Method for improving content of tanshinone in salvia miltiorrhiza plant based on editing uORF sequence of salvia miltiorrhiza

Abstract

The invention provides a method for improving tanshinone content in a salvia miltiorrhiza plant based on editing a salvia miltiorrhiza uORF sequence. The CPS1 gene is a key gene in a tanshinone biosynthetic pathway, the expression level and activity of the CPS1 gene directly influence synthesis and accumulation of tanshinone, and a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1 or 2 can regulate gene expression by inhibiting translation of CDS, so that the CPS1 gene can be used for preparing the tanshinone gene. Translation inhibition of the DNA fragment on the salvia miltiorrhiza CPS1 gene CDS is relieved through a gene editing means, and the content of tanshinone in salvia miltiorrhiza can be increased.

Description

Technical Field

[0001] The invention relates to a method for increasing the tanshinone content in salvia miltiorrhiza plants based on editing salvia miltiorrhiza uORF sequences, and relates to the technical field of genetic engineering. Background Art

[0002] Salvia miltiorrhiza Bunge has been effectively used for the treatment of cardiovascular and cerebrovascular diseases. In addition to its significant medicinal value, Salvia miltiorrhiza has the characteristics of a short life cycle, a relatively small genome size, and genetic transferability. Due to these characteristics, Salvia miltiorrhiza has been widely regarded as an important model medicinal plant. Tanshinones are fat-soluble phenanthroquinone compounds extracted from Salvia miltiorrhiza, which are produced through the multiple catalytic actions of isopentenyl pyrophosphate (IPP) and dimethylpropenol pyrophosphate (DMAPP), the common precursors of terpenoids. The biosynthesis of tanshinones involves three major stages: the mevalonate (MVA) pathway and the 2-C-methyl-D-erythritol 4-phosphate (MEP) pathway, which form precursors; these precursors are then further catalyzed by diterpene synthases to form carbon skeleton structures; finally, through the catalytic action of CYP450 post-modification enzymes, complex and diverse tanshinones are generated.

[0003] The preparation of tanshinone compounds mainly includes two methods: extraction from natural sources and artificial synthesis. Among them, increasing the tanshinone content in salvia miltiorrhiza is the basis for improving the extraction efficiency of tanshinone from natural sources. How to use genetic engineering to explore the key genes in the tanshinone biosynthesis pathway and their regulatory mechanisms on the tanshinone content, and then increase the tanshinone content in salvia miltiorrhiza, is one of the technical problems that technicians in this field need to solve urgently. Summary of the invention

[0004] The invention provides an application of a DNA fragment in regulating the tanshinone content in salvia miltiorrhiza plants.

[0005] The present invention also provides sgRNA and CRISPR / Cas9 systems for targeted knockout of the above DNA fragments, and applications thereof in increasing the tanshinone content in salvia miltiorrhiza plants.

[0006] The first aspect of the present invention provides the use of a DNA fragment in regulating the tanshinone content in a Salvia miltiorrhiza plant, wherein the DNA fragment is one of A1 or A2:

[0007] A1, a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1;

[0008] A2. A DNA fragment having a nucleotide sequence as shown in SEQ ID NO: 2.

[0009] The nucleotide sequence provided by the present invention is such as the DNA fragment shown in SEQ ID NO:1-2 including the upstream open reading frame (upstream open reading frame, uORF) of the CPS1 gene, i.e., the 70th-171st nucleotides in SEQ ID NO:1 (i.e., SEQ ID NO:2) or the 77th-154th nucleotides in SEQ ID NO:1 (i.e., the 8th-85th nucleotides in SEQ ID NO:2), and both of these DNA fragments start with ATG and end with TAA, and can be determined to be uORF sequences. The CPS1 gene is a key gene in the biosynthetic pathway of tanshinone, and its expression level and activity directly affect the synthesis and accumulation of tanshinone. The DNA fragment with a nucleotide sequence such as that shown in SEQ ID NO:2 can regulate gene expression by inhibiting the translation of CDS, and therefore, removing the translation inhibition of the DNA fragment for the CDS of the CPS1 gene of Danshen by gene editing means can increase the content of tanshinone in Danshen.

