Sick gene SbCSLG2, recombinant plasmid and preparation method and application thereof
By locating the sorghum anthracnose susceptibility gene SbCSLG2 through genome-wide association and transcriptome analysis, constructing a recombinant plasmid and performing genetic transformation, the problem of sorghum anthracnose control was solved, and efficient breeding and variety improvement were achieved.
Patent Information
- Application Number
- CN202411679245.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2025-11-18
- Estimated Expiration
- 2044-11-22
AI Technical Summary
The lack of cloning and functional analysis of the sorghum anthracnose susceptibility gene in existing technologies makes it difficult to control sorghum anthracnose and hinders breeding and improvement.
By combining genome-wide association analysis and transcriptome analysis, the sorghum anthracnose susceptibility gene SbCSLG2 was located and cloned. Recombinant plasmids were constructed and genetically transformed to achieve susceptibility identification and functional analysis of sorghum plants.
It provides molecular markers for rapid screening of sorghum anthracnose-resistant resources, lays the theoretical foundation for sorghum anthracnose-resistant breeding, and promotes academic research and variety improvement of sorghum anthracnose.
Smart Images

Figure CN119736309B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of biotechnology and relates to a disease-susceptibility gene SbCSLG2, a recombinant plasmid, its preparation method, and its application. Background Technology
[0002] Sorghum is the fifth most widely cultivated cereal crop globally, used as food, animal feed, and industrial raw material. Anthracnose is one of the most serious diseases affecting sorghum-growing regions worldwide. It can occur at any stage of sorghum's growth, causing yield reductions and even total crop failure. Studying the genetic mechanisms of anthracnose resistance in sorghum and conducting breeding improvements are the most effective ways to increase sorghum yield, reduce costs, improve efficiency, and prevent anthracnose.
[0003] Gene cloning technology provides a powerful tool for studying biological genetics and molecular biology mechanisms. Cloning genes for crop-related traits can be used to improve crop varieties, increase crop yield, and enhance stress resistance. Gene function analysis is an important method for studying gene function in organisms. It can reveal the specific functions of genes and provide crucial information for understanding fundamental life processes such as growth, development, and physiological metabolism. Bioinformatics tools can be used to analyze gene sequences, protein functions, and phylogenetic patterns, thereby uncovering new information and laws.
[0004] Disease-susceptibility genes can be directly used as molecular markers for screening and identification of sorghum resources. There are also numerous reports of gene mutations leading to resistance genes, such as Chen et al.'s discovery of a naturally occurring BSR-D1 rice blast susceptibility gene mutation in rice that transformed into the resistance gene SNP33-G. Eukaryotic translation initiation factor 4E (EIF4E) is a susceptibility factor for viral infection in many plant species. Hoffie et al. targeted mutagenesis of the EIF4E gene using the Cas9 endonuclease in BaMMV / BaYMV-susceptible winter barley varieties, leading to frame shift and loss of function, thus enhancing Bymovirus resistance in winter barley. Overexpression of the ribosomal silencing factor (RsfS) homolog TaRsfS in wheat reduces resistance to powdery mildew and stripe rust, while TaRsfS knockout (TaRsfS-KO) increases resistance to these two diseases without affecting key agronomic traits. The wheat GRAINWIDTH2 (TaGW2) homolog negatively regulates grain weight and mediates TaSGT1 ubiquitination to negatively regulate wheat leaf rust resistance. CRISPR / Cas9 editing of TaGW2 achieved a simultaneous increase in both grain weight and leaf rust resistance. This study demonstrates that the sorghum anthracnose susceptibility gene SbCSLG2 may be transformed into a resistance gene through gene editing and other technologies, offering potential applications for sorghum disease resistance breeding research. Further research will continue to explore its functions.
