfected with the recombinant plasmid Noggin-pCDNA3.1; S3: After transfection, centrifuge and change the medium every 3-5 days, and then transfer and culture. Fed-Batch and cryopreservation; S4: The cells frozen in S3 were revived, and after the viability was greater than 90%, monoclonal plating was performed, and the expression level of the cell supernatant was detected; S5: Screening high-expressing cell lines for suspension culture to obtain Noggin protein-expressing cell lines.

[0013] Preferably, the culture conditions in S1 and S2 are 120 rpm, 37°C, 8% CO2, and 80% humidity in a shaking incubator.

[0014] Preferably, the Noggin-pCDNA3.1 plasmid in S22 is filtered through a 0.22 μm membrane and then added to OPM-293 CD05, and mixed and incubated with PEI diluted with OPM-293 CD05.

[0015] Preferably, the sugar level in the culture process of S4 is controlled at 2-8 g / L, and the sample is collected by centrifugation when the cell viability is about 60%, and the expression level of the supernatant is detected using ForteBio.

[0016] The fifth aspect of the present invention discloses the use of the above nucleic acid molecule, recombinant plasmid Noggin-pCDNA3.1 or the above cell strain in producing a recombinant protein, wherein the recombinant protein is specifically Noggin protein.

[0017] The 293 stably expressed cell line obtained by the technical solution of the present invention can be grown in suspension culture in a serum-free medium to express and produce cytokines, and the volume can be enlarged to 2L, 10L, or even 300L, breaking the limitation of the small well plate culture system, reducing the batch-to-batch difference in factor expression, and providing a basis for large-scale expression.

[0018] The 293 stable expression cell line obtained by the technical solution of the present invention has the following advantages compared with its corresponding transient expression system: 1. It does not require a large amount of plasmid preparation, reducing the cost of manpower and consumables. 2. The expression amount is significantly improved compared with transient transfection. 3. The confirmation of the purification method and freeze-drying process can provide a basis for large-scale commercial production and finished product transportation.

[0019] Preservation certificate: The cell line Expi293-Noggin47-P6 OPM-RD2104 belongs to human embryonic kidney cells. It was received and registered by the General Microbiology Center (CGMCC) of China Microorganism Culture Collection Administration on July 29, 2024. The registration number of the collection center is CGMCC No.46023. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is a graph showing the expression level detection results of different codon sequences in Example 3.

[0021] Figure 2 This is a graph showing the viability of Expi293 cells pressurized with different concentrations of G418 in Example 5.

[0022] Figure 3 This is a graph showing the protein concentration of the cell supernatant during plasmid transfection.

[0023] Figure 4 and Figure 5 This is a graph showing the protein concentration of cell supernatant during monoclonal plating.

[0024] Figure 6This is the Noggin expression diagram of different cell lines in WB detection.

[0025] Figure 7 A detection diagram of Noggin expression in the cell lines screened by the present invention.

[0026] Figure 8 This is the chromatogram in Example 7.

[0027] Fig. 9 This is a graph showing the protein activity detection of the expression products of different expression systems in Example 8. DETAILED DESCRIPTION

[0028] The present invention is further described below by way of examples, but the present invention is not limited to the scope of the examples. The experimental methods in the following examples, unless otherwise specified, are conventional methods, and are performed according to the techniques or conditions described in the literature in the art or according to the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial sources.