[0010] Tanshinone in the present invention specifically refers to tanshinone compounds, including at least one of cryptotanshinone (CPT), tanshinone I (TanI), tanshinone IIA (Tan IIA), and dihydrotanshinone I (DHT).

[0011] The second aspect of the present invention provides the use of a substance for targeted knockout of the above-mentioned DNA fragment in increasing the content of tanshinone in salvia miltiorrhiza plants.

[0012] Furthermore, the substance for targeted knockout of the above-mentioned DNA fragment may be a CRISPR / Cas9 system.

[0013] In a third aspect, the present invention provides sgRNA for targeted knockout of the above-mentioned DNA fragment, wherein the target sequence of the sgRNA1 is positions 15-34 of the nucleotide sequence shown in SEQ ID NO:1, and the target sequence of the sgRNA2 is positions 175-194 of the nucleotide sequence shown in SEQ ID NO:1.

[0014] A fourth aspect of the present invention provides a CRISPR / Cas9 system comprising the above-mentioned sgRNA.

[0015] Furthermore, the CRISPR / Cas9 system also includes a Cas9 protein, and the amino acid sequence of the Cas9 protein is shown in SEQ ID NO:3.

[0016] A fifth aspect of the present invention provides a DNA molecule encoding the above-mentioned sgRNA or CRISPR / Cas9 system.

[0017] The sixth aspect of the present invention provides a recombinant expression vector comprising the above-mentioned DNA molecule.

[0018] The seventh aspect of the present invention provides a recombinant transformant comprising the above-mentioned recombinant expression vector.

[0019] Furthermore, the recombinant transformant is a recombinant microorganism comprising the above-mentioned recombinant expression vector, such as Agrobacterium.

[0020] An eighth aspect of the present invention provides the use of the above-mentioned sgRNA or CRISPR / Cas9 system in increasing the tanshinone content in Salvia miltiorrhiza plants.

[0021] A ninth aspect of the present invention provides a method for increasing the content of tanshinone in a salvia miltiorrhiza plant, comprising:

[0022] Constructing a CRISPR / Cas9 system, the CRISPR / Cas9 system comprising sgRNAs targeting the above-mentioned DNA fragment, the sgRNAs comprising sgRNA1 and sgRNA2, wherein the target sequence of the sgRNA1 is positions 15-34 of the nucleotide sequence shown in SEQ ID NO:1, and the target sequence of the sgRNA2 is positions 175-194 of the nucleotide sequence shown in SEQ ID NO:1;

[0023] The CRISPR / Cas9 system is used to knock out the DNA fragment in the genome of the recipient Salvia miltiorrhiza plant, and positive plants with a higher tanshinone content than the recipient Salvia miltiorrhiza plant are screened to increase the tanshinone content in the Salvia miltiorrhiza plant.

[0024] The tenth aspect of the present invention provides a method for cultivating a Salvia miltiorrhiza plant with a high tanshinone content, comprising:

[0025] Constructing a CRISPR / Cas9 system, the CRISPR / Cas9 system comprising sgRNAs targeting the above-mentioned DNA fragment, the sgRNAs comprising sgRNA1 and sgRNA2, wherein the target sequence of the sgRNA1 is positions 15-34 of the nucleotide sequence shown in SEQ ID NO:1, and the target sequence of the sgRNA2 is positions 175-194 of the nucleotide sequence shown in SEQ ID NO:1;

[0026] The CRISPR / Cas9 system is used to knock out the DNA fragment in the genome of the recipient Salvia miltiorrhiza plant, and a positive Salvia miltiorrhiza plant having a higher tanshinone content than the recipient Salvia miltiorrhiza plant is screened.