[0005] There are numerous reports on heterologous cloning of sorghum genes. For example, the nitrogen deficiency-specific inducible gene SbMYB-like in sorghum was cloned, an overexpression vector was constructed, and it was transformed into Arabidopsis thaliana to obtain overexpression lines, verifying that this gene plays an important role in promoting root elongation and flowering. The deep-root gene SbDRO1 in sorghum was cloned, and overexpression of SbDRO1 in Arabidopsis thaliana significantly improved the survival rate of Arabidopsis thaliana under drought conditions, and the root system of transgenic Arabidopsis thaliana was significantly more developed than that of wild type. The sorghum shattering gene Sh-B140 was cloned and transformed into the Sudan grass variety Hiro-1. Field phenotype observation of the T1 generation transgenic plants showed that although the shattering intensity of T1 plants was higher than that of Hiro-1, it was significantly lower than that of the parental B140. However, there are few reports on homologous cloning in sorghum, and no homologous clones and functional analyses of genes related to sorghum anthracnose have been found. This invention identifies the sorghum anthracnose susceptibility gene SbCSLG2 using a combination of genome-wide association analysis (GWAS) and transcriptome analysis. Homologous cloning and vector construction were then performed to obtain genetically transformed sorghum plants with SbCSLG2. Bioinformatics analysis of this gene was conducted to lay the foundation for research on the biological function of genes related to anthracnose resistance in sorghum.
[0006] Susceptibility genes in plants are key genes in the development of diseases. Upon direct contact with effector proteins of pathogenic bacteria, they are overexpressed, subsequently activating the entire susceptibility pathway and ultimately leading to disease. In reports of anthracnose infection in sorghum, previous studies had not identified any susceptibility genes. Obtaining sorghum anthracnose susceptibility genes would allow for a systematic analysis of the molecular response mechanisms of anthracnose occurrence, as well as the identification of anthracnose in sorghum. Furthermore, cloning and transforming these genes could elucidate the genetic mechanisms of anthracnose resistance in sorghum, laying the foundation for research on anthracnose resistance genes and genetic improvement of anthracnose resistance in sorghum. Summary of the Invention
[0007] The purpose of this invention is to provide a susceptibility gene SbCSLG2, a recombinant plasmid, its preparation method, and its application. This invention obtains a recombinant plasmid by transforming the susceptibility gene SbCSLG2 into a recombinant plasmid. This recombinant plasmid can be applied to sorghum plants to identify their resistance to anthracnose.
[0008] The technical solution of the present invention: a susceptibility gene SbCSLG2, wherein the nucleotide sequence of the susceptibility gene SbCSLG2 is SEQ ID NO. 01, the susceptibility gene SbCSLG2 is a gene encoding a protein composed of the amino acid sequence shown in SEQ ID NO: 2, and the susceptibility gene SbCSLG2 is a susceptibility gene for sorghum anthracnose.
[0009] A recombinant plasmid comprising the disease-susceptibility gene SbCSLG2 sequence as described in claim 1.
[0010] The aforementioned method for constructing recombinant plasmids is carried out according to the following steps:
[0011] (1) After PCR amplification of the disease-susceptibility gene SbCSLG2, the 2244bp electrophoretic fragment was cut out and recovered. The target fragment was recovered using the agarose gel DNA recovery kit DP209-03 from Tiangen Biotech Co., Ltd.
[0012] (2) Perform an enzyme digestion-ligation reaction on the target fragment to obtain the ligation product;
[0013] (3) The ligation product was mixed with competent Escherichia coli cells, cultured in LLB liquid medium to restore the cells to normal growth state, and then the recombinant plasmid was transformed into plasmid colonies on LB solid medium plates.
[0014] (4) Use primers JJ-F and NOS-R to amplify the plasmid colonies obtained in step (3) by PCR and perform PCR detection; pick out the positive colonies, separate and purify them, and then extract the plasmid.
