Sweet waxy corn breeding method and construction of haploid induction line of sweet waxy corn

Abstract

The invention discloses a sweet-waxy corn breeding method and construction of a haploid induction line of the sweet-waxy corn breeding method, and aims to solve the technical problem that genes for corn kernel quality breeding are difficult to polymerize and efficiently create. According to the application, a CRISPR / Cas9 gene editing technology is utilized, targeted mutation of two corn genes ZmWx1 and ZmSh2 is introduced, and through recessive homozygous genotype screening and combinatorial hybridization, a sweet-waxy polymerized double recessive genotype strain is finally obtained; meanwhile, a haploid induction breeding technology and a CRISPR / Cas9 gene editing technology are combined, and a multi-gene fixed-point editing breeding system based on a haploid technology is established. According to the method, the breeding period is greatly shortened, and a theoretical basis is provided for genetic improvement of sweet and waxy corn characters.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular breeding, and in particular to a sweet and sticky corn breeding method and the construction of a haploid induction line thereof. Background Art

[0002] Corn is a widely used crop, and its demand continues to grow. It is widely used in many fields such as raw material supply, industrial production and food security. Among them, sweet and sticky corn, as a type of fresh-edible special corn with high grain quality, has many excellent characteristics such as high sugar content, good palatability, unique flavor, and rich in various nutrients necessary for the human body. It is increasingly favored by the market, and consumer demand is increasing year by year. According to statistics, the national sweet and sticky corn planting area has reached 20 million mu in 2018. The sown area and consumption of fresh corn in my country are both ranked first in the world, showing the broad development prospects of high-quality fresh corn such as sweet and sticky. Therefore, cultivating special-purpose fresh corn with different tastes has become a new trend in the current breeding field.

[0003] The sweetness and stickiness of sweet and sticky corn are controlled by specific genes. Sweet corn is controlled by multiple recessive genes such as su1, su2, sh1, sh2, bt1, bt2, etc., and is divided into three types: ordinary sweet corn, super sweet corn and enhanced sweet corn. Ordinary sweet corn kernels are rich in water-soluble polysaccharides, and also contain high levels of protein, oil and vitamins. Super sweet corn loses starch synthase activity due to homozygous single gene, which converts glucose into soluble sugar instead of starch, so the sugar content is twice that of ordinary sweet corn, but lacks a sticky taste. Enhanced sweet corn is a combination of the characteristics of ordinary sweet corn and super sweet corn, which is achieved through the double recessive mutation of su1su1sese, in which the se gene is a modifier gene of su1, ensuring the sucrose content in the kernel. Waxy corn is controlled by a single recessive gene waxy on chromosome 9, and its kernel endosperm starch is almost entirely composed of amylopectin, showing waxy or sticky characteristics. The waxy gene of ordinary corn usually expresses GBSS I protein and synthesizes amylose, while the waxy corn has a mutation in the waxy gene or a decrease in the activity of GBSS I enzyme, which inhibits the production of amylose and forms 100% amylopectin, eventually leading to the formation of waxy grains. Sweet and sticky corn is a variety controlled by both sweet and sticky genes, resulting in the simultaneous sweetness and stickiness of the grains on the ear. However, the sticky gene has a strong epistatic effect, the gene interaction is obvious, and the interaction effect of sugar content is different, which makes it difficult to achieve the genotype and phenotype of the sweet gene and the sticky gene in the same grain at the same time; and the conventional sweet and sticky corn breeding method is limited by the long backcross breeding cycle and other reasons and has developed slowly. Therefore, it is urgent to develop and establish a rapid grain quality improvement system.

[0004] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0005] In view of at least one of the above technical problems, the present disclosure provides a sweet and sticky corn breeding method and the construction of a haploid induction line thereof, using CRISPR / Cas9 gene editing technology to introduce ZlUT and ZlUT The targeted mutation of two corn genes was carried out through recessive homozygous genotype screening and combinatorial hybridization, and finally a double recessive genotype strain with sweet and sticky aggregation was obtained; at the same time, the haploid induction breeding technology was combined with the CRISPR / Cas9 gene editing technology to develop a breeding system for multi-gene site-specific editing based on haploid induction technology, so as to solve the problem of difficult aggregation and efficient creation of genes in corn grain quality breeding.