[0027] Furthermore, the steps for obtaining the above-mentioned positive Salvia miltiorrhiza plants include: step 1, cultivating sterile Salvia miltiorrhiza seedlings; step 2, designing sgRNA molecules complementary to the target gene to guide the Cas9 protein to reach a specific gene site; step 3, constructing a recombinant expression vector expressing the CRISPR / Cas9 system; step 4, using the Agrobacterium-mediated genetic transformation method to introduce the constructed recombinant expression vector into Agrobacterium, and using the Agrobacterium successfully introduced with the recombinant expression vector to infect leaves from sterile Salvia miltiorrhiza seedlings, and using plant tissue culture technology to produce transgenic plants; step 5, extracting genomic DNA from the T0 generation plants at the seedling stage, performing positive detection by PCR method or genome sequencing, and screening out plants that have been successfully transformed and the above-mentioned DNA fragments have been successfully knocked out; step 6, post-cultivating the knockout plants.

[0028] The present invention utilizes gene editing technology to knock out the uORF of the Salvia miltiorrhiza CPS1 gene to obtain a Salvia miltiorrhiza plant with a high tanshinone content, thereby achieving the breeding application of Salvia miltiorrhiza plants with a high content of tanshinone compounds and the preparation and extraction of tanshinone compounds. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] Figure 1 It is the positive identification of the uORF-edited seedlings of CPS1 gene of Salvia miltiorrhiza;

[0030] Figure 2 This is the sequencing result of the positive seedlings of CPS1 gene uORF editing in Salvia miltiorrhiza;

[0031] Figure 3 The results are as follows: the determination of tanshinone content in the uORF editing-positive seedlings of CPS1 gene of Salvia miltiorrhiza; wherein, A is the determination result of cryptotanshinone (CPT); B is the determination result of dihydrotanshinone I (DHT); C is the determination result of tanshinone IIA (Tan IIA); and D is the determination result of tanshinone I (Tan I). DETAILED DESCRIPTION

[0032] In order to make the purpose, technical solutions and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in combination with the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0033] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions, such as molecular cloning, vector construction, etc.

[0034] The Agrobacterium tumefaciens EHA105 in the following examples was purchased from Shanghai Weidi Biotechnology Co., Ltd. with the catalog number AC1013; the plasmid pCAMBIA1300 was purchased from Addgene with the catalog number 44183.

[0035] Example 1: Obtaining positive plants of uORF knockout of CPS1 gene of Salvia miltiorrhiza

[0036] Step 1: Cultivate sterile seedlings of Salvia miltiorrhiza

[0037] Soak the Salvia miltiorrhiza seeds in 0.1% mercuric chloride solution for 10 minutes, rinse with sterile water 3-4 times after soaking, dry the surface moisture, distribute the seeds evenly on 1 / 2MS solid culture medium, and culture under 22℃ and 16h / 8h (light / dark) lighting conditions. Sterile Salvia miltiorrhiza seedlings can be obtained after 3 weeks.

[0038] Step 2: sgRNA design

[0039] According to the upstream and downstream sequences (nucleotide sequence as shown in SEQ ID NO: 1) of the uORF sequence of the Salvia miltiorrhiza CPS1 gene (nucleotide sequence as shown in SEQ ID NO: 2), the PAM site was found and sgRNA was designed. The sgRNA included sgRNA1 and sgRNA2. The target sequence of sgRNA1 was positions 15-34 of the nucleotide sequence shown in SEQ ID NO: 1, and the target sequence of sgRNA2 was positions 175-194 of the nucleotide sequence shown in SEQ ID NO: 1.

[0040] The specific target sequence of sgRNA1 is: 5′-CCTAAACCCTGTTCCGCCAC-3′;

[0041] The specific target sequence of sgRNA2 is: 5'-CTTTCCACATCTCCACTCAA-3'.