[0015] In step (1) above, the PCR amplification reaction system consists of 25 μL of 2xPCR buffer, 10 μL of 2mMdNTPs, 1 μL of primer F, 1 μL of primer R, 1 μL of KOD-FX, and 1 μL of BTx623 sorghum DNA template, plus ddH2O to prepare a 50 μL PCR amplification reaction system; the PCR amplification reaction conditions are: first, 98℃ for 3 min pre-denaturation, then 98℃ for 10 sec to 68℃ for 3 min, for 32 cycles, and finally 68℃ for 6 min; the nucleotide sequence of primer F is SEQ ID NO. 03, and the nucleotide sequence of primer R is SEQ ID NO. 04.
[0016] In step (2) above, the enzyme digestion-ligation reaction system is as follows: 1.5 μL of 10×CutSmartBuffer, 1.5 μL of 10 mM ATP, 100 ng of empty vector plasmid, 100 ng of target fragment, 10 U of BsaI-HF and 35 U of 4 DNA ligase, and H2O is added to prepare 15 μL; the enzyme digestion-ligation reaction parameters are 37℃ for 5 min first, and then 20℃ for 5 min.
[0017] In step (4) above, the colony PCR amplification system is as follows: 10 μL of 2XTaqMIX, 0.5 μL of JJ-F primer and 0.5 μL of NOS-R primer are taken, colonies are picked and added, and ddH2O is added to 20 μL. The colony PCR amplification reaction parameters are: 95℃ for 5 min pre-denaturation, 95℃ for 530 sec denaturation, 55℃ for 30 sec annealing, 72℃ for 1 min extension, and 72℃ for 2 min final extension. The nucleotide sequence of primer JJ-F is SEQ ID NO. 05, and the nucleotide sequence of primer NOS-R is SEQ ID NO. 06.
[0018] The application of the aforementioned susceptibility gene SbCSLG2 and the aforementioned recombinant plasmid in homologous genetic transformation of sorghum.
[0019] In the aforementioned application, the sorghum positive plants genetically transformed with the susceptibility gene SbCSLG2 showed significant overexpression of the gene after treatment with sorghum anthracnose spore solution, and the lesions on the sorghum positive plants were significantly more numerous than those on wild control sorghum plants; indicating that the susceptibility gene SbCSLG2 is a susceptibility gene for sorghum anthracnose.
[0020] In the aforementioned application, after treating anthracnose-resistant and anthracnose-susceptible sorghum with anthracnose spore solution, the susceptibility gene SbCSLG2 was significantly overexpressed in the susceptible sorghum, which can be used for rapid identification of anthracnose-susceptible sorghum resources.
[0021] In the aforementioned applications, the nucleotide sequences of the specific primers for detecting the overexpression of the disease-sensitive gene SbCSLG2 are SEQ ID NO. 07 and SEQ ID NO. 08.
[0022] Compared with the prior art, the present invention has the following beneficial effects:
[0023] 1. This invention discloses a sorghum anthracnose susceptibility gene SbCSLG2, a recombinant plasmid, and their applications. SbCSLG2 is a susceptibility gene for sorghum anthracnose. Primers designed based on this susceptibility gene can be directly used as molecular markers to quickly screen and identify sorghum resources resistant to anthracnose at the seedling stage, providing a convenient method for rapid screening of materials and improvement of sorghum anthracnose resistant varieties in sorghum anthracnose resistant breeding research.
[0024] 2. There are currently no reports of sorghum anthracnose susceptibility genes. Sorghum susceptibility genes can be transformed into resistance genes through gene locus mutation. The SbCSLG2 sorghum susceptibility gene in this invention may be transformed into a resistance gene through gene editing and other technologies. It has certain potential applications for sorghum disease resistance breeding research and can help provide theoretical methods and new strategies for the creation of sorghum germplasm resistant to anthracnose. The next step will be to continue to explore its functions.