[0006] Specifically, the present application provides a sweet and sticky corn breeding method, comprising the following steps: (1) Selection Sh2 Genes and Wx Gene as target gene; (2) In the Sh2 Two gRNA target sequences were designed in the 6th and 8th exon regions of the gene. Wx Two gRNA target sequences were designed in the exon 2 and 8 regions of the gene; (3) The gRNA target sequences are constructed on Cas9 expression vectors to form Sh2 Genes and Wx CRISPR / Cas9 expression vector of the gene; (4) Sh2 Gene CRISPR / Cas9 expression vector was introduced into corn inbred line C01; Wx The gene CRISPR / Cas9 expression vector was introduced into the maize inbred line B104 for genetic transformation to obtain the T0 line; (5) Cultivating the T0 line to the T3 line by self-pollination, and screening the T3 line for the deletion of the Cas9 gene editing element. Sh2 Gene and Wx The homozygous recessive mutant strains of the gene are hybridized, and then the hybrid offspring are self-pollinated to isolate the double homozygous recessive mutant strains as parents; (6) the parent and Wx The single recessive mutant strains of the gene are hybridized to obtain F1 hybrids, and then the F1 hybrids are self-pollinated to obtain sweet and glutinous corn.

[0007] In some embodiments of the present disclosure, in step (2), Sh2 The gRNA target sequences of the genes are shown in SEQ ID NO. 1~2 respectively; Wx The gRNA target sequences of the genes are shown in SEQ ID NO.3~4 respectively.

[0008] According to another aspect of the present disclosure, a method for constructing a sweet and sticky corn haploid induction line is provided, comprising the steps of: (1) Respectively ZlP and ZDMP Gene design of CRISPR / Cas9 targeting sites, construction ZlP and ZDMP Dual gene editing vectors; (2) genetically transforming the dual gene editing vector into corn to obtain ZlP and ZDMP Double gene mutation strains; (3) hybridizing a corn line carrying the sweet and sticky trait gene editing element with the double gene mutant plant to aggregate the sweet and sticky trait with the haploid-induced gene mutation; (4) Screening for sweet and sticky gene editing elements in hybrid offspring and ZlP and ZDMP The double gene mutant plants were self-pollinated; the sweet and sticky trait gene editing elements were then screened in the self-pollinated offspring. ZlP and ZDMP The strains in which all genes are homozygous edited mutations are the sweet and sticky corn haploid induced lines.

[0009] In some embodiments of the present disclosure, in step (1), ZlP and ZDMP The targeting site sequences of the genes are shown in SEQ ID NO.5~6 respectively.

[0010] One or more technical solutions provided in the embodiments of the present application have at least any of the following technical effects or advantages: 1. Combining haploid induction breeding technology with CRISPR / Cas9 gene editing technology, developing a breeding system based on double haploid technology for multi-gene fixed-point editing. After two generations, high-quality double haploid (DH) pure lines of corn improved by gene editing can be quickly created, thereby greatly shortening the breeding period and solving the problem of difficult gene aggregation and efficient creation in corn grain quality breeding. At the same time, using CRISPR / Cas9 gene editing technology, ZlUT and ZlUTThe targeted mutation of two corn genes can eventually be converted into a double recessive gene of sweet and sticky aggregation through recessive homozygous genotype screening and combined hybridization. And because the recessive gene in the recipient material is directly mutated through gene editing technology, rather than obtained through backcrossing recombination, there is no linkage drag; in addition, during the backcrossing process, the transferred gene editing element can be easily separated from the breeding material or parent that does not contain the element, and the genetic background of the parent is restored very quickly. This provides breeding materials for the cultivation of sweet, sticky and sweet sticky corn germplasm varieties, and provides an effective technical approach for the genetic improvement of corn traits such as sweetness and stickiness.

[0011] 2. By further optimizing sgRNA, the gene editing accuracy and specificity of sgRNA are proportional to the GC content in the guide RNA and maintained at 40%~60%, which can reduce off-target effects. In addition, the method of shortening the guide RNA is used to reduce the possibility of homologous sequences. Therefore, the constructed CRISPR / Cas9 vector exhibits excellent targeting efficiency and accuracy. Combined with the gene editing haploid induction technology created for improvement based on target traits, it can make it possible to accurately and quickly improve multiple target traits of corn, which plays an important role in promoting the molecular breeding process of corn, and can be used to create mutant germplasm for gene function research, trait improvement, etc. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 In one embodiment of this application sh2 and Wx Gene structure and its CRISPR-Cas9 expression vector; wherein, A: sh2 The structure of the gene shows 20 exons and 19 introns; the black highlighted sequence indicates the guide RNA, and the red box indicates the PAM; a schematic model of the pBUE411-Cas9-Os3Up-SH2sgRNA vector; B: Wx The structure of the gene, showing 14 exons and 13 introns; the black highlighted sequence indicates the guide RNA and the red box indicates the PAM; schematic model of the pBUE411-Cas9-Os3Up-WXsgRNA vector.