[0042] Step 3: Construction of gene editing vector

[0043] The expression units of sgRNA and Cas9 protein coding sequence (amino acid sequence as shown in SEQ ID NO: 3) were co-inserted into the Kpn I and BamH I restriction sites of pCAMBIA1300. PCR and sequencing were used to verify whether the sgRNA and Cas9 coding sequences were correctly inserted into the vector. The constructed vector was propagated in bacteria and plasmid DNA was extracted, which was used for the subsequent stable genetic transformation of Salvia miltiorrhiza plants.

[0044] Step 4: Stable genetic transformation and regeneration of Salvia miltiorrhiza plants

[0045] The constructed gene editing vector is introduced into the EHA105 Agrobacterium strain and the strain is activated. The leaves of the sterile Salvia miltiorrhiza seedlings obtained in step 1 are microwounded and then infected with Agrobacterium introduced with the gene editing vector to introduce the exogenous gene into the plant cells. The infected plant tissues are co-cultured and then sterilized to remove the Agrobacterium. A medium containing selective resistance is used to screen callus containing exogenous genes, and then these tissues are promoted to differentiate and regenerate into plants.

[0046] Step 5: Extract genomic DNA from about 100 regenerated Salvia miltiorrhiza seedlings, use the PCR primers shown in Table 1, perform PCR amplification with KOD enzyme, and the amplification reaction system is shown in Table 2. Run the amplified product on gel to observe whether the band size is consistent. The gel run results are as follows: Figure 1 As shown, Figure 1 The bright band in the middle indicated that the vector was successfully transformed into the Salvia miltiorrhiza plant, and the successfully transformed Salvia miltiorrhiza plants were screened.

[0047] Table 1 PCR primers

[0048] Primer name Primer sequence (5'-3') Forward Primer1 atcggcctggacatcggcaccaac Reverse Primer1 cgtagccgttcttgctctggtcgaagaaaatc

[0049] Table 2 KOD enzyme PCR amplification reaction system

[0050]

[0051]

[0052] Step 6: Identification of positive seedlings with uORF editing and knockout of CPS1 gene in Salvia miltiorrhiza.

[0053] choose Figure 1 The Salvia miltiorrhiza plant corresponding to the bright band shown in the third row and the eighth column is numbered as the positive plant Del3#. Specific primers as shown in Table 3 were designed 200-300 bp upstream and downstream of each target site, and the fragment with the target sequence was amplified with a high-fidelity polymerase. After the PCR product was recovered and purified by gel, it was subjected to Sanger sequencing, and the sequencing results were analyzed using software.

[0054] Table 3 PCR primers

[0055] Primer name Primer sequence (5'-3') F2 TGAAACTCAAATCCTAAACCC R2 TCAAATTTCCCTTTGAGTGGAGAT

[0056] The sequencing results are as follows Figure 2 As shown, it can be seen that in the genome of the positive plant Del 3#, the 72nd nucleotide (G) in the DNA fragment shown in SEQ ID NO: 1 is deleted, and the 78th nucleotide (T) is replaced by A, indicating that the uORF of the CPS1 gene has been successfully knocked out.

[0057] Step 7: Identification of target traits of Salvia miltiorrhiza plants with positive uORF editing of CPS1 gene

[0058] The uORF-positive Salvia miltiorrhiza CPS1 gene was transplanted into a culture pot with a mixture of nutrient soil and vermiculite in a ratio of 1:1, and cultured at 22°C and 16h / 8h (light / dark) light intensity. Fertilizer was applied regularly. After 12 months, the roots of the wild-type and uORF-knockout Salvia miltiorrhiza CPS1 gene plants were taken and vacuum freeze-dried and crushed. Tanshinones were extracted with methanol, and the contents of tanshinones (tanshinone IIA, cryptotanshinone, dihydrotanshinone I and tanshinone I) were measured by liquid chromatography-high-throughput triple quadrupole mass spectrometry (TQ-Absolute). Three groups of experiments were designed in parallel.