[0029] Example 1 Designing Protein Noggin sequence, the protein is 205aa in length, and a signal peptide is added to the N-terminus to promote secretory expression. A 6-histidine his tag is added after the signal peptide to facilitate purification. An enterokinase cleavage site is inserted between the his tag and the protein to facilitate the removal of the tag when needed. The specific sequence is as follows: hhhhhhDDDDK qhy lhirpapsdn lplvdliehp dpifdpkekd lnetllrsll gghydpgfma tsppedrpgggggaaggaed laeldqllrq rpsgampsei kglefsegla qgkkqrlskk lrrklqmwlw sqtfcpvlyawndlgsrfwp ryvkvgscfs krscsvpegm vckpsksvhl tvlrwrcqrr ggqrcgwipi qypiiseckcsc (SEQ ID NO: 1); The codon optimization of Noggin amino acid sequence was performed as follows: Noggin-V0 cagcactatctccacatccgcccggcacccagcgacaacctgcccctggtggacctcatcgaacacccagaccctatctttgaccccaaggaaaaggatctgaacgagacgctgctgcgctcgctgctcgggggccactacgacccaggcttcatggccacctcgccccccgaggaccggcccggcgggggcgggggtgcagctgggggcgcggaggacctggcggagctggaccagctgctgcggcagcggccgtcgggggccatgccgagcgagatcaaagggctagagttctccgagggcttggcccagggcaagaagcagcgcctaagcaagaagctgcggaggaagttacagatgtggctgtggtcgcagacattctgccccgtgctgtacgcgtggaacgacctgggcagccgcttttggccgcgctacgtgaaggtgggcagctgcttcagtaagcgctcgtgctccgtgcccgagggcatggtgtgcaagccgtccaagtccgtgcacctcacggtgctgcggtggcgctgtcagcggcgcgggggccagcgctgcggctggattcccatccagtaccccatcatttccgagtgcaagtgctcgtgc (SEQ ID NO:2) Noggin-V1 cagcactatctccacatccgcccggcgcccagcgacaacctgcccctggtggacctcatcgaacacccagaccctatctttgaccccaaggagaaggatctgaacgagacgctgctgcgctcgctgctcgggggccactacgacccgggcttcatggccacctcgccccccgaggaccggcccggcgggggcgggggtgcggctgggggcgcggaggacctggcggagctggaccagctgctgcggcagcggccgtcgggggccatgccgagtgagatcaaagggctagagttctccgagggcttggcccagggcaagaagcagcgcctgagcaagaagctgcggaggaagttacagatgtggctgtggtcgcagacgttctgccccgtgctgtacgcgtggaacgacctgggcagccgcttttggccgcgctacgtgaaggtgggcagctgcttcagtaagcgctcgtgctccgtgcccgagggcatggtgtgcaagccgtccaagtccgtgcacctcacggtgctgcggtggcgctgtcagcggcgcgggggccagcgctgcggctggattcccatccagtaccccatcatttccgagtgcaagtgctcgtgc (SEQ ID NO:3) Noggin-V2 Cagcactatctccacatccgcccggcgcccagcgacaacctgcccctggtggacctcatcgaacacccagaccctatctttgaccccaaggagaaggatctgaacgagacgctgctgcgctcgctgctcgggggccactacgacccgggcttcatggccacctcgccccccgaggaccggcccggcgggggcgggggtgcggctgggggtgcggaggacctggcggagctggaccagctgctgcggcagcggccgtcgggggccatgccgagcgagatcaaagggctggagttctccgagggcttggcccagggcaagaagcagcgcctgagcaagaagctgcggaggaagttacagatgtggctgtggtcgcagaccttctgccccgtgctgtacgcgtggaacgacctgggctcacgcttttggccgcgctacgtgaaggtgggcagctgcttcagtaagcgctcgtgctccgtgcccgagggcatggtgtgcaagccgtccaagtccgtgcacctcacggtgctgcggtggcgctgtcagcggcgcgggggccagcgctgcggctggattcccatccagtaccccatcatttccgagtgcaagtgctcctgc (SEQ ID NO:4) Noggin-V3 CAGCACTACCTGCACATCAGACCCGCCCCTAGCGACAACCTGCCCCTGGTGGACCTGATCGAGCACCCCGACCCCATCTTCGACCCCAAGGAGAAGGACCTGAACGAGACCCTGCTGAGATCCCTGCTGGGCGGCCACTATGACCCCGGCTTT ATGGCCACCTCCCCTCCCGAGGACAGACCTGGCGGGGGCGGCGGGGCCGCTGGGGGCGCCGAGGACCTGGCCGAGCTGGATCAGCTGCTGAGACAGAGACCTAGCGGCGCCATGCCTAGCGAGATCAAGGGCCTGGAGTTCAGCGAGGGCCTGG CCCAAGGCAAGAAGCAGAGACTGAGCAAGAAGCTGAGAAGAAAGCTGCAGATGTGGCTGTGGAGCCAAACCTTCTGCCCCGTGCTGTACGCCTGGAACGACCTGGGCAGCAGATTCTGGCCTAGATACGTGAAGGTGGGCAGCTGCTTCAGCAA GAGAAGCTGCAGCGTGCCCGAGGGCATGGTGTGCAAGCCTAGCAAGAGCGTGCACCTGACCGTGCTGAGATGGAGATGTCAGAGAAGAGGCGGGCAGAGATGCGGCTGGATCCCCATTCAGTACCCCATCATCAGCGAGTGCAAGTGCAGCTGC (SEQ ID NO: 5) The above DNA sequences were synthesized by a synthesis company and inserted into expression plasmid V02 respectively to obtain plasmids V02-Noggin-V0, V02-Noggin-V1, V02-Noggin-V2, and V02-Noggin-V3. The expression levels were detected by transient transfection with 293 cells to determine the effect of codon optimization.

