Method for constructing a psoriasis mouse model based on dihydroxyisobutyrylation modification of lysine 212 of mouse skin-specific GLUD1

Abstract

The present invention relates to a method for constructing a mouse model for psoriasis research, and a mouse model of conditional knock-in of GLUD1K212T gene in epidermal cells is constructed using Cre-loxP system and a psoriasis mouse model is constructed. First, a Glud1K212T-Flox knock-in mouse model is established using CRISPR / Cas9 technology, and then F1 generation GLUD1K212T-FLOX heterozygous mice are mated with skin-specific cre tool mice KRT14-Cre mice, and Glud1-K212T-flox+ / KRT14-Cre positive mice are screened from the breeding mice to construct a psoriasis model. The method of the present invention has a shorter modeling time, more serious skin lesions and inflammatory cell infiltration, and enhanced glutamine metabolism. It is a method for constructing a psoriasis mouse model that is more consistent with human psoriasis in skin metabolism and inflammatory response.

Description

Technical Field

[0001] The present invention relates to a method for constructing a mouse model for psoriasis research, in particular to a method for constructing a mouse model for psoriasis research by combining gene editing technology with imiquimod induction, and specifically to a method for constructing a psoriasis mouse model based on dihydroxyisobutyrylation modification of lysine 212 at position of mouse skin-specific GLUD1. Background Art

[0002] Psoriasis is a common chronic inflammatory skin disease. Its typical clinical manifestations are red papules or plaques covered with thick scales. Its pathological features are mainly parakeratinization, hyperkeratinization, abnormal proliferation, angiogenesis and inflammatory cell infiltration of skin keratinocytes, which seriously affect the quality of life of patients. Currently, the number of patients worldwide is as high as 125 million, and the prevalence of psoriasis in China is as high as 0.47%, which is a huge challenge for my country's public health. Although biological agents and small molecule treatment measures are effective, the occurrence of relapses and the ineffectiveness of some moderate to severe psoriasis still exist.

[0003] Psoriasis is one of the diseases that are currently being studied in the field of dermatology, and the development of new drugs is particularly important. Animal models of psoriasis are important tools for the pathogenesis of psoriasis and the development of new drugs. Currently, the models used to study psoriasis include spontaneous mouse models, drug-induced models (such as mouse psoriasis models induced by topical application of imiquimod to the skin), genetically engineered mouse models, and allogeneic transplant mouse models.

[0004] Although there are many animal models of psoriasis, they all have shortcomings in fully simulating the characteristics of psoriasis:

[0005] ① Although spontaneous mouse models can show psoriasis skin manifestations in a relatively short period of time, such as acanthosis and increased vascular dilation in the dermis, they rarely show T cell and neutrophil infiltration, cannot reflect all the characteristics of psoriasis, and lack response to psoriasis treatment drugs. Therefore, this type of model is only suitable for the study of anti-proliferative drugs, and is not suitable for the pathogenesis of psoriasis and the study of new drugs;

[0006] ② The genetically engineered mouse model was constructed based on the psoriasis susceptibility gene, which is of great help in studying the pathogenesis of psoriasis. However, the manifestation of psoriasis lesions is greatly affected by later factors such as transcription and translation, and there are differences in the consistency of the lesion model, which limits the research on the progression and treatment of psoriasis.

[0007] ③ The allogeneic transplant animal model is a model in which the skin of psoriasis patients is transplanted onto immunodeficient mice. This type of animal model can more completely simulate the complex immunological and histopathological changes of psoriasis and is a suitable tool for studying the T cell pathogenesis of psoriasis and drug development. However, this type of mouse is more susceptible to infection due to severe immune defects and has a high breeding cost, so the promotion and application of this type of model also has certain limitations.

[0008] ④ Drug-induced skin inflammation is relatively non-specific to a large extent, and its clinical manifestations and pathological histological manifestations overlap with other diseases, such as atopic dermatitis; the drug-induced animal model is an acute induction model and an acute inflammatory response, so it cannot fully reproduce the chronic inflammatory state of psoriasis. Summary of the invention

[0009] In view of the problems existing in the prior art, one of the objectives of the present invention is to provide a method for a psoriasis mouse model with a shorter modeling time and a skin appearance and inflammatory response that are more consistent with human psoriasis.

