Tomato slnf-y c9 gene and its encoded protein in regulating drought tolerance of tomato

By constructing transgenic plants that overexpress and knock out the SlNF-YC9 gene in tomatoes, the problem of insufficient drought resistance in tomatoes was solved, and the effect of improving the drought resistance of tomatoes was achieved, providing new gene resources for the improvement of tomato varieties.

CN119736332BActive Publication Date: 2026-01-02NORTHWEST A & F UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411977638.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-31
Publication Date
2026-01-02
Estimated Expiration
2044-12-31

AI Technical Summary

Technical Problem

There is a lack of effective drought-resistant tomato varieties in the current technology. Drought has a serious impact on the growth, development and yield of tomatoes, and it is necessary to improve the drought resistance of tomatoes through molecular biology.

Method used

By constructing transgenic plants that overexpress the tomato SlNF-YC9 gene, and using Agrobacterium-mediated transformation to construct recombinant vectors, the drought resistance of tomatoes was improved. At the same time, the SlNF-YC9 gene was knocked out using gene editing technology to study its application in regulating tomato drought resistance.

Benefits of technology

Transgenic plants overexpressing SlNF-YC9 showed higher drought tolerance, while plants with the SlNF-YC9 gene knocked out showed reduced drought tolerance, providing new genetic resources for breeding new drought-resistant tomato varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119736332B_ABST
    Figure CN119736332B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of biotechnology, and specifically provides a tomato SlNF-YC9 gene with a nucleotide sequence as shown in SEQ ID NO:1, a tomato SlNF-YC9 protein with an amino acid sequence as shown in SEQ ID NO:2, or a biological material containing the tomato SlNF-YC9 gene with the nucleotide sequence as shown in SEQ ID NO:1, and application of the biological material in regulating drought resistance of tomatoes or cultivating drought-resistant tomatoes, which provides a new genetic resource for improving drought-resistant varieties of tomatoes.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application relates to the field of biotechnology, and particularly relates to application of a tomato SlNF-YC9 gene and a coded protein thereof in regulating drought resistance of tomatoes. BACKGROUND

[0002] Tomato (Solanum lycopersicum L.) is an important economic vegetable crop widely cultivated worldwide. Its fruits are not only delicious but also rich in nutrients, containing various vitamins and trace mineral nutrients beneficial to human health. The high content of vitamin C, vitamin A, vitamin K, and minerals such as potassium and iron in tomato fruits makes it play an important role in promoting health and preventing diseases. Tomato has a long history of cultivation, originating from the Andes mountain region of South America. After a long period of domestication and breeding, there are now thousands of different varieties. These varieties have different characteristics in appearance, color, size, and taste, meeting the needs of different regions and consumers. From cherry tomatoes to beefsteak tomatoes, from red to yellow, green, and even black, the diversity of tomatoes demonstrates the wisdom and creativity of human agricultural civilization.

[0003] In agricultural production, the cultivation of tomatoes has certain requirements for environmental conditions. Drought, as a common natural disaster, has a serious impact on the growth and yield of tomatoes. Therefore, research and utilization of drought-resistant genes in tomatoes, through molecular biology and genetic engineering methods for variety improvement, are of great significance for improving drought resistance, stabilizing yield, and ensuring food safety.

[0004] In recent years, scientists have made significant progress in the study of drought-resistant genes in tomatoes. For example, the mechanism of CPK27, BBX18, and other genes in tomato drought resistance has been discovered, providing a theoretical basis and technical support for breeding new drought-resistant tomato varieties. Through techniques such as genome-wide association analysis, researchers are continuously exploring and analyzing the genetic basis of tomato drought resistance, with the aim of reducing the impact of drought on tomato yield in future agricultural production and promoting the sustainable development of the tomato industry.

[0005] Therefore, creating new drought-resistant tomato materials and cultivating new drought-resistant varieties are of great significance for ensuring stable and increased production of tomatoes. SUMMARY

[0006] The application provides application of a tomato SlNF-YC9 gene and a coded protein thereof in regulating drought resistance of tomatoes, and research finds that transgenic plants overexpressing SlNF-YC9 are more drought-resistant, and the drought resistance of tomato plants obtained by knocking out the SlNF-YC9 gene using gene editing technology is significantly reduced, thereby providing a gene resource for improvement of drought-resistant tomato varieties.