[0030] Example 2 Transient expression of foreign proteins in the 293 system To transiently express foreign proteins in the 293 system, the specific steps are as follows: The culture medium was OPM-293 CD05 Medium, stored in a 4°C refrigerator and preheated in a 37°C water bath before use.

[0031] Cell preparation: Resuscitate Expi293 cells into OPM-293 CD05, culture 30 mL in a 125 mL shake flask, 120 rpm, 37°C, 8% CO2, 80% humidity shaker, and inoculate after three or more passages. Dilute the resuscitated cells to a density of 0.4-0.7×106 cell / ml, and culture in a shaker at 120 rpm, 37°C, 8% CO2, 80% humidity.

[0032] Cell transfection expression: Cell transfection Day 0 The cell transfection density should be between 3-5×10 6 cell / ml, take a sample to measure VCD and VIA. If the cell density is too high, dilute it with CD05 to an appropriate density. When transfecting cells, filter 0.03 mg of plasmid through a 0.22 μm filter membrane and add it to 1.5 mL CD05 to prepare a plasmid dilution solution. Add 0.09 mg PEI to 1.5 mL CD05 to prepare a PEI dilution solution. Add the PEI dilution solution to the plasmid dilution solution and mix, and let it stand at room temperature for 20 min. Pour 3 mL of the DNA-PEI mixture into 30 mL of Expi293 cells, mix well, and culture in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity.

[0033] Protein expression Day1-Day7 18-24h after transfection, add 5% of the initial volume of OPM-293 ProFeed and culture in a shaker at 120rpm, 37°C, 8% CO2, and 80% humidity. 2-5 days after transfection, take samples regularly to record cell density and cell viability, measure the glucose concentration in the culture medium, and control the sugar content to 2-8g / L. On the 7th day after transfection, the cell supernatant was harvested by centrifugation, filtered, and packaged, stored at -80℃ for subsequent experiments.

[0034] Example 3 Expression level detection: Fortiebio The experiment used OctetRED96e (Sartorius) based on Bio-Layer Interferometry (BLI) technology for sample quantitative testing. The experiment used 0.05% PBST as the dilution buffer. Before the experiment began, the HIS2 sensor was placed in the buffer for pre-wetting for more than 10 minutes. V02-Noggin-V0, V02-Noggin-V1, V02-Noggin-V2, V02-Noggin-V3, and the expression supernatant were added to the sample plate. After the experiment began, the sensor was combined with the sample for 180 seconds, and the signal value at the binding end point was compared. The test results are shown in Figure 1 The higher the signal value, the higher the expression level, and this is used to roughly rank the expression levels of the four samples.

[0035] Detection results: expression levels V02-Noggin-V3>V02-Noggin-V0>V02-Noggin-V1>V02-Noggin-V2; and the V02-RSPO1-V3 codon sequence is about twice that of other sequences.

[0036] Example 4 Construction of Noggin protein expression vector used in stable cell line construction According to the results of the codon optimization scheme screening, the final optimized DNA sequence Noggin-V3 was connected to the vector pcDNA3.1. The specific sequence is shown in SEQ ID NO:5.

[0037] Example 5 Construction of a 293 cell line stably expressing Noggin protein.