[0013] Figure 2 This is a skeleton map of the original CRISPR-Cas9 vector in one embodiment of the present application.

[0014] Figure 3 In one embodiment of the present application, corn Zmsh2 and ZlUT Map of gene CRISPR-Cas9 editing vectors.

[0015] Figure 4 CRISPR-Cas9 gene editing vector in one embodiment of the present application sh2-1 and sh2-2 Target editing sequence.

[0016] Figure 5 CRISPR-Cas9 gene editing vector in one embodiment of the present application WX-1 and WX-2 Target editing sequence.

[0017] Figure 6 This is the PCR screening of transgenic plants in one embodiment of the present application; wherein, on the left: T0sh-1-6; on the right: T0wx-1-5; NC: negative control.

[0018] Figure 7 is a comparison of editing target sequences between T0 and T1 transgenic plants in one embodiment of the present application; wherein A: SH2 Comparison of gene T1 transgenic line with wild-type editing target sequence; B: Wx GeneT1 transgenic line compared to WT editing target sequence; target sequence is underlined and PAM sequence is highlighted with a red border; red fonts are mutated bases; WT: wild type; deletions are indicated by dashes.

[0019] Figure 8 In one embodiment of the present application, T3 cas9-free sh2 Phenotypic evaluation of homozygous mutant lines; A: T3 mature ear phenotype; B: T3 mature grain phenotype, bar=1cm; C: B104, sh2-c1 and sh2-c2 Longitudinal section of mature grains, bar=0.5cm; D: B104, sh2-c1 and sh2-c2 Determination of soluble sugar in mature grains. Data represent the mean ± SD of sugar measurements of three independent samples of each genotype. One-way ANOVA with Tukey's multiple comparison test. Different lowercase letters indicate significant differences, P < 0.05.

[0020] Fig. 9 In one embodiment of the present application, T3 cas9-free sh2 Analysis of agronomic traits of edited plants; A: plant height; B: ear height; C: main tassel length; D: number of tassel branches; E: outer ear leaf length; F: outer ear leaf width; G: ear leaf length; H: ear leaf width; I: lower leaf length; J: lower leaf width; Different lowercase letters indicate significant differences based on one-way ANOVA with Tukey's multiple comparison test.

[0021] Fig.10 In one embodiment of the present application, T3 cas9-free WxPhenotypic evaluation of homozygous mutant lines; A: T3 mature ear phenotype; B: B104, sh2-c1 and sh2-c2 Analysis of light transmittance of mature grains, bar=1cm; C: B104, wx-c1 and wx-c2 Determination of amylopectin content in mature grains. Data represent the mean ± SD of sugar measurements of three independent samples of each genotype. One-way ANOVA with Tukey's multiple comparison test. Different lowercase letters indicate significant differences. D: WT, wx-c1 and wx-c2 Seed, bar=0.5cm.

[0022] Fig.11 In one embodiment of the present application, T3 cas9-free Wx Analysis of agronomic traits of edited plants; A: plant height; B: ear height; C: main tassel length; D: number of tassel branches; E: outer ear leaf length; F: outer ear leaf width; G: ear leaf length; H: ear leaf width; I: lower leaf length; J: lower leaf width; Different lowercase letters indicate significant differences based on one-way ANOVA with Tukey's multiple comparison test.

[0023] Fig.12 In one embodiment of the present application, T3 cas9-free SW Phenotypic evaluation of homozygous mutant lines; A: genetic map created by SWC; B: T3 mature ear phenotype, bar=1cm; C: B104, sh2-c1 and sh2-c2 Grain phenotype, bar=1cm; D: Grain longitudinal section, bar=0.5cm; E: WT, sw1 and sw2 Determination of soluble sugar in mature grains; F: WT, sw1 and sw2 Determination of amylopectin content in mature grains. Data represent the mean ± SD of sugar measurements of three independent samples of each genotype. Different lowercase letters indicate significant differences based on one-way ANOVA with Tukey's multiple comparison test.