[0025] 3. The susceptibility gene SbCSLG2 for sorghum anthracnose was discovered for the first time. It was constructed into a recombinant plasmid and genetically transformed into sorghum plants. Further functional analysis of the susceptibility gene SbCSLG2 can be performed, which has profound significance for academic research on sorghum anthracnose and the improvement of anthracnose-resistant sorghum varieties. Attached Figure Description
[0026] Figure 1 SbCSLG2 gene structure diagram (white box - UTR, red box - exons, lines - introns);
[0027] Figure 2 : Plasmid vector map of the SbCSLG2 gene;
[0028] Figure 3 : T0 generation overexpression transformation seedlings of SSbCSLG2 and positive identification (A: T0 seedlings of SbCSLG2, B: Electrophoresis diagram of positive overexpression strains of SbCSLG2);
[0029] Figure 4 : Expression level of SbCSLG2 gene in positive sorghum;
[0030] Figure 5 Images of wild-type (CK) and SbCSLG2 transformed sorghum leaves on day 5 after anthracnose treatment (A: image of CK, B: image of SbCSLG2);
[0031] Figure 6 Specific expression of the SbCSLG2 gene in disease-resistant and disease-susceptible sorghum. Detailed Implementation
[0032] The present invention will be further described below with reference to the accompanying drawings and embodiments, but this should not be construed as limiting the present invention.
[0033] Example 1: Gene Mapping
[0034] First, based on 242 sorghum whole-genome resequencing data (China National Gene Bank (CNGB) CNP0002968) and the sorghum population SNP detection method, 2,015,850 high-quality SNPs were obtained for subsequent genome-wide association analysis (GWAS) and haplotype analysis. Following the GWAS method of Zhang et al., GWAS was performed using the BLINK, FarmCPU, GLM, MLM, and MLMM statistical methods implemented in the Genome Association and Prediction Integration Toolkit (GAPIT version 3.0). GWAS was performed on the three replicated sorghum anthracnose lesion onset time disease index and lesion size disease index traits. The first three PCs derived from the whole-genome SNPs were used as fixed effects in the mixture model to correct for stratification. Random effects were estimated based on the groups clustered according to phylogenetic relationships among all germplasms. A genome-wide significance cutoff was defined using an adjusted Bonferroni test threshold, set as P = -log 10 (1 / 2015850) =6.3, sites above the threshold are considered reliable, and the average decay distance for linkage disequilibrium (LD) is 62.5 kb (r). 2 =0.2,), according to the sorghum BTx623 reference genome, candidate genes related to anthracnose resistance in sorghum were searched within 62.5 kb above and below all significant SNPs. Secondly, 1.5 x 10^6 DNA samples of *Colletotrichum sublineolum*, the sorghum anthracnose pathogen isolated and identified by the Department of Plant Pathology, Guizhou University, were used. 5Seedlings of anthracnose-resistant and anthracnose-susceptible sorghum were treated with a spore solution of spores per ml. Transcriptome analysis was then performed on aboveground seedlings at 0h, 12h, 24h, 36h, and 48h to identify differentially expressed genes related to anthracnose resistance. GWAS and transcriptome analysis were then used to identify co-located genes and analyze the FPKM of co-mined DEGs. Genes with FPKM values >3 and >17, and whose FPKM and qPCR expression trends were similar and significantly different in resistant and susceptible sorghum, were selected. The candidate gene Sobic.003G442500 was identified as a novel sorghum anthracnose susceptibility gene. BlastP was used to search the NCBI database (https: / / ngdc.cncb.ac.cn / sorgsd / browse) to download SBP15 sequences from other species. Using MEGA 7.0 software, sequences were aligned using the muscle method, and a rootless phylogenetic tree was constructed using neighbor-joining (NJ) (bootstrap = 1000). Homology comparison and neighbor-joining analysis revealed that the Sobic.003G442500 protein showed the highest homology with ZmCSLG2 (cellulose synthase-like protein G2; maize) (Per.Ident = 78.80%, E-value = 0). Therefore, the Sobic.003G442500 gene can be considered as the SbCSLG2 gene. The nucleotide sequence of the SbCSLG2 gene is SEQ ID NO. 01, and the amino acid sequence of the SbCSLG2 protein gene is SEQ ID NO. 02.