[0038] Determine the optimal screening concentration of G418: Experimental steps: Select 0 / 100 / 200 / 400 / 800 ug / mL G418 (Gibco) concentrations to pressurize Expi293 cells. The culture medium is OPM-293 CD05 Medium. Centrifuge and change the medium every 3-5 days. Take samples and count them regularly. Find the G418 concentration that can kill all Expi293 cells in 7-10 days as the working concentration.

[0039] The experimental results are as follows Figure 2 As shown, 200 and 400ug / mL of G418 have good killing effect on Expi293 and can kill all Expi293 cells within 7-11 days. Therefore, 200 and 400ug / mL of G418 were selected as working concentrations.

[0040] 2. Preparation of recombinant pcDNA3.1: The recombinant plasmid Noggin-pCDNA3.1 was confirmed to be correct by sequencing and then transformed into Escherichia coli for plasmid extraction. Finally, the recombinant plasmid Noggin-pCDNA3.1 was linearized by PvuI (NEB) and used for 293 cell transfection.

[0041] 3. Transfection of 293 cells with recombinant pcDNA3.1 and screening: 3.1 Plasmid transfection The linearized Noggin-pCDNA3.1 was transfected into Expi293 cells using PEI (Biohub). The cell density should be between 3-5 × 10 6cell / ml, with a viability greater than 95%. Pour the DNA-PEI mixture into Expi 293 cells, mix well, and culture in a shaker at 120rpm, 37°C, 8% CO2, and 80% humidity. Add 400ug / mL or 200ug / mL G418 for screening the day after transfection. At the same time, take samples regularly to record cell density and cell viability 1-26 days after pressurization, centrifuge and change the medium every 3-5 days, and then transfer to a shaker at 120rpm, 37°C, 8% CO2, and 80% humidity for culture. After the viability and density are restored, expand the culture and perform Fed-Batch and cryopreservation respectively.

[0042] 3.2 Pool Fed-Batch Sample Preparation: The cells were inoculated at 1E6 / mL, with a total volume of 10mL. When the cell density was 4-6E6 / mL, 5% OPM-293ProFeed was added. The sugar was controlled at 2-8g / L during the entire culture process. When the cell viability was about 60%, the samples were collected by centrifugation, and the expression level of the supernatant was detected using ForteBio. The identification results are as follows Figure 3 As shown, the results showed that the expression level of Noggin was: 200ug / mL G418 pressurized (B1: Noggin-D7-200ug / mL G418) > transiently transfected sample (A1: Noggin-D7 transiently transfected sample) > 400ug / mL G418 pressurized (C1: Noggin-D7-400ug / mL G418).

[0043] 4. Monoclonal screening: According to the test results, the cells that were pressurized with 200ug / mL and 400ug / mL G418 after transfection were revived, and after passage until the viability was greater than 93%, monoclonal plates were plated at 0.5 cells / well using the limiting dilution method. After plating, microscopic observation was performed at D1 / 4 / 7 / 10, and the polyclonal wells were excluded, leaving only the monoclonal wells for marking. At D20, monoclonal cells were selected for expansion culture and transferred to 24-well plates and 6-well plates in turn. Finally, the cell supernatant in the 6-well plate was taken for ForteBio detection.

[0044] According to the ForteBio results, clones N2 / 14 / 28 / 31 / 39 / 44 / 47 / 3 / 12 / 23 / 26 with high expression levels were selected and transferred into shaking tubes for suspension acclimation, and then the expression levels were detected by ForteBio after Fed-Batch. Figure 4 and Figure 5 Shown The method for preparing Fed-Batch samples for monoclonal culture is as follows: cells are inoculated at 1E6 / mL, the total volume is 10mL, 5% OPM-293 ProFeed is added when the cell density is 4-6E6 / mL, the sugar is controlled at 2-8g / L during the entire culture process, the cell viability is about 60%, and the samples are collected by centrifugation on the 7th day.

[0045] According to the ForteBio results and the cell growth of Fed-Batch, clones N3 / 14 / 26 / 31 / 39 / 47 with high expression levels were screened for WB detection of relative expression and protein location.