[0007] Nuclear Factor-Y (NF-Y) is also known as CCAAT binding factor (CBF) and heme-activator proteins (HAP). NF-Y contains three subunit members NF-YA, NF-YB and NF-YC. In animals, usually a single subunit is encoded by a single gene, while in plants, gene families exist, for example, in maize, there are 14, 18 and 18 members of NF-YA, NF-YB and NF-YC respectively (Zhang et al., 2016), and in Arabidopsis, there are 10, 13 and 13 members of the three subunits respectively (Laloum et al., 2013). NF-Y transcription factors not only regulate plant growth and development, but also play an important role in drought response. For example, PdNF-YB21 specifically expressed in the roots of poplar can enhance the drought tolerance of overexpressing poplar plants by increasing the content of abscisic acid in the roots (Zhou et al., 2020). Soybean GmNF-YC14 / GmNF-YB2 / GmNF-YA16 forms a trimer, regulates and enhances the expression of ABA receptor GmPYR1, thereby enhancing ABA signal transduction, and ultimately improving the drought tolerance of transgenic soybean (Yu et al., 2021). Under normal conditions and drought stress, overexpression of sweet orange CsNF-YA5 in tobacco significantly reduces the production of H2O2 and improves the photosynthetic rate (Pereira et al., 2018). Although some progress has been made in the study of NF-Y transcription factors, there are few reports on the involvement of tomato NF-YC members in tomato drought tolerance.

[0008] The first object of the present application is to provide the application of tomato SlNF-YC9 gene in regulating the drought tolerance of tomato, the nucleotide sequence of tomato SlNF-YC9 gene is shown as SEQ ID NO: 1; overexpression of tomato SlNF-YC9 gene is regulated to improve the drought tolerance of tomato.

[0009] The second object of the present application is to provide the application of tomato SlNF-YC9 gene in breeding drought-tolerant tomato, the nucleotide sequence of tomato SlNF-YC9 gene is shown as SEQ ID NO: 1; transgenic tomato plants overexpressing tomato SlNF-YC9 gene are constructed to improve the drought tolerance of tomato.

[0010] Further, the transgenic tomato plants are constructed by Agrobacterium-mediated method.

[0011] Further, the agrobacterium-mediated method comprises constructing a recombinant vector for overexpression of the tomato SlNF-YC9 gene, and transforming the agrobacterium with the recombinant vector, wherein the initial vector of the recombinant vector is pHellsgate2.

[0012] A third object of the present application is to provide an application of the tomato SlNF-YC9 protein in regulating drought tolerance of tomatoes, and the amino acid sequence of the tomato SlNF-YC9 protein is shown as SEQ ID NO: 2.

[0013] A fourth object of the present application is to provide an application of the tomato SlNF-YC9 protein in breeding drought-tolerant tomatoes, and the amino acid sequence of the tomato SlNF-YC9 protein is shown as SEQ ID NO: 2.

[0014] A fifth object of the present application is to provide an application of the biological material containing the tomato SlNF-YC9 gene with the nucleotide sequence shown as SEQ ID NO: 1 in regulating drought tolerance of tomatoes.

[0015] A sixth object of the present application is to provide an application of the biological material containing the tomato SlNF-YC9 gene with the nucleotide sequence shown as SEQ ID NO: 1 in breeding drought-tolerant tomatoes.

[0016] Further, the biological material is a recombinant vector, an expression cassette, a transgenic cell line or a recombinant bacterium.

[0017] In summary, due to the adoption of the above technical solutions, the present application has the following beneficial effects:

[0018] It is found that the transgenic plants overexpressing SlNF-YC9 are more drought-tolerant, and the drought tolerance of the tomato plants obtained by knocking out the SlNF-YC9 gene by using gene editing technology is obviously reduced. The present application provides an application of the tomato SlNF-YC9 gene with the nucleotide sequence shown as SEQ ID NO: 1, the tomato SlNF-YC9 protein with the amino acid sequence shown as SEQ ID NO: 2 or the biological material containing the tomato SlNF-YC9 gene with the nucleotide sequence shown as SEQ ID NO: 1 in regulating drought tolerance of tomatoes or breeding drought-tolerant tomatoes, which provides a new genetic resource for improving drought-tolerant varieties of tomatoes. BRIEF DESCRIPTION OF DRAWINGS

[0019] Figure 1 Figure 2 is a graph showing the detection results of the SlNF-YC9 expression amount in the leaves of the wild-type tomato variety M82 in Example 1 under different days of drought treatment and after 5 days of rehydration.

[0020] Figure 2 Figure 4 is a graph showing the detection results of the SlNF-YC9 expression amount in the wild-type plants and the overexpression plants in Example 3.

[0021] Figure 3 This is a sequencing result diagram of the T0 generation knockout plants obtained in Example 3; where, Figure 3 A represents the gene editing site map of the T0 generation knockout plants; Figure 3 B represents the gene difference diagram between wild-type plants, knockout line KO-13, and knockout line KO-23; Figure 3 The figure of C represents the amino acid differences between wild-type plants, knockout line KO-13, and knockout line KO-23.