[0010] To achieve this object, the present invention adopts the following technical solutions:

[0011] A method for constructing a mouse model for psoriasis research, specifically a method for constructing a psoriasis mouse model based on dihydroxyisobutyrylation modification of lysine at position 12 of mouse skin-specific GLUD12:

[0012] include:

[0013] In the first step, the DNA sequences of Cas9 and guide were synthesized by PCR, and then transcribed into Cas9 mRNA and gRNA using a transcription kit. The gRNA is a protein containing GLUD1. K212 The base before the site mutation; select GLUD1 K212 The sequence of about 100 bases upstream and downstream of the mutation site including the mutation base sequence is used as the oligonucleotide donor DNA to synthesize the oligo donor DNA;

[0014] In the second step, the Cas9 mRNA, gRNA and oligo donor DNA obtained in the first step are microinjected into the male pronucleus of the fertilized egg of C57BL / 6J mice, and the injected fertilized eggs are transplanted into the uterus of pseudo-pregnant female mice. The mice born in this way are F0 generation mice;

[0015] The third step is to identify the genotype of the F0 generation mice by PCR amplification and sequencing, mate the identified F0 generation positive mice with C57BL / 6J mice to breed F1 generation mice, and identify the genotype of the F1 generation mice by PCR amplification and gene sequencing to obtain F1 generation positive mice, i.e., F1 generation GLUD1-K212T-FLOX heterozygous mice;

[0016] The fourth step is to cross-breed the F1 generation GLUD1-K212T-FLOX heterozygous mice with the specific cre tool mice KRT14-Cre mice, and identify the genotypes of the bred mice by PCR identification and gene sequencing to obtain Glud1-K212T-flox+ / KRT14-Cre positive mice and Glud1-K212T-flox+ / KRT14-Cre negative mice.

[0017] As a preferred implementation of the present invention, it further comprises:

[0018] In the fifth step, the Glud1-K212T-flox+ / KRT14-Cre positive mice and Glud1-K212T-flox+ / KRT14-Cre negative mice obtained in the fourth step were induced with imiquimod, and experimental controls were performed.

[0019] As a preferred implementation of the present invention, it further comprises:

[0020] The gene sequence of the gRNA is SEQ ID NO.2.

[0021] As a preferred implementation of the present invention, it further comprises:

[0022] The gene sequence of the oligo donor DNA is SEQ ID NO.3.

[0023] As a preferred implementation of the present invention, it further comprises:

[0024] The third step is to use the 5' homology arm recombination positive F0 generation mouse PCR identification method to identify the genotype of the F0 generation mouse by PCR amplification and sequencing, and the primer gene sequences used are SEQ ID NO.4 and SEQ ID NO.5. 6. The method according to claim 1 further comprises:

[0025] The third step is to use the PCR identification method for F0 generation mice positive for 3' homology arm recombination to identify the genotype of the F0 generation mice through PCR amplification and sequencing. The primer gene sequences used are SEQ ID NO.6 and SEQ ID NO.7.

[0026] As a preferred implementation of the present invention, the fifth step further includes: after depilating the backs of Glud1-K212T-flox+ / KRT14-Cre positive mice and Glud1-K212T-flox+ / KRT14-Cre negative mice, respectively, applying imiquimod cream to the depilated area on the back of the mice every day, the back area is 2cm×3cm, applying 62.5mg / d, continuously applying for 5 days, and then conducting the experiment.

[0027] As a preferred implementation of the present invention, it further includes: inducing Glud1-K212T-flox+ / KRT14-Cre positive mice and Glud1-K212T-flox+ / KRT14-Cre negative mice with imiquimod, and on the 5th day of imiquimod induction, the two groups of mice are anesthetized to death, local skin lesions are taken, HE staining is used, and pathological changes of skin tissue are observed under a microscope.

[0028] As a preferred embodiment of the present invention, it further comprises: evaluating Glud1-K212T-flox+ / KRT14-Cre positive mice and Glud1-K212T-flox+ / KRT14-Cre negative mice induced by imiquimod using the PASI scoring standard.

[0029] Compared with the prior art solutions, the present invention has at least the following beneficial effects:

[0030] ① The present invention constructs a psoriasis mouse model based on the post-translational modification level, avoiding the influence of factors such as transcription and translation on the mouse phenotype, reducing the influence of non-experimental factors on the results to a certain extent, and ensuring the comparability of the results;

[0031] ② This invention is the first to construct a psoriasis mouse model based on the metabolic target GLUD1, which is of great significance for the development of research on the metabolic mechanism of psoriasis.