[0046] 5. WB detection of Noggin expression Take 40μL of cell supernatant and add 10μL of 5×Sample Buffer to mix, heat at 95℃ for 10min, install the precast gel plate into the electrophoresis device, add MOPS Running Buffer, take 10μL of protein marker and appropriate amount of protein sample and load them in order. Perform SDS-PAGE at 130V for about 60-70min until the protein marker runs to the bottom of the separation gel, and prepare for transfer (the transfer solution needs to be pre-cooled in a 4℃ refrigerator in advance).

[0047] Transfer the membrane at a constant current of 400 mA for 70 minutes to transfer the protein to the PVDF (Millipore) membrane. After the transfer, immerse the PVDF membrane in the rapid blocking solution and incubate at room temperature for 15-25 minutes. Dilute the primary antibody (Rabbit monoclonal [H169-1-5] Anti-His IgG Fc, Abcam) and the rapid blocking solution at a concentration of 1:25000, cut the membrane according to the size of the target protein based on the position of the protein marker, put it in the diluted primary antibody, and incubate it at 37°C for 1.5 hours. Rinse with TBST 3 times, 10 minutes each time. Dilute the secondary antibody (goat anti-rabbit IgG H&L-HRP) and the rapid blocking solution at a concentration of 1:20000, put the PVDF membrane in the secondary antibody dilution solution, and incubate it at 37°C for 1.5 hours. Rinse with TBST 3 times, 10 minutes each time. Mix the Enhancer Buffer Solution and Peroxide Buffer of the ECL kit in a 1:1 ratio. The PVDF membrane was fully soaked in the mixed solution and exposed in a fully automatic luminescence imaging system.

[0048] Noggin molecule FedBatch supernatant WB test results are as follows Figure 6 As shown; combined with the results of Fortie and WB expression detection, the cell line with better Noggin expression is N47.

[0049] 6. Target gene detection Combined with the results of cell growth and expression, N47 was finally selected as the main clone, and the cell line was named Expi293-Noggin47-P6 OPM-RD2104 for target gene detection.

[0050] Experimental steps: The Tiangen DNA Extraction Kit (DP304-02) was used to extract the genome after passage, and primers were designed to amplify the inserted sequence. The PCR product was run on a gel and then cut and recovered for sequencing.

[0051] The PCR amplification primer sequences are as follows: pCDNA-F 5'- AATGGCGGTAGGCGTGTAC -3' (SEQ ID NO: 6) pCDNA-R 5'- AGGAAGGCACGGGGGAGGGG -3' (SEQ ID NO: 7) The sequencing primer sequences are as follows: pCDNA-F 5'- AATGGCGGTAGGCGTGTAC -3' (SEQ ID NO: 6) pCDNA-R 5'- AGGAAGGCACGGGGGAGGGG -3' (SEQ ID NO: 7) The PCR amplification primer sequence used in the present invention is consistent with the sequencing sequence.

[0052] Experimental results: The comparison results are as follows Figure 7 As shown; the results showed: consistent with the reference sequence.

[0053] Example 6 Comparison of transient expression and stable expression Transiently express the exogenous protein Noggin in the Expi293 system. The specific steps are as follows: The cell transfection density should be between 3-5×10 6 cell / ml, 0.03 mg plasmid, V02-Noggin-V3 was filtered through a 0.22 μm filter membrane and added to 1.5 mL CD05 to prepare a plasmid dilution. 0.09 mg PEI was added to 1.5 mL CD05 to prepare a PEI dilution. PEI dilution was added to the plasmid dilution and mixed, and allowed to stand at room temperature for 20 min. 3 mL of DNA-PEI mixture was poured into 30 mL of Expi293 cells, mixed, and cultured in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity. 24 h after transfection, 5% of the initial volume of 293 ProFeed was added, and cultured in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity. 2-5 days after transfection, samples were taken regularly to record cell density and cell viability, and the glucose concentration in the culture medium was measured to control the sugar content to 2-8 g / L. On the 7th day after transfection, the cell supernatant was harvested by centrifugation, filtered, aliquoted, and stored at -80°C for subsequent experiments.