[0022] Figure 4 The drought stress phenotypes of the overexpressing lines, knockout lines, and wild-type AC plants under normal and drought treatments in Example 4 are shown. Among them, OE-5 and OE-10 are overexpressing lines, and KO-13 and KO-23 are knockout lines.

[0023] Figure 5 This is a graph showing the drought tolerance test results of the overexpression line, knockout line, and wild-type AC plant under normal and drought treatments in Example 4; where, Figure 5 A represents the conductivity measurement results; Figure 5 B represents the MDA content determination results in the graph; Figure 5 The C in the figure represents the SOD enzyme activity assay results; Figure 5 The figure shows the results of POD enzyme activity assay; OE-5 and OE-10 are overexpression lines, while KO-13 and KO-23 are knockout lines. Detailed Implementation

[0024] The present invention will now be described in detail with reference to the accompanying drawings.

[0025] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0026] Example 1

[0027] Screening for drought response gene SlNF-YC9

[0028] Wild-type tomato variety M82, which had grown normally to one month of age, was subjected to drought treatment: 25℃, 16h light / 20℃, 8h darkness. Tomato leaves were sampled after 1, 2, 3, 4, and 5 days of drought and after rehydration for transcriptome sequencing analysis.

[0029] Result: As Figure 1As shown, the analysis of the transcriptome results found that the expression amount of SlNF-YC9 was 3.45 times of CK at 1d of drought treatment, 5.11 times of CK at 2d, and maintained high expression until the expression amount decreased to the level before drought treatment after rehydration.

[0030] Example 2

[0031] Construction of SlNF-YC9 overexpression and knockout vectors

[0032] Construction of SlNF-YC9 overexpression vector: specific primers OE-SlNF-YC9-F (sequence: TTGGAGAGGACACGCTCGAGATGGATCAACATGGAAATGGACAGC) and OE-SlNF-YC9-R (sequence: CATTAAAGCAGGACTCTAGATTAAGAATCTGAGGGTGGTTGC) were designed according to the sequence. The SlNF-YC9 fragment was amplified using high-fidelity DNA polymerase (Nanjing Novozyme Super-Fidelity DNA Polymerase, item number: P501-d1), and then the pHellsgate2 vector was linearized by XbaI and XhoI double enzyme digestion. The SlNF-YC9 fragment was connected with the linearized vector using homologous recombination enzyme (Nanjing Novozyme ClonExpress Ultra OneStep Cloning Kit, item number: C115-01), and the overexpression vector driven by 35S promoter was obtained. The recombinant plasmid was sent to Xi'an Genesee Company for sequencing, and the results of the primer sequences (F-GACGCACAATCCCACTATCC; R-GCTTCTGGATTCCTGTAATCTAAGC) were found to be completely consistent with the sequence published in the tomato genome. The nucleotide sequence of SlNF-YC9 is shown in SEQ ID NO: 1, and the encoded amino acid sequence is shown in SEQ ID NO: 2.

[0033] SlNF-YC9 gene sequence, SEQ ID NO. 1 is shown as follows:

[0034] ATGGATCAACATGGAAATGGACAGCCTCCAGGTATTGGAGTCGTTACTAGCTCAGCTCCAATATATGGTGCTCCATACCAAGCTAACCAAATGGCAGGGCCCTCTCCTCCTGCAGTTTCAGCTGGTGCAATTCAATCTCCTCAAGCAGCTGGTCTTGCTGCTTCGTCAGCTCAGATGGCGCAACATCAGCTCGCTTATCAGCACATTCATCAGCAGCAGCAACAACAGTTGCAGCAACAACTCCAGACTTTCTGGGCAAATCAATATCAAGAAATCGAGCATGTTACTGATTTCAAGAATCATAGCTTGCCATTGGCAAGGATCAAGAAAATCATGAAAGCGGATGAAGATGTTAGGATGATATCTGCTGAAGCACCAGTCGTATTTGCTCGTGCCTGTGAGATGTTCATACTTGAATTGACACTGCGTGCATGGAACCACACTGAGGAGAACAAAAGGAGGACGCTGCAGAAAAATGATATCGCTGCAGCCATAACAAGGACTGACATATTTGATTTCTTAGTTGACATTGTCCCAAGAGAGGACTTGAAAGATGAGGTGCTTGCAACAATTCCTAGAGGAACGCTTCCTGTTGGAGGCCCAACTGAGGGTCTGCCATTCTATTATGGCATGCCACCACAATCTGCTCAACCGATTGGAGCTCCAGGGATGTACATGGGAAAGCCTGTCGATCAAGCTCTGTATGCCCAGCAGCCCCGCCCATATATGGCACAGCCAATTTGGCCCCAGCAGCAGCAACCACCCTCAGATTCTTAA.