[0032] ③ The modeling cycle of the present invention is short. Mild inflammation appears on the second day of imiquimod induction, and obvious psoriasis skin manifestations appear on the fifth day of induction. However, the modeling cycle in the literature reported previously lasts for about 2 weeks.

[0033] ④ The mouse model constructed by the present invention has more severe skin lesions and inflammatory cell infiltration, which is most consistent with the characteristics of skin lesions in patients with psoriasis and meets the requirements for animal models in the primary stage of psoriasis research. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 :Schematic diagram of establishing the GLUD1 gene locus K212T-Flox knock-in mouse model using CRISPR / Cas9 technology.

[0035] Figure 2: Homologous recombination vector plasmid map.

[0036] Figure 3 :Electrophoresis diagram of homologous recombination vector digestion identification. Nde I digestion identification results, theoretical band sizes are 8660bp, 4977bp, 728bp; M: 1kb DNA ladder.

[0037] Figure 4 : Schematic diagram of the F0 generation mouse identification strategy.

[0038] Figure 5 : Schematic diagram of the positions of PCR identification primers.

[0039] Figure 6 :Glud1-K212T-Flox WT sequencing results.

[0040] Figure 7 :Glud1-K212T-Flox HE sequencing results.

[0041] Figure 8: Figure 8-1 The first row is 100 bp, and a schematic diagram of the DNA ladder; Figure 8-2 This is the electrophoresis diagram for KRT14-Cre PCR identification, where WT is the wild-type mouse genome, H20 is the negative control, and Marker is a 100 bp DNA marker from Transgen (BM311); Numbers 158, 159, 163, and 164 are KRT14-Cre-positive mice.

[0042] Fig. 9 :F1 generation mouse genetic phenotype and basic information diagram.

[0043] Fig.10 :GLUD1 WT and GLUD1 K212T Expression of GLUD1 modified by dihydroxyisobutyrylation of lysine 212 (K212-khib) in mouse epidermal lysates.

[0044] Fig.11 :GLUD1 WT and GLUD1 K212T The contents of IL-17, IL-6, TNF, and IL-1B inflammatory factors in mouse epidermal lysate.

[0045] Fig.12 :GLUD1 WT and GLUD1 K212T Schematic diagram of skin lesion changes during imiquimod induction in mice.

[0046] Fig.13 :GLUD1 WT and GLUD1K212T PASI scores during imiquimod induction in mice.

[0047] Figure 14: GLUD1 WT and GLUD1 K212T Schematic diagram of HE staining of mouse imiquimod-induced tissue sections. HE staining showed that the GLUD1 WT Compared with GLUD1 K212T The epidermis of mice was significantly thickened, with obvious inflammatory cell infiltration, parakeratosis and hyperkeratosis, and epidermal protrusions extending downward. Figure 14-1 For GLUD1 WT Mouse, Figure 14-2 For GLUD1 K212T Mouse.

[0048] Fig.15 :GLUD1 WT and GLUD1 K212T Epidermal thickness of mice induced with imiquimod for 5 days.

[0049] Fig.16 :1# mouse sequencing reaction comparison results.

[0050] Fig.17 :2# mouse sequencing reaction comparison results.

[0051] Fig.18 :3# mouse sequencing reaction comparison results.

[0052] Fig.19 :4# mouse sequencing reaction comparison results.

[0053] Reference numerals:

[0054] Figure 1 :1A, wild type allele; 1B, targeted allele; 1C, targeting vector; 1D, 5'-homology arm; 1E, 3'-homology arm; 1a, exon 1; 1b, exon 4; 1c, wild type exon 4-13 cDNA (exon4-13 cDNA WT); 1d, woodchuck hepatitis virus post-transcriptional regulatory element-polyadenylation (WPRE-pA); Gene editing site; -: homology arm; Gene editing region (coding region); Uncoding region; Mutation base (mutation); loxp; →: primer location; -: PCR product.

[0055] -: PCR sequenced region. DETAILED DESCRIPTION

[0056] The technical solution of the present invention is further described below with reference to the accompanying drawings and through specific implementation methods.