[0035] The SbCSLG2 gene was retrieved and screened using the SorGSD genome browser (https: / / ngdc.cncb.ac.cn / sorgsd / browse) and its gene characteristics were analyzed. The analysis revealed a complete gene structure and multiple introns. The SbCSLG2 gene is located on the positive strand of chromosome 3, with a gene region of 74,093,353–74,097,352 bp, encoding a 748aa protein containing 5 exons and 4 introns. The SbCSLG2 gene contains 647 SNPs and 261 deletion / insertion (Indel) mutations. Two high-consequence SNP variants were found, both of which were stop-gain SNP variants. The coding region contained 17 medium-consequence SNP variants (missense variants) and 15 low-consequence SNP variants (synonymous variants). Among the modification types, upstream and downstream genes had the most mutations, followed by intron mutations. The least common mutations were a few in the UTR region, but no coding region mutations were found. For Indel mutations, there are 6 high-consequence Indel variants, including stop loss and frameshift mutations; 11 medium-consequence Indel variants (integer mutations) and 3 low-consequence Indel variants (splice region mutations) exist in the coding region; among the modification types, upstream and downstream genes have the most mutations, followed by intron mutations, and the least common mutations are a few in the UTR region, but no coding region mutations are found (Table 1). Figure 1 ).
[0036] Table 1. Statistics on variations in SbCSLG2 encoding.
[0037]
[0038] Example 2: Construction of a vector for the disease susceptibility gene
[0039] 1. Vector primer design, as shown in Table 2.
[0040] Table 2 Primer sequences for constructing the vector
[0041]
[0042] 2. Amplification and recovery of the target fragment
[0043] During fragment recovery, the Sobic.007G120000 and SbCSLG2 genes excised 2874bp and 2244bp electrophoretic fragments, respectively, and the target fragments were recovered using the agarose gel DNA recovery kit (DP209-03) from Tiangen Biotech Co., Ltd.; the operation was performed according to the kit instructions.
[0044] The PCR reaction system was as follows: 25 μL of 2xPCR buffer, 10 μL of 2mMdNTPs, 1 μL of F, 1 μL of R, 1 μL of KOD-FX, 1 μL of BTx623 sorghum DNA template, and ddH2O was added to 50 μL to obtain the PCR reaction.
[0045] PCR reaction conditions:
[0046]
[0047] 3. Enzyme digestion-ligation reaction
[0048] Follow the enzyme digestion reaction system in Table 3, and then set the reaction parameters according to Table 4 for the enzyme digestion-ligation reaction.
[0049] Table 3 Enzyme digestion reaction system
[0050]
[0051] Table 4 Enzyme digestion-ligation reaction parameters
[0052]
[0053] 4. Transformation of recombinant plasmids
[0054] (1) Take a tube of 100 μL LDH5a competent E. coli cells and mix with 2-5 μL of ligation product, and incubate on ice for 30 min;
[0055] (2) Quickly place it in a 42℃ constant temperature water bath, heat shock for 90s, then ice bath for 2min;
[0056] (3) Add 500 μL LLB liquid culture medium and mix well;
[0057] (4) Incubate at 37℃ and 200rpm for 45min to allow the cells to return to normal growth.
[0058] (5) Spread the bacterial culture evenly on Kana-resistant LB solid medium plates;
[0059] (6) After 30 minutes, place in a 37°C constant temperature incubator and incubate overnight.
[0060] 5. Bacterial test
[0061] Colony PCR was performed using the JJ-F / NOS-R primer pair according to the following colony PCR amplification system and the parameters in Table 4; positive colonies were picked and shaken.
[0062] Colony PCR amplification system: 10 μL 2XTaqMIX, 0.5 μL JJ-F primers, 0.5 μL NOS-R primers, pick a small number of colonies, add ddH2O to 20 μL to obtain the final product.