[0024] Fig.13 This is the phenotype of SWCs pollinated for 20 days in one embodiment of the present application.

[0025] Fig.14 Schematic diagram of the gene target editing sequence of the CRISPR-Cas9 gene editing vector ZmPLA in one embodiment of the present application.

[0026] Fig.15It is the CRISPR-Cas9 gene editing vector ZmDMP gene target editing sequence in one embodiment of the present application.

[0027] Fig.16 In one embodiment of the present application, T1 represents ZlP and ZDMP Detection results of the double gene editing strain; A: target 1 ZlP Comparison of gene target sequence editing; B: Target 2 ZDMP Comparison of gene target sequence editing.

[0028] Fig.17 The detection of the sweet and sticky trait gene editing haploid induction line of corn in one embodiment of the present application; wherein A: target 1 ZmPLA1 Homozygous editing of gene target sequence; B: Target 2 ZDMP Homozygous editing of gene target sequences. DETAILED DESCRIPTION

[0029] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; unless otherwise specified, the reagents involved are all commercially available conventional reagents; unless otherwise specified, the detection and preparation methods involved are all conventional methods.

[0030] Example 1. Construction of CRISPR / Cas9 expression vector In this case, we selected the control of soluble sugar content in corn kernels. Sh2 Genes and Controls of Maize Kernel Waxy Texture Wx Genes were first obtained from the maizeGDB database Sh2 and Wx Gene annotation information: Sh2 The gene consists of 20 exons and 19 introns, and it encodes the large subunit of ADP-glucose pyrophosphorylase, a key enzyme in endosperm starch biosynthesis; Wx The gene consists of 14 exons and 13 introns, encoding granule-bound starch synthase I (GBSS I), which plays a role in starch synthesis. Subsequently, according to the mRNA and genome sequences provided by NCBI (National Center for Biotechnology Information, https: / / www.ncbi.nlm.nih.gov / ), they were Sh2 and WxEfficient CRISPR targets were designed. Targets were screened using the CRISPR online website (http: / / www.genome.arizona.edu / crispr / CRISPRsearch.html). Off-targets were evaluated using Cas-Offinder (http: / / www.rgenome.net / cas-offinder / ). Several target sites with a predicted On-score greater than 0.5 and located within the CDS (Coding sequence) region were selected, and the selected target sites were analyzed by maize genome BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Two of the target sites (Target1 and Target2) were selected, and the Bsa I endonuclease recognition sequence was added to the 5′ end and the PCR overlapping sequence was added to the 3′ end, respectively. Sh2 and Wx The target site of the gene is Sh2 Two gRNA target sequences were designed in the 6th and 8th exon regions of Wx Two gRNA target sequences were designed in the 2nd and 8th exon regions of Figure 1 ), specifically: Sh2 Target 1 sequence: ATTCTCAAACAGTCCTCTAGG; Target 2 sequence: TGAGTGGCGATCAGCTTTATCGG.

[0031] Wx Target 1 sequence: GCATGAACGTCGTCTTCGTCGG; Target 2 sequence: TTCGCCTTCTCCGACTACCCGG.

[0032] The fragment containing the target site was amplified by PCR to obtain an amplified product, which was then digested with BsaI enzyme. The digested product was ligated to pBUE411 ( Figure 2 ) vector. Then the recombinant vector was transformed into E. coli DH5ɑ recipient cells ( Figure 3 ). Kan plate screening, colony PCR and sequencing identification sh2 ( Figure 4 ), wx Colony PCR and sequencing identification wx ( Figure 5 ), and finally determined the positive clones.

[0033] Example 2: Agrobacterium-mediated plant gene transformation and screening In this case, maize inbred lines B104 and C01 were used as transformation recipients. 10-15 day old immature embryos were collected from the inbred lines and the isolated immature embryos were co-cultured using the Agrobacterium-mediated transformation method.