[0059] The results are as follows Figure 3 As shown, the content of tanshinone in Salvia miltiorrhiza plants with gene knockout of the uORF of the Salvia miltiorrhiza CPS1 gene was significantly increased, indicating that the knockout of the uORF of the Salvia miltiorrhiza CPS1 gene released the translation inhibition of the CDS of the Salvia miltiorrhiza CPS1 gene, thereby increasing the content of tanshinone in the Salvia miltiorrhiza plants.

[0060] In summary, knockout of the uORF of the CPS1 gene in Salvia miltiorrhiza can increase the tanshinone content in Salvia miltiorrhiza plants, which is of great significance for the innovation of Salvia miltiorrhiza germplasm with high tanshinone content.

[0061] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. The use of DNA fragments in regulating the content of tanshinone in Salvia miltiorrhiza plants, characterized in that: The DNA fragment is one of A1 or A2: A1, a DNA fragment with a nucleotide sequence as shown in SEQ ID NO: 1; A2. A DNA fragment having a nucleotide sequence as shown in SEQ ID NO:

2.

2. Use of a substance for targeted knockout of the DNA fragment described in claim 1 in increasing the content of tanshinone in Salvia miltiorrhiza plants.

3. The sgRNA for targeted knockout of the DNA fragment according to claim 1, characterized in that: The sgRNA includes sgRNA1 and sgRNA2, wherein the target sequence of the sgRNA1 is positions 15-34 of the nucleotide sequence shown in SEQ ID NO:1, and the target sequence of the sgRNA2 is positions 175-194 of the nucleotide sequence shown in SEQ ID NO:

1.

4. A CRISPR / Cas9 system comprising the sgRNA of claim 3.

5. A DNA molecule encoding the sgRNA of claim 3 or the CRISPR / Cas9 system of claim 4.

6. A recombinant expression vector comprising the DNA molecule of claim 5.

7. A recombinant transformant comprising the recombinant expression vector according to claim 6.

8. Use of the sgRNA described in claim 3 or the CRISPR / Cas9 system described in claim 4 in increasing the content of tanshinone in Salvia miltiorrhiza plants.

9. A method for increasing the content of tanshinone in salvia miltiorrhiza plants, characterized in that: include: Constructing a CRISPR / Cas9 system, the CRISPR / Cas9 system comprising an sgRNA targeting the DNA fragment of claim 1, the sgRNA comprising sgRNA1 and sgRNA2, wherein the target sequence of the sgRNA1 is positions 15-34 of the nucleotide sequence shown in SEQ ID NO: 1, and the target sequence of the sgRNA2 is positions 175-194 of the nucleotide sequence shown in SEQ ID NO: 1; The CRISPR / Cas9 system is used to knock out the DNA fragment described in claim 1 in the genome of the recipient Salvia miltiorrhiza plant, and positive plants with a higher tanshinone content than the recipient Salvia miltiorrhiza plant are screened to increase the tanshinone content in the Salvia miltiorrhiza plant.

10. A method for cultivating Salvia miltiorrhiza plants, characterized in that: include: Constructing a CRISPR / Cas9 system, the CRISPR / Cas9 system comprising an sgRNA targeting the DNA fragment of claim 1, the sgRNA comprising sgRNA1 and sgRNA2, wherein the target sequence of the sgRNA1 is positions 15-34 of the nucleotide sequence shown in SEQ ID NO: 1, and the target sequence of the sgRNA2 is positions 175-194 of the nucleotide sequence shown in SEQ ID NO: 1; The CRISPR / Cas9 system is used to knock out the DNA fragment described in claim 1 in the genome of the recipient Salvia miltiorrhiza plant, and a positive Salvia miltiorrhiza plant having a tanshinone content higher than that of the recipient Salvia miltiorrhiza plant is screened.

Images