[0063] Table 5 Colony PCR reaction parameters
[0064]
[0065] 6. Plasmid Extraction
[0066] (1) Pick single clones from LB solid medium plates and inoculate them into LB liquid medium with a final concentration of 50 μg / mL for kanamycin resistance, and incubate overnight at 37°C;
[0067] (2) Take 4 mL of activated bacterial solution, centrifuge at 10,000 rpm for 2 min at room temperature, and completely discard the supernatant;
[0068] (3) Take 250 μL of Solution I reagent containing ribonuclease A and thoroughly resuspend the bacterial block;
[0069] (4) Take 250 μL of Solution II reagent to lyse the bacterial block, and gently invert it several times until the bacterial cells are transparent;
[0070] (5) Take 350 μL of Solution III reagent, invert it several times until a white, firm flocculent substance is formed;
[0071] (6) Centrifuge at 12,000 rpm for 10 min at room temperature and collect the supernatant;
[0072] (7) Remove the nucleic acid purification column from the kit and place it on the collection tube;
[0073] (8) Take the clear supernatant from step 6 above into a nucleic acid purification column, centrifuge at 12,000 rpm for 1 min at room temperature, and discard the filtrate;
[0074] (9) Add 500 μL of BufferW1 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;
[0075] (10) Add 700 μL of BufferW2 to the nucleic acid purification column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;
[0076] (11) Repeat step 10 above;
[0077] (12) Place the nucleic acid purification column on the collection tube and centrifuge at 12,000 rpm for 2 min at room temperature to remove as much residual liquid as possible;
[0078] (13) Discard the collection tube, take the nucleic acid purification column and place it in a 1.5 mL EP tube, and add 50 μL of elution buffer to elute the DNA attached to the nucleic acid purification column membrane (the elution buffer can be preheated in a 65℃ constant temperature water bath to help elute the DNA), and let it stand at room temperature for 2 min.
[0079] (14) Centrifuge at 12,000 rpm for 2 min at room temperature to wash off the DNA attached to the nucleic acid purification column membrane, and store at -40℃ for later use.
[0080] (15) Take a small amount of the recovered product and use 1% agarose gel electrophoresis to detect the plasmid extraction quality.
[0081] 7) Sequencing
[0082] The plasmid extracted from the above positive bacterial plaques was subjected to Sanger sequencing using the eGFP-cx sequencing primer. If the sequencing result matched the target fragment sequence, the overexpression vector was successfully constructed. The vector map is shown below. Figure 2 .
[0083] Example 3: Genetic transformation of sorghum
[0084] Agrobacterium containing a plasmid vector was transferred into tissue-cultured sorghum. Stable genetic transformation of sorghum was accomplished with the assistance of the Institute of Crop Science, Chinese Academy of Agricultural Sciences. This process included sorghum callus induction, Agrobacterium infection of callus tissue, selection of resistant callus, and culture of regenerated plants.
[0085] 1. Cultivation and gene overexpression detection of genetically transformed sorghum
[0086] T0 generation sorghum plants overexpressed and transformed were planted at the teaching and experimental farm of Guizhou University and managed using standard methods. When the T0 generation sorghum reached the jointing stage, leaves from eight plants were taken for identification as positive plants. Bright bands were observed in all eight plants, and the size of the amplified product was consistent with expectations. Figure 3 Leaves from wild-type (CK) and SbCSLG2 positive plants (L1275-1, L1275-3, L1275-3) were taken from sorghum plants at the heading stage for expression testing.