[0034] Specifically, the vector pBUE411 was transferred into Agrobacterium EHA105 by electroporation, and positive seedlings were identified by PCR amplification. Freshly peeled maize embryos of about 1 mm were used as materials. The peeled maize embryos were placed in a 2 ml plastic centrifuge tube containing 1.8 mL of suspension. About 150 immature embryos were treated within 30 min; the suspension was removed, and the remaining maize embryos were in the tube, and then 1.0 ml of Agrobacterium suspension was added and placed for 5 min. The immature embryos in the centrifuge tube were suspended and poured into the co-culture medium, and the excess Agrobacterium liquid on the surface was removed with a pipette, and co-cultured at 23 °C in the dark for 3 d. After co-culture, the immature embryos were transferred to the resting medium, and after 6 d of dark culture at 28 °C, they were placed on the screening medium containing 5 mg / L Bialaphos, and the screening culture was started for two weeks, and then transferred to the screening medium containing 8 mg / L Bialaphos for 2 weeks of screening culture. The resistant callus was transferred to differentiation medium 1 and cultured at 25°C, 5000 rcf, and light for 1 week. The callus was then transferred to differentiation medium 2 and cultured under light for 2 weeks; the differentiated seedlings were transferred to rooting medium and cultured under light at 25°C until they took root. Finally, the seedlings were transferred to small pots for growth, and transplanted to a greenhouse after a certain growth stage. The offspring seeds were harvested after 3-4 months. Genomic DNA was extracted from the obtained transgenic plants and PCR was performed. The results showed that ( Figure 6 ), a total of 6 Cas- Sh2 Gene T0 line and 5 strains of Cas- Wx Gene T0 line was positive.

[0035] Example 3: Molecular Characterization Analysis of Transgenic Plant T1 Lines The T1 line was obtained by self-pollination of positive T0 plants, and genomic DNA was isolated from the T1 transgenic plants. Sh2 The results of sequence analysis showed that Sh2 In T1-positive plants, four mutation types from multiple transformants were identified in target 1 and six mutation types were identified in target 2, which were named T sh -1, T sh -2, T sh -3.T sh -4, T sh -5, T sh -6 ( Figure 7 ). The specific editing method of the positive strain is as follows:sh -1 inserts 1 T base at the T1 target site and deletes 2 bases at the T2 target site; while T sh -2 inserts an A base at the T1 target site and deletes a base at the T2 target site; sh -3, a C base is inserted at the T1 site, and the T base at the T2 site is mutated to a GG base; sh -4 inserted a C base at the T1 target site, and the T base at the T2 target site mutated to a G base; sh -5 shows that the T1 target site has 1 T base inserted and the T2 target site has 2 bases deleted; finally, T sh -6 has no mutation at the T1 target site, but has a T base inserted at the T2 target site.

[0036] Likewise, in Wx In the T1 generation, positive plants were screened from 5 mutants derived from multiple transformants in target 1, and 3 mutants were screened in target 2, which were recorded as T Wx -1, T Wx -2, T Wx -3.T Wx -4, T Wx -5 ( Figure 7 ). Wx -1, the G base is inserted at the T1 site, and the AC base is deleted at the T2 site; Wx -2 involves a deletion of 290 bp at the T1 target site and 15 bases at the T2 target site; T Wx -3 has a deletion of 349 bp at the T1 site and 15 bases at the T2 site; T Wx -4 inserts an A base at the T1 target site and deletes 15 bases at the T2 target site. Wx -5 had a T to G mutation at the T1 target site and an A insertion at the T2 target site.

[0037] Example 4: Phenotypic evaluation of T3 homozygous strains and determination of grain composition 1. Phenotypic evaluation of T3 homozygous strains: Through continuous self-pollination to the T3 generation, we obtained Wx and Sh2 The phenotypes of homozygous gene-edited lines were investigated, and their agronomic traits such as plant height, ear height, main tassel length, number of tassel branches, outer ear leaf length, outer ear leaf width, ear leaf length, ear leaf width, lower leaf length, and lower leaf width at the milky stage were further determined. More than 30 plants were selected for each material for data analysis. The Student's r test was used for significant difference analysis.

[0038] 2. Determination of amylopectin content in grains: The amylopectin content detection kit (BeijingSolarbio Science&Technology Co., Ltd. BC4270) was used to determine the amylopectin content in grains. Weigh 0.005 g of dried sample and grind it in a mortar, add 1 mL of reagent 1, transfer to an EP tube after full homogenization, extract in a water bath at 80℃ for 30 min, centrifuge at 3000 g, 25℃ for 5 min, discard the supernatant, keep the precipitate, add 1 mL of reagent 2 (ether) and oscillate for 5 min, centrifuge at 3000 g, 25℃ for 5 min, discard the supernatant, keep the precipitate, add 5 mL of reagent 4 to fully dissolve, water bath at 90℃ for 10 min, centrifuge at 3000 g, 25℃ for 5 min after cooling, and take the supernatant for measurement; preheat the spectrophotometer for more than 30 min, adjust the dual wavelengths to 530nm and 755nm, and adjust to zero with distilled water; dilute the 1 mg / mL standard solution with reagent 4 to 0.5, 0.4, 0.2, 0.1, 0.05, 0.025, and 0.0125 mg / mL standard solutions for use, and the specific operations are shown in Table 1 (add the following reagents provided in the kit in sequence to a 1.5 mL centrifuge tube).