[0054] The successfully constructed stable 293 cell line was used to express the exogenous protein Noggin. The specific operations are as follows: Resuscitate Expi293-Noggin47-P6 OPM-RD2104 cells in OPM-293 CD05, and culture 30 mL in a 125 mL shake flask at 120 rpm, 37°C, 8% CO2, and 80% humidity. When the cell density reaches 3-5×106cell / mL and the cell viability is greater than 90%, subculture every three days with OPM-293 CD05 medium at 0.5×106 cell / mL until the cell volume reaches 2 L. This day is defined as Day 0. Continue to culture until the cell density reaches 4-6×106 cell / mL, maintain the cell viability greater than 90%, add 293 ProFeed at 5% of the initial culture volume, and culture in a shaker at 120 rpm, 37°C, 8% CO2, and 80% humidity. During the culture process, samples were taken every day to record the cell density and cell viability, and the glucose and lactic acid concentrations in the cell suspension were measured to control the sugar content to 2-8 g / L. Sugar was supplemented on D1 and D4. On the 7th day of culture, the cell viability dropped to 60%, and the cell supernatant was harvested by centrifugation and stored at -80°C.

[0055] Example 7 Purification of transient and stable expression supernatants using nickel fillers Experimental reagents and consumables:

[0056] Ni-TED FF agarose purification resin was purchased from Jiaxing Qianchun Biotechnology Co., Ltd.; chromatography empty columns were purchased from Shanghai Huxi Analytical Instrument Factory Co., Ltd.; imidazole, sodium chloride and Tris were purchased from Shanghai Sangon Biotechnology Co., Ltd.; equilibration buffer: 20mM Tris 500mM NaCl pH8.0; elution buffer: 20mM Tris 500mM NaCl 500mM imidazole pH8.0.

[0057] The 6× His tag at the N-terminus of the Noggin target gene can bind to the Ni 2+ Specific binding.

[0058] Flash loading 1.6L 5cm 2 *13cmTED stable loading 1.6L 10cm 2 *10cmTED The experimental operation steps are as follows: pump 5 CV of affinity chromatography equilibration buffer into the chromatography column that has been washed with pure water to equilibrate the column. After the baseline is stable, load the sample at a flow rate of 5 mL / min, and then pump affinity chromatography equilibration buffer again to equilibrate for 5 CV. Set the linear elution of 0-500mM imidazole concentration for 15CV, and the elution flow rate is set to 8 mL / min. Prepare samples of the starting protein solution, flow-through and linear elution for SDS-PAGE analysis, as shown in Figure 2. Figure 8. After elution, rinse the column with deionized water until the conductivity is less than 1 s / m. Then pump 2 CV of 1 mol / L NaOH solution to clean the column, and finally rinse the column with pure water until the pH of the liquid in the column is neutral. Remove the column and store it vertically in a refrigerator at 4°C. The protein was quantified using BCA, and the instantaneous yield was calculated to be 3.45 mg / L cell supernatant. The stable yield was 20.33 mg / L cell supernatant.

[0059] Experimental conclusion: After harvesting the cell supernatant, the target protein Noggin was concentrated after a series of purification methods such as affinity capture and chromatography. The yield of the transient expression system was 3.45 mg per liter of cell supernatant, and the yield of the stable expression system was 20.33 mg per liter of cell supernatant. The yield of the stable expression system was much higher than that of the transient expression system.

[0060] Example 8 Activity test of transiently and stably expressed proteins Using mouse intestinal organoids as a model to verify the biological activity of noggin 1. Experimental Reagents 1. Organoid culture medium: Organoid culture medium ingredients: Advanced DMEM / F12, 10 mM HEPES, 100 μg / mL Primocin, 2 mM GlutaMax, 1 × N2, 1 × B27, 1 mM N-acetylcysteine, 50 ng / mL EGF, 100 ng / mL Noggin, 1 μg / mL R-spondin-1, 10 μM Y-27632.

[0061] When testing Noggin, different concentration gradients were set in the mouse small intestinal organoid culture medium: 100 ng / mL and 200 ng / mL, and a commercial similar product was used as a positive control (factor manufacturer: PeproTech, Noggin product number is 250-38).

[0062] 2. Experimental Methods 1. Isolate mouse small intestinal crypts. Calculate the volume of the selected fraction containing approximately 1500 crypts. Transfer the required volume to three correspondingly labeled 15 mL conical tubes and centrifuge at 300 g and 4 °C for 5 min. Carefully aspirate and discard the supernatant.