[0035] The SINF-YC9 protein sequence, SEQ ID NO. 2, is shown below:

[0036] MDQHGNGQPPGIGVVTSSAPIYGAPYQANQMAGPSPPAVSAGAIQSPQAAGLAASSAQMAQHQLAYQHIHQQQQQQLQQQLQTFWANQYQEIEHVTDFKNHSLPLARIKKIMKADEDVRMISAEAPVVFARACEMFILELTLRAWNHTEENKRRTLQKNDIAAAITRTDIFDFLVDIVPREDLKDEVLATIPRGTLPVGGPTEGLPFYYGMPPQSAQPIGAPGMYMGKPVDQALYAQQPRPYMAQPIWPQQQQPPSDS.

[0037] Construction of CRISPR / Cas9 vector containing SlNF-YC9 specific sgRNA: According to the genomic sequence of SlNF-YC9, the sgRNA target sequence was designed using the CRISPR target site design website (http: / / crispr.hzau.edu.cn / CRISPR / ). The SlNF-YC9 specific knockout target sequence is CATGGAAATGGACAGCCTCC. After annealing of the target sequence, it was connected with the AtU6-sgRNA-AtUBQ-Cas9 vector linearized using BbsI enzyme. After transformation of E. coli, the plasmid was extracted. Both the constructed Cas9 recombinant plasmid and the pCAMBIA2301 vector were double-digested with EcoRI and HindIII. After ligation, the plasmid was extracted after transformation of E. coli. The final vector was sent to Xi'an Qikai Company for sequencing.

[0038] Example 3

[0039] Obtaining of tomato SlNF-YC9 gene overexpression plants and knockout plants

[0040] The correctly sequenced overexpression vector and knockout vector were transformed into Agrobacterium GV3101. The Agrobacterium GV3101 liquid transformed with the SlNF-YC9 overexpression vector and knockout vector with an OD of 0.6 and 30 mL was used to infect tomato cotyledons. Then, callus induction was performed using tomato selection medium, adventitious bud differentiation was performed using subculture medium, and rooting culture was performed using rooting medium. Finally, the rooted tissue culture seedlings were obtained.

[0041] Tomato selection medium: 4.43 g of MS powder (Phytotech, M519) was weighed into 800 mL of ultrapure water, 30 g of sucrose was added, and the volume was made up to 1000 mL. The pH was adjusted to 5.8, 7.5 g of agar was added, and high-pressure sterilization was performed at 121°C for 21 min. After cooling, 0.1 mg / L IAA + 2 mg / L zeatin (ZR) + 100 mg / L kana + 360 mg / L TMT were added.

[0042] Callus induction culture condition: 16h light / 8h dark, 25 degrees, culture for 14 days.

[0043] Tomato subculture medium: weigh 4.43g MS powder (Phytotech, M519), dissolve in 800mL ultrapure water, add 30g sucrose, and make up to 1000mL. Adjust PH to 5.8, agar 7.5g, 121℃ high pressure sterilization for 21min, after cooling, add antibiotics 0.2mg / L ZR+100mg / L kana+360mg / L TMT.

[0044] Adventitious bud differentiation culture condition: 16h light / 8h dark, 25 degrees, culture for 14 days.

[0045] Rooting medium: weigh 4.43g MS powder (Phytotech, M519), dissolve in 800mL ultrapure water, add 30g sucrose, 2mg / L IBA, and make up to 1000mL. Adjust PH to 5.8, agar 7.5g, 121℃ high pressure sterilization for 21min, after cooling, add antibiotics 360mg / L TMT+50mg / L kana.

[0046] Rooting culture condition: 16h light / 8h dark, 25 degrees, culture for 21 days.

[0047] Overexpression plant positive detection was performed using primers, and the expression amount of overexpression plants was further detected using real-time fluorescent quantitative PCR. As shown in Figure 2 , the expression amount of SlNF-YC9 in the two overexpression lines was about 90.5 and 38.3 times that in wild type plants, respectively, indicating that overexpression lines were successfully obtained. The sequence near the target of the candidate knockout plant was amplified by PCR using Taq enzyme, and was sent to Xi'an Genkey Company for sequencing to detect whether editing occurred. After sequencing, it was found that KO-13 plant lacked 1 base, KO-23 plant inserted 1 base, both occurred frame shift mutation and caused translation to terminate early Figure 3 . The above results show that knockout plants are successfully obtained.