[0087] The testing method was RT-qPCR, using Ambion by Life Technologies. Total RNA was extracted using Reagent (Lot. No. 338111) and reverse transcribed into cDNA using Beyotime's BeyoRT™ III CDNA Reverse Transcription Kit (Beyotime, with gDNA EZeraser, Lot. No. D7185M). SbUBQ10 was used as an internal control gene, and homologous cloning gene primers were used for qRT-PCR amplification using Biosharp's Universal SYBR Qpcr MasterMix Kit (Lot. No. BL697A); all reagent usage methods were performed according to the manufacturer's instructions. Gene expression levels were quantified using a BIO-RAD CFX96 Real-Time cycler (c100 Touch Thermal cycler). The 2-step method described by Schmittgen was followed. -ΔΔCT The method is used to determine the relative fold change in the expression of a target gene.
[0088] Table 6 Primers for disease resistance-related genes in homologous clones.
[0089] Serial Number name sequence SEQID NO. 07 Forward primer (5'-3') GCTCTCAGTCTCAGTCGTCTCC SEQID NO. 08 Reverse primer (5'-3') AGGAACAGCAGCGTCAGGTC
[0090] Leaves of successfully transformed positive sorghum plants were selected for anthracnose resistance phenotype identification.
[0091] Example 4: Overexpression of SbCSLG2 in positive strains
[0092] The results of overexpression assays for the SbCSLG2 gene in three overexpression lines are as follows: Figure 4 As shown, compared with the wild-type CK, the L1275-1, L1275-3, and L1275-3 of SbCSLG2 were 869.72, 399.33, and 601.61 times higher than those of CK, respectively. This indicates that the constructed overexpression vectors acted on SbCSLG2 in sorghum, ultimately leading to the effect by altering their expression levels. These materials can be further studied to investigate the impact of mutational effects on the agronomic traits and disease resistance of the materials.
[0093] Example 5: Lesion changes in sorghum overexpressed with the gene
[0094] Lesions were counted every 12 hours. At 72 hours, lesions began to appear on the veins of both positive and control SbCSLG2 plants, but the number of lesions on the veins of positive plants was greater than that on the veins of control plants. At 96 hours, lesions began to appear on the leaves of both positive and control SbCSLG2 plants, but the number of lesions on the leaves of positive plants was greater than that on the leaves of control plants. At 120 hours, the number of lesions on the leaves of positive SbCSLG2 plants was significantly greater than that on the leaves of control plants. Figure 5 This indicates that overexpression of SbCSLG2 in sorghum leads to an increase in sorghum lesions.
[0095] Example 6: SbCSLG2 Identification of Anthracnose Resistance in Sorghum
[0096] Based on the nucleotide sequence of the susceptibility gene SbCSLG2 (SEQ ID NO. 01), a specific primer sequence (SEQ ID NO. 07) was designed for this gene. Then, 1.5 x 10⁻⁶ *Sorghum anthracnose* was used. 5 Seedlings of anthracnose-resistant sorghum (DR) and anthracnose-susceptible sorghum (S) were sprayed with a spore solution of spores / ml. Aboveground parts of the plants were collected at 0h before spore inoculation and at 12, 24, 36, and 48h after inoculation. RNA was extracted, and the specific expression of the SbCSLG2 gene in resistant and susceptible sorghum was analyzed by real-time quantitative qPCR using SEQ ID NO. 07 as primers. Figure 6 As shown, the relative expression level of the SbCSLG2 gene in susceptible sorghum was significantly higher than that in resistant sorghum from 12 to 48 hours. Based on the significant difference in the relative expression level of the SbCSLG2 gene in anthracnose-resistant and anthracnose-susceptible sorghum, it is possible to identify whether sorghum is resistant or susceptible to anthracnose, and to quickly identify anthracnose-resistant sorghum resources.
Claims
1. A disease-susceptibility gene SbCSLG2 Its application in the rapid identification of anthracnose-susceptible sorghum resources is characterized by: After treating anthracnose-resistant and anthracnose-susceptible sorghum with anthracnose spore solution, within 12-48 hours... SbCSLG2 Sorghum with significant overexpression of the susceptibility gene is susceptible to anthracnose. SbCSLG2 The nucleotide sequence is SEQ ID NO.1.