[0057] In order to better illustrate the present invention and facilitate understanding of the technical solution of the present invention, the specific implementation methods of the present invention are as follows:

[0058] The inventor of this patent has devoted himself to research and found that the amino acid at position 212 of GLUD1 is highly modified in the skin lesions of patients with psoriasis, and found that changes in the modification level can promote the proliferation of keratinocytes and the release of chemokines and inflammatory factors. Based on the research results, in order to solve the problems existing in the prior art, the inventor obtained heterozygous mice in which lysine (K) mutated to threonine (T) at position 212 of the GLUD1 gene through genetic engineering technology, and then combined with topical imiquimod induction, successfully constructed a psoriasis mouse model. The modeling time of this model is shorter, the skin lesions and inflammatory cell infiltration are more severe, and the skin appearance and inflammatory response are more consistent with the characteristics of psoriasis.

[0059] The main inventive concept of the present invention is: firstly, CRISPR / Cas9 technology and homologous recombination repair are used to introduce a target point mutation, and the 212th lysine (K) of the GLDU1 protein is mutated to threonine (T), aiming to simulate the high dihydroxyisobutyrylation modification of the 212th lysine of human GLUD1, so as to obtain GLUD1 K212T Mice heterozygous for the point mutation, Figure 1 Schematic diagram of the design strategy for establishing the Glud1 gene locus K212T-Flox knock-in mouse model using CRISPR / Cas9 technology; imiquimod ointment was then applied topically to the skin to further induce a psoriasis mouse model.

[0060] The specific embodiments of the present invention are further described in detail as follows:

[0061] Basic information of the mutated gene:

[0062] The name of the gene mutated in the method of the present invention (Ensembl number) is GLUD1 (ENSMUSG00000021794)

[0063] Ensembl website link for mutation target gene:

[0064] http: / / asia.ensembl.org / Mus_musculus / Gene / Summary?g= ENSMUSG00000021794;r=14:34032684-34067222

[0065] Transcript targeted by mutation (Ensembl number): Glud1-201 (ENSMUST00000022322.17)

[0066] Mutation site: K212

[0067] The method of the present invention uses the Cre-loxP system to construct GLUD1 in epidermal cells K212T A mouse model with conditional gene knock-in and a psoriasis mouse model were constructed. The present invention adopts CRISPR / Cas9 technology to knock-in the K212T-Flox expression frame at the exon 4 site of the Glud1 gene by homologous recombination. The brief process is as follows: Cas9 mRNA and gRNA are obtained by in vitro transcription; a homologous recombination vector (donor vector) is constructed by the In-Fusion cloning method, which contains a 3.1kb 5' homology arm, K212T-Flox and a 2.9kb 3' homology arm. Cas9mRNA, gRNA and donor vector are microinjected into fertilized eggs of C57BL / 6J mice to obtain F0 generation mice. F0 generation mice with positive PCR amplification and sequencing identification are mated with C57BL / 6J mice to obtain positive F1 generation mice. Figure 1 The CRISPR / Cas9 technology was used to establish the Glud1 gene locus K212T-Flox cassette knock-in mouse model. K212T-FLOX The heterozygous mice were mated with the skin-specific Cre tool mouse KRT14-Cre mice, and Glud1-K212T-flox / +; KRT14-Cre+ mice were selected from the bred mice to construct a psoriasis model. The details are as follows:

[0068] In the first step, Cas9 mRNA and guideRNA (guide DNA sequence, referred to as gRNA) were obtained by in vitro transcription; a homologous recombination vector (donor vector) was constructed by In-Fusion cloning, which contained a 3.1kb 5' homology arm, K212T-Flox and a 2.9kb 3' homology arm. Figure 2 This is the plasmid map of the homologous recombination vector. Figure 3 This is the electrophoresis diagram of homologous recombination vector digestion identification. The Nde I digestion identification result shows that the theoretical band sizes are 8660bp, 4977bp, and 728bp; M: 1kb DNA ladder, the position of Nde I enzyme is Figure 2 The plasmid map of the homologous recombination vector is visible.

[0069] Specifically, the DNA sequences of Cas9 and guide are synthesized by PCR, and then transcribed into Cas9 mRNA and gRNA by a transcription kit, wherein the gRNA contains the bases before the GLUD1K212 site mutation; a sequence of about 100 bases upstream and downstream of the GLUD1K212 mutation site including the mutant base sequence is selected as oligonucleotide donor DNA to synthesize oligo donor DNA, and the synthesis of oligo donor DNA can be achieved by existing conventional technology or by a commercial gene synthesis company.

[0070] SEQ ID NO.1: Wild-type genome sequence (i.e. before mutation) information:

[0071]

[0072] The bold bases AAG are the bases to be mutated, and the underlined ones are the gRNA sequences.