[0048] SlNF-YC9 knockout vector construction primers:

[0049] F GATTGCATGGAAATGGACAGCCTCC.

[0050] R AAACGGAGGCTGTCCATTTCCATGC.

[0051] SlNF-YC9 knockout vector detection primers:

[0052] F CGGCGAGTTCTGTTAGGTCCTCTA.

[0053] R CTCCGTGGATACCGACCTTCCGC.

[0054] SlNF-YC9 knockout plant editing detection primers:

[0055] F TCTTCGTGTGATTGATATCCAC.

[0056] R TGGTGCTTCAGCAGATATCATC.

[0057] SlNF-YC9 fluorescence quantitative primers:

[0058] F CGTTACTAGCTCAGCTCCAATA.

[0059] R GATGAATGTGCTGATAAGCGAG.

[0060] Example 4

[0061] Drought tolerance detection of tomato SlNF-YC9 gene overexpression lines and knockout lines

[0062] Wild type AC plants, overexpression lines and knockout lines were all subjected to 12 days of continuous drought treatment. At the beginning of the test, overexpression plants and knockout plants showed similar phenotypes to AC plants. However, after 4 days of drought, AC plants began to show leaf wilting, knockout plants showed stronger wilting, while overexpression plants were basically healthy. Figure 4 ) Although all plants became wilted after 12 days of drought treatment, it was obvious that knockout plants, AC plants showed more severe drought damage (such as stem breakage, leaf petiole shedding) than overexpression plants, which indicated that overexpression of SlNF-YC9 enhanced the drought resistance of tomato plants. It was found that overexpression plants showed increased antioxidant enzyme SOD and POD activity, reduced membrane damage, as evidenced by reduced electrolyte leakage and reduced malondialdehyde content under drought stress, while knockout lines were the opposite Figure 5 ) However, under control conditions, no significant differences in these physiological and biochemical indicators were detected between AC, overexpression plants and knockout plants.

[0063] The above only describes the preferred embodiments of the present application and is not intended to limit the present application. Any modifications, equivalent replacements and improvements made within the spirit and principle of the present application shall be included in the protection scope of the present application.

Claims

1. The application of the tomato SlNF-YC9 gene in regulating drought resistance in tomatoes, characterized by: The nucleotide sequence of the tomato SlNF-YC9 gene is shown in SEQ ID NO:1; regulating the overexpression of the tomato SlNF-YC9 gene can improve the drought resistance of tomatoes.

2. The application of the tomato SlNF-YC9 gene in the breeding of drought-resistant tomatoes, characterized by, The nucleotide sequence of the tomato SlNF-YC9 gene is shown in SEQ ID NO:1; transgenic tomato plants overexpressing the tomato SlNF-YC9 gene were constructed to improve the drought resistance of tomatoes.

3. The application as described in claim 1 or 2, characterized in that, Transgenic tomato plants were constructed using the Agrobacterium-mediated transformation method.

4. The application as described in claim 3, characterized in that, The Agrobacterium-mediated transformation method includes constructing a recombinant vector for overexpressing the tomato SlNF-YC9 gene, transforming Agrobacterium with the recombinant vector, and using the initial vector of the recombinant vector as pHellsgate2.

5. The application of tomato SlNF-YC9 protein in regulating drought resistance in tomatoes, characterized by: The amino acid sequence of tomato SlNF-YC9 protein is shown in SEQ ID NO:2; regulating the overexpression of tomato SlNF-YC9 protein can improve the drought resistance of tomatoes.

6. The application of tomato SlNF-YC9 protein in the cultivation of drought-resistant tomatoes, characterized in that, The amino acid sequence of the tomato SlNF-YC9 protein is shown in SEQ ID NO:2; regulating the overexpression of the tomato SlNF-YC9 protein to cultivate drought-resistant tomatoes.

7. Application of biological materials that overexpress the tomato SlNF-YC9 gene with nucleotide sequences such as SEQ ID NO:1 in regulating tomato drought resistance; the biological materials are recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria.

8. Application of biological materials that overexpress the tomato SlNF-YC9 gene with nucleotide sequences such as SEQ ID NO:1 in the cultivation of drought-resistant tomatoes, wherein the biological materials are recombinant vectors, expression cassettes, transgenic cell lines or recombinant bacteria.

Citation Information

Patent Citations

  • Transcription factor SpbHLH89 for regulating drought tolerance of tomatoes and application of transcription factor SpbHLH89

    CN112876551A

  • Application of tomato gene SlCIPK7 in regulation and control of plant drought resistance

    CN114457106A