[0039] Table 1 Absorbance value determination (pullen) operation table .

[0040] Finally, a standard curve was established, with the concentration of the amylopectin standard solution as the x-axis and the ΔA standard corresponding to the standard solution as the y-axis. The standard curve was established to obtain the standard equation y=kx+b. The ΔA determination was substituted into the equation to obtain x (mg / mL); Amylopectin content (mg / g mass) = x×V 样总 ÷W=5x÷W;V 样总 : Volume of reagent IV added, 5 mL; W: Sample mass, g. Please follow the instructions for detailed operation steps.

[0041] 3. Determination of soluble sugar content in seeds Weigh 0.1-0.2 g of the sample on a balance, then add 1 mL of distilled water to grind it evenly, slowly add it to a centrifuge tube, heat it in boiling water for 10 min, and check whether the lid of the centrifuge tube is completely closed to prevent leakage. After cooling, centrifuge at 8000 g for 10 min, aspirate the supernatant in the centrifuge tube into a test tube, add distilled water to make up to 10 mL, and gently shake the test tube to mix it evenly. Preheat the spectrophotometer for more than 30 min, adjust the wavelength to 620 nm, and adjust the zero value with distilled water. Adjust the water bath to 95℃. Perform the operations shown in Table 2 in the EP tube. After adding the reagents, mix well and place in a 95℃ water bath for 10 min (cover tightly to prevent water loss). After cooling to room temperature, read the absorbance of the blank tube and the test tube at 620nm, ∆A=A test tube-A blank tube; Establishment of standard curve: adjust the zero value of distilled water at 620nm, read the absorbance of the standard tube, ∆A=A standard tube-A blank tube. Establish a standard curve with concentration (y) as the ordinate and absorbance A (x) as the abscissa; Calculation of soluble sugar content: According to the standard curve, substitute ∆A into the formula (x) to calculate the sample concentration y (mg / mL). Calculated by sample fresh weight: Soluble sugar (mg / g fresh weight) = (y×V1) ÷ (W×V1÷V2) = 10×y÷W; calculated by sample protein concentration: Soluble sugar (mg / mg prot) = (y×V1) ÷ (V1×Cpr) = y÷Cpr. V1: added sample volume, 0.2 mL; V2: added extract volume, 10 mL; Cpr: sample protein concentration, mg / mL; W: sample fresh weight, g.

[0042] Table 2 Absorbance value determination (soluble sugar) operation table .

[0043] 4. Iodine-potassium iodide staining of seed endosperm In order to analyze the amylopectin in the endosperm of the obtained material seeds, the corn kernels were cut longitudinally, and a drop of potassium iodide solution was added to the cut surface to completely stain the endosperm. After waiting for 5 minutes, the endosperm was observed and photographed under an OLYMPUS solid microscope.

[0044] In order to obtain stable Cas9-free homozygous gene editing materials, the self-pollinated progeny were screened. After two generations of self-pollination and identification analysis, two homozygous lines were randomly selected. sh2-c1 and sh2-c2 Compared with the wild type, these lines Sh2 The mutation of the gene causes the top of the kernel to shrink, become translucent, and become sunken when mature ( Figure 8 A, B). In order to observe the changes in the internal structure of the grains in more detail, the mature grains were observed horizontally and longitudinally. The results showed that ( Figure 8 C), compared with the wild type, sh2-c1 and sh2-c2 The endosperm lacks starch filling, and the kernel interior presents a shrunken phenotype. This may be attributed to Sh2 The effect of the gene on AGPase activity hinders the conversion of sugar into starch. The soluble sugar content in the homozygous mutant grains was measured 20 days after pollination. The results showed that ( Figure 8 D), Sh2 The gene mutated, and the soluble sugar content in the mutant increased sharply. Further, the agronomic traits of these homozygous mutant T3 lines were observed, including plant height, ear height, main tassel length, number of tassel branches, outer ear leaf length, outer ear leaf width, ear leaf length, ear leaf width, lower leaf length and lower leaf width. The results showed that ( Fig. 9 AJ), these agronomic traits had no significant difference (P<0.05). Sh2 Specific expression in maize kernels.