[0073] SEQ ID NO.2: gRNA sequence

[0074] TGGGGGTGCTAAAGCTGGTGTTAAGATCAATCCCAAGAACTATACTGATA ATGAATTGGA AAAGATCACAAGGAGGTCACCATGGAGCTAGCAAAA SEQ ID NO.3: oligo donor DNA sequence information:

[0075] TGGGGGTGCTAAAGCTGGTGTTAAGATCAATCCCAAGAACTATACTGATA ATGAATTGGA AAAGATCACA AGGAGGTTCA CCATGGAGCT

[0076]

[0077] In the second step, the Cas9 mRNA, gRNA and donor DNA obtained in the first step were microinjected into the male pronucleus of the fertilized eggs of C57BL / 6J mice, and the injected fertilized eggs were transplanted into the uterus of pseudo-pregnant mother mice. The mice born around 20 days were F0 generation mice, and their genotypes were identified by PCR amplification and product sequencing, and the F0 generation mice with positive sequencing were screened out.

[0078] The F0 generation mice born in the second step are subjected to PCR amplification and sequencing to identify their genotypes; the identification strategy of F0 generation mice is shown in Figure 40.5 cm was cut from the end of the tail of the F0 generation mouse, and then DNA was extracted and PCR identification was performed according to the following method: the 5' arm homologous recombination positive genome should amplify a 3.9 kb fragment, and the negative genome should have no fragment; the 3' arm homologous recombination positive genome should amplify a 3.4 kb fragment, and the negative genome should amplify a 7.6 kb fragment.

[0079] PCR Identification Method for F0 Generation Mice with Positive 5'Homologous Arm Recombination

[0080] Primer information is listed in Table 1 below.

[0081] Table 1

[0082] Primers Sequence 5'-->3' Primer Type I GGCTGTGCTTCTCATGTTAATAGAC Positive II TGAACAACAAATGTCTTATCGCCAA Reverse

[0083] SEQ ID NO.4: Primer 1: GGCTGTGCTTCTCATGTTAATAGAC

[0084] SEQ ID NO.5: Primer II: TGAACAACAAATGTCTTATCGCCAA

[0085] PCR Identification Method for F0 Generation Mice with Positive 3'Homologous Arm Recombination

[0086] Primer information is listed in Table 2 below.

[0087] Table 2

[0088] Primers Sequence 5'-->3' Primer Type III TCCACCAACTAAGCTACGGC Positive IV CCGCTGGGTATGGTGAACTT Reverse

[0089] SEQ ID NO.6: Primer III: TCCACCAACTAAGCTACGGC

[0090] SEQ ID NO.7: Primer IV: CCGCTGGGTATGGTGAACTT

[0091] The reaction system is shown in Table 3 below (the reaction system and reaction conditions are applicable to both the 3' homology arm and the 5' homology arm).

[0092] Table 3

[0093]

[0094] *KOD-Multi&Epi-(TOYOBO, Code No: KME-101)

[0095] The process described in Table 3 is as follows: PCR: polymerase chain reaction, mainly used to amplify specific DNA fragments in vitro. The system required for this reaction is shown in Table 3. The total volume of the system is 20ul, the volume of double deionized water is 8.05ul, the volume of 2xPCR buffer is 10ul, the volume of primer 1 is 0.3ul, the volume of primer 2 is 0.3ul, the volume of KOD-Multi&Epi-* is 0.35ul, and the volume of genomic DNA is 1ul.

[0096] The reaction conditions are listed in Table 4 below.

[0097] Table 4

[0098]

[0099] The specific process described in Table 4 is as follows: PCR: polymerase chain reaction, mainly used to amplify specific The basic steps of PCR technology are as follows: Step 1: 94℃, 3min. Step 2 Denaturation: Heat to 98℃, 20sec. The double-stranded DNA is unwound into a single strand, which is convenient for the primer to bind. Step 3: Annealing: Cool down to about 63°C for 20 seconds. Step 4: Extension: Heat to 68°C for 4 minutes, DNA polymerase recognizes and adds new deoxyribonucleosides Acid chain, repeat steps 2-4, about 35 cycles. Step 5: 68℃, 5min. Step 6: The temperature will drop to 12℃.