[0063] 2. Matrigel plating and culture test. Add an appropriate amount of matrigel according to the amount of 5-10 crypts / μl (the pipette tip used in this step needs to be pre-cooled); let the culture plate stand at 37℃ for 5 minutes to wait for the Matrigel to completely solidify, invert the plate, and place it in the incubator at 37℃ for 25 minutes, then add preheated intestinal organoid culture medium, and add sterile PBS to other wells that have not been inoculated with droplets to maintain humidity during culture. Take pictures on Day 3 and Day 6, such as Fig. 9 .

[0064] Conclusion: In the mouse small intestinal organoid model, the biological activity of noggin purified from two different expression systems was tested with imported noggin as a positive control. Based on the morphological observation, size and number analysis of the organoids on the third and sixth days, it can be inferred that noggin purified from two different expression systems can support the growth of mouse small intestinal organoids, and there is no significant difference compared with imported noggin.

[0065] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.

Claims

1. A nucleic acid molecule Noggin, characterized in that The codon-optimized nucleotide sequence is shown in SEQ ID NO:5, and the expressed amino acid sequence is shown in SEQ ID NO:

1.

2. A recombinant plasmid Noggin-pCDNA3.1, characterized in that: The nucleic acid molecule of claim 1 is synthesized and inserted into the expression plasmid V02 to obtain the synthetic plasmid V02-Noggin-V3, and then the synthetic plasmid V02-Noggin-V3 and pCDNA3.1 are double-digested with HindIII / EcoRI, run on a gel, and the target fragment is recovered, and then connected to construct the recombinant plasmid Noggin-pCDNA3.

1.

3. A cell line expressing Noggin protein, characterized in that: The cell line is constructed by linearizing the recombinant plasmid Noggin-pCDNA3.1 described in claim 2 with PvuI and then transfecting 293 cells to obtain a cell line expressing Noggin protein.

4. The cell line expressing Noggin protein according to claim 3, characterized in that: The obtained positive cell population was inoculated in a multi-well plate, and multiple passages were performed when the cell confluence reached 80-90%. The supernatant was taken for protein quantitative detection to screen out cell lines with high expression of Noggin protein.

5. The cell line expressing Noggin protein according to claim 4, characterized in that Its registration number at the General Microbiology Center of China Culture Collection Administration is CGMCC NO.46023.

6. The method for constructing a cell line expressing Noggin protein according to claim 4, characterized in that: S1: The cells are revived and cultured in culture medium, and then inoculated after three or more passages; S2: After the cells are passaged, they are diluted and the recombinant plasmid Noggin-pCDNA3.1 described in claim 2 is used to transfect the cells; S3: After transfection, the medium is changed by centrifugation every 3-5 days, and then after the transfer culture is completed, Fed-Batch and cryopreservation are performed; S4: The cells frozen in S3 were revived, and after the viability was greater than 90%, monoclonal plating was performed, and the expression level of the cell supernatant was detected; S5: Screening high-expressing cell lines for suspension culture to obtain Noggin protein-expressing cell lines.

7. The method for constructing a cell line expressing Noggin protein according to claim 6, characterized in that: The culture conditions in S1 and S2 were 120 rpm, 37°C, 8% CO2, and 80% humidity in a shaking incubator.

8. The method for constructing a cell line expressing Noggin protein according to claim 6, characterized in that: The recombinant plasmid Noggin-pCDNA3.1 in S2 was filtered through a 0.22 μm membrane and then introduced into OPM-293 CD05 and mixed and incubated with PEI diluted with OPM-293 CD05.

9. The method for constructing a cell line expressing Noggin protein according to claim 6, characterized in that: During the culture process of S4, the sugar content was controlled at 2-8 g / L. When the cell viability was about 60%, the samples were collected by centrifugation and the supernatant was used to detect the expression level using ForteBio.

10. Use of the nucleic acid molecule Noggin according to claim 1, the recombinant plasmid Noggin-pCDNA3.1 according to claim 2, or the cell line according to any one of claims 3 to 5 in producing recombinant proteins.

Images