[0045] Similarly, randomly select wx-c1 and wx-c2 Two T3 homozygous lines were analyzed. The results showed that ( Fig.10 A), after the grain matures, the whole ear is obviously dull and waxy. Further analysis of the light transmittance of mature wild-type and mutant seeds showed that ( Fig.10 B) The light transmittance of mutant seeds is significantly lower than that of wild-type seeds, which may be due to Wx The grain is composed of waxy endosperm. The amylopectin content of the homozygous mutant grains was tested 20 days after pollination. The results showed that ( Fig.10 C) The amylopectin content in the mutant grains was significantly higher than that in the wild type. This increase is due to Wx The mutation inactivated the GBSS I protein, resulting in the inhibition of amylose synthesis. At the same time, based on the characteristic that amylopectin turns brown with iodine, the starch granules of waxy corn kernels were stained with iodine. The results showed that ( Fig.10 D), after iodine staining, the starch granules of waxy corn kernels were brown, showing the characteristics of waxy corn. In addition, further observations were made Wx The agronomic traits of the homozygous mutant lines showed that ( Fig.11 AJ), with Sh2 Mutants are similar, Wx The agronomic traits of the mutants did not change significantly. Overall, the Wx mutation led to a significant increase in amylopectin content, but had no significant effect on other agronomic traits of corn, and had good application prospects.

[0046] Example 5: Creation of new sweet and sticky polymorphism germplasm Homozygous strains without cas9 elements are of great value and significance in the breeding of sweet and sticky corn germplasm resources. sh2-c1 / sh2-c2 Department and wx-c1 / wx-c2 The F1 ( SH2sh2WXwx ). After F1 self-pollination, the genotype sh2sh2wxwxThe strains were isolated from F1 and used as P1 parents of SWC. wx-c1 / wx-c2 Line as P2 parent ( SH2SH2wxwx ). The P1 parent and the P2 parent were hybridized to obtain SH2sh2wxwx The F1 hybrid of the same genotype was then self-pollinated to produce SWC corn with a waxy to sweet kernel ratio of 3:1 per ear ( Fig.12 A). In addition, randomly select sw-1 ( SH2sh2-c1wx-c1wx-c1 )and sw-2 ( SH2sh2-c2wx- c2wx-c2 ) Phenotypic observation of self-pollinated ears ( Fig.12 B). At 20 days, there is a significant difference between waxy and sweet kernels. The conversion of soluble sugars to starch in waxy kernels is not affected, and amylopectin accumulates rapidly in the endosperm, showing normal dented waxy kernels. Sweet kernels of corn are the result of blocked starch synthesis in the biochemical metabolic pathway. This blockage leads to a decrease in starch content in the endosperm and an increase in reducing sugars, sucrose or water-soluble polysaccharides, resulting in plump and soft kernels ( Fig.13 ).

[0047] After the kernels are fully mature, it can be observed that the endosperm of sweet kernels is more wrinkled than that of wax kernels, causing the sweet kernels to become smaller and darker in color. In order to gain a deeper understanding of the development process of sweet and sticky corn, longitudinal observations of mature kernels were conducted and it was found that compared with waxy kernels, the endosperm of sweet kernels was significantly less starchy and wrinkled ( Fig.12 C, D). At 20 days, the soluble sugar content in the sweet grains separated from SWC ears was detected and analyzed, showing that the soluble sugar content was significantly higher than that in the wild-type grains from WT ears ( Fig.12 E). The waxy kernels separated from SWC ears also had significantly higher amylopectin content than those from WT ( Fig.12 F), indicating that the present application has successfully created a new type of SWCs that combines the characteristics of sweet corn and waxy corn.

[0048] Example 6: Construction of a haploid induction system for sweet and sticky gene editing 1. Haploidy-inducing genes ZlP and ZDMP Edit ZlP and ZDMP are two key genes that determine the haploid induction efficiency. Mutations in these two genes can significantly improve the induction efficiency of the induced line. ZlP and ZDMP In this case, a CRISPR / Cas9 targeting site was designed for each gene by analyzing its sequence characteristics, and the PBUE411 backbone vector was used to construct ZlPand ZDMP Dual gene editing vector ( Fig.14 , Fig.15 ). After transformation with Agrobacterium, the young embryos of maize 15 days after pollination were infected, and then callus was induced and differentiated into seedlings. The T0 plants were screened for positive results. After self-pollination of the positive plants, the editing of the two gene targets was tested in the T1 generation. The test results are as follows Fig.14 As shown, the 8 individual plants tested ZlP and ZDMP The respective target sites of the gene were edited. ZlP The target editing methods of the genes were all heterozygous, and the editing types were mainly 1bp or 58bp deletions. ZDMP The target editing methods of the genes are all homozygous, and the editing types are all -31bp ( Fig.16 ). This indicates that this application is successful ZlP and ZDMP Two haploidy-inducing genes were edited.

[0049] 2. Creation of a sweet and sticky trait gene-edited haploid induction line for maize In order to integrate the CRISPR / Cas9 elements for maize sweet and sticky trait gene editing with ZlP and ZDMP Double-edited mutant genes were aggregated, and positive single plants carrying the CRISPR / Cas9 gene editing element of the sweet and sticky trait gene were combined with ZlP and ZDMP The double gene mutant single plants were hybridized, and the hybrid offspring were selected to carry the CRISPR / Cas9 gene editing element of the sweet and sticky trait gene and ZlP and ZDMP The double gene mutation single plant was self-pollinated, and then the CRISPR / Cas9 gene editing element homozygous for the sweet and sticky trait gene was screened in the self-pollinated offspring. ZlP and ZDMP The genes are all homozygous edited mutation strains, and the test results show that the strain ZlP The gene homozygous deletion is 58bp. ZlP The gene homozygous deletion is 31 bp ( Fig.17 ). The above results show that this application successfully created a haploid induced line of maize sweet and sticky trait gene editing.

[0050] Although some preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0051] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the inventive concept. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. A sweet and sticky corn breeding method, characterized in that: The following steps are involved: (1) Selection Sh2 Genes and Wx Gene as target gene; (2) In the Sh2 Two gRNA target sequences were designed in the 6th and 8th exon regions of the gene. Wx Two gRNA target sequences were designed in the exon 2 and 8 regions of the gene; (3) The gRNA target sequences are constructed on Cas9 expression vectors to form Sh2 Genes and Wx CRISPR / Cas9 expression vector of the gene; (4) Sh2 Gene CRISPR / Cas9 expression vector was introduced into corn inbred line C01; Wx The gene CRISPR / Cas9 expression vector was introduced into the maize inbred line B104 for genetic transformation to obtain the T0 line; (5) Cultivating the T0 line to the T3 line by self-pollination, and screening the T3 line for the deletion of the Cas9 gene editing element. Sh2 Gene and Wx The homozygous recessive mutant strains of the gene are hybridized, and then the hybrid offspring are self-pollinated to isolate the double homozygous recessive mutant strains as parents; (6) the parent and Wx The single recessive mutant strains of the gene are hybridized to obtain F1 hybrids, and then the F1 hybrids are self-pollinated to breed sweet and sticky corn.

2. The sweet and sticky corn breeding method according to claim 1, characterized in that: In step (2), Sh2 The gRNA target sequences of the genes are shown in SEQ ID NO. 1~2 respectively; Wx The gRNA target sequences of the genes are shown in SEQ ID NO.3~4 respectively.

3. A method for constructing a sweet and sticky corn haploid induction line, characterized in that: The steps include: (1) Respectively ZlP and ZDMP Gene design of CRISPR / Cas9 targeting sites, construction ZlP and ZDMP Dual gene editing vectors; (2) genetically transforming the dual gene editing vector into corn to obtain ZlP and ZDMP Double gene mutation strains; (3) hybridizing a corn line carrying the sweet and sticky trait gene editing element with the double gene mutant plant to aggregate the sweet and sticky trait with the haploid-induced gene mutation; (4) Screening for sweet and sticky gene editing elements in hybrid offspring and ZlP and ZDMP Individual plants with double gene mutations were self-pollinated; Then, the sweet and sticky trait gene editing elements were screened in the self-pollinated progeny. ZlP and ZDMP The genes are all homozygous edited mutant strains, and sweet and sticky corn haploid induced lines are bred.

4. The construction method according to claim 3, characterized in that: In step (1), ZlP and ZDMP The targeting site sequences of the genes are shown in SEQ ID NO.5~6 respectively.

Images