[0100] The PCR identification products of F0 positive mice were sequenced, and a total of 4 sequencing reactions were performed. The corresponding regions of the sequencing reactions were as follows: Figure 4 Among them, 2 sequencing reactions were performed for 5' homology arm identification and PCR product sequencing, which were marked as 1 and 2 respectively; 2 sequencing reactions were performed for 3' homology arm identification and PCR product sequencing, which were marked as 3 and 4 respectively.

[0101] Sequencing results of PCR identification products of F0 generation mice and alignment with target sequences

[0102] PCR identification primer position indication Figure 5 shown.

[0103] Results of PCR identification and sequencing of 5' homology arms of F0 generation mice

[0104] 1# Sequencing reaction comparison results are detailed in Fig.16 .

[0105] Fig.16 Query is the target sequence (Glud1-K212T recombinant gene DNA sequence), Subject is the sequencing result, and the red underlined bases are the 5arm homology arm sequences.

[0106] 2# Sequencing reaction comparison results are detailed in Fig.17 .

[0107] Fig.17Query is the target sequence (Glud1-K212T recombinated genomic DNA sequence), Subject is the sequencing result, the red underlined bases are the 5arm homology arm sequences, and the blue underlined bases are the knock-in sequences.

[0108] Results of PCR identification and sequencing of 3' homology arms of F0 generation mice

[0109] 3# Sequencing reaction comparison results are detailed in Fig.18 .

[0110] Fig.18 Query is the target sequence (Glud1-K212T recombinated genomic DNA sequence), Subject is the sequencing result, the red underlined bases are the 3arm homology arm sequences, and the blue underlined bases are the knock-in sequences.

[0111] 4# Sequencing reaction comparison results are detailed in Fig.19 .

[0112] Fig.19 Query is the target sequence (Glud1-K212T recombinated genomic DNA sequence), Subject is the sequencing result, and the red underlined bases are the 3arm homology arm sequences.

[0113] The above results show that in the F0 mouse DNA genome, the 3arm homology arm sequence and the 5arm homology arm sequence are completely matched with the target sequence after alignment, the AAG at the knock-in sequence GLUD1K212 site mutates to ACA, and the remaining sequence bases completely match the target sequence bases.

[0114] The third step is that since the cleavage rate of the fertilized egg is very fast in the early stage, the positive F0 generation mice obtained by genotyping in the second step are chimeric mice, which may not have the ability of stable inheritance. Therefore, it is necessary to pass on the generation to obtain stable F1 generation mice, which is the third step. The specific steps are: the identified F0 generation positive mice are mated with C57BL / 6J mice to breed F1 generation mice, and the genotypes are identified by PCR amplification and sequencing to obtain F1 generation positive mice, that is, F1 generation GLUD1K212T-FLOX heterozygous mice. The PCR identification strategy and method are the same as the F0 generation mouse identification part.

[0115] Fourthly, the F1 generation GLUD1K212T-FLOX heterozygous mice were mated with the specific cre tool mice KRT14-Cre mice, and their genotypes were identified by PCR identification and sequencing to obtain Glud1-K212T-flox+ / KRT14-Cre+ mice (experimental group) and Glud1-K212T-flox+ / KRT14-Cre- mice (control group).

[0116] Specific identification steps: Cut 0.5 cm from the end of the mouse's tail and then extract DNA.

[0117] The identification method of Glud1-K212T-Flox mice is listed in Table 5 below.

[0118] Table 5

[0119]

[0120] SEQ ID NO.8: Primer P1: AGGCAGGCGGATTTCTGAGT

[0121] SEQ ID NO.9: Primer P2: AGCTAAGCTGTGTCTATGAG

[0122] SEQ ID NO.10: WTseq:

[0123] GATAATGAATTAGAAAAAATTACACGGAGGTTCACTATGGAGCTGGCCAAGAAGGGTTTTATTGGTATGTATTGCCCTATGTATTTCTGTATAGAGTGAAAC

[0124] SEQ ID NO.11:Mutseq:

[0125] GATAATGAATTAGAAAAAATTACACGGAGGTTCACTATGGAGCTGGCCAAGACAGG TTTTATTGGTATGTATTGCCCTATGTATTTCTGTATAGAGTGAAAC

[0126] The specific process described in Table 5 is as follows: PCR: polymerase chain reaction, mainly used to amplify specific CertainlyDNA fragment. The system required for this reaction is shown in Table 5. The total volume of the system is 20ul, the volume of double deionized water is 7ul, the volume of 2xPCR mixed solution is 10ul, the volume of primer 1 is 0.5ul, the volume of primer 2 is 0.5ul, and the volume of genomic DNA is 2ul. The basic steps of PCR technology are as follows: Step 1: 94℃, 3min. Step 2 Denaturation: 94℃, 30sec, to unwind the DNA double strand into a single strand, which is convenient for primer binding. Step 3 Annealing: Cool down to about 63℃, 30sec, the primer binds to the complementary sequence of the target DNA single strand. Step 4 Extension: Heat up to 72℃, 30sec, DNA polymerase recognizes and adds new deoxyribonucleosides Acid chain, after heavy Repeat steps 2-4 for about 34 cycles. Step 5: 72°C, 5 min. Step 6: The temperature will drop to 12°C.

[0127] The PCR amplification product was 392 bp, and then the sequencing primer P1 was used to identify the genotype of the PCR amplification product. The bold part is the mutation site.

[0128] The KRT14-Cre mouse identification method is listed in Table 6 below.

[0129] Table 6

[0130]

[0131] SEQ ID NO.12: Primer P3: TTCCTCAGGAGTGTCTTCGC

[0132] SEQ ID NO.13: Primer P4: GTCCATGTCCTTCCTGAAGC

[0133] The specific process described in Table 6 is as follows: PCR: polymerase chain reaction, mainly used to amplify specific DNA fragments in vitro. The system required for this reaction is shown in Table 6, the total volume of the system is 20ul, the volume of double deionized water is 7ul, the volume of 2xPCR mixed solution is 10ul, the volume of primer 1 is 0.5ul, the volume of primer 2 is 0.5ul, and the volume of genomic DNA is 2ul.

[0134] The basic steps of PCR technology are as follows: Step 1: 94℃, 3min. Step 2: Denaturation: 94℃, 30sec to denature the DNA double strands. Spin into a single strand to facilitate primer binding. Step 3 Annealing: Cool to about 63°C for 30 seconds. The primer and the complementary sequence of the target DNA single strand will anneal. Step 4: Extension: Heat to 72°C for 30 seconds, DNA polymerase recognizes and adds new deoxyribonucleotide chains. Repeat steps 2-4 for about 34 cycles. Step 5: 72°C, 5 min. Step 6: The temperature will drop to 12°C.

[0135] The PCR amplification product is 494 bp .

[0136] Figure 6 This is the sequencing result of Glud1-K212T-Flox WT. Figure 7This is the result of Glud1-K212T-Flox HE sequencing. When judging the genotype by direct sequencing of PCR products, please note that the basis for judgment is the "peak shape graph" of the sequencing results, not the sequence information of the sequencing results (because the PCR products of heterozygous mice are mixed with two different DNA molecules, the sequence information of the sequencing results is unreliable). By analyzing the results of the "peak shape graph", at the mutant base site, the double peaks are heterozygous mice; the "peak shape graph" is a normal single peak, which may be wild type or homozygous, and needs to be judged based on the sequence information of the mutation site. For details, please refer to the subsequent sequencing peak graph schematic diagram.

[0137] Figure 8-2 This is the electrophoresis diagram for KRT14-Cre PCR identification, where WT is the wild-type mouse genome, H20 is the negative control, and Marker is a 100bp DNA marker from Transgen (BM311). Numbers 158, 159, 163, and 164 are KRT14-Cre positive mice. Numbers 156, 157, and 160-162 are KRT14-Cre negative mice. Figure 8-1 100bp PlusDNALadder means 100bp Plus DNA ladder.

[0138] Fig. 9 For GLUD1 K212T -FLOX heterozygous mice were mated with specific Cre tool mice KRT14-Cre mice. The genetic information of mice after mating: No. 1 and No. 2 were female GLUD1 K212T and GLUD1 WT , rats 3 and 4 were male GLUD1 WT and GLUD1 K212T Mouse epidermal protein lysate was then extracted, and the dihydroxyisobutyrylation modification content of epidermal GLUD1212 site was detected using a GLUD1-K212 site-specific dihydroxyisobutyrylation modification antibody. Fig.10 For GLUD1 K212T and GLUD1 WT The expression level of dihydroxyisobutyrylation modification of Glud1-K212 site in mouse epidermis. The results showed that WT GLUD1 K212T The expression level of dihydroxyisobutyrylation modification at the Glud1-K212 site in mouse epidermis was significantly increased. Fig.11 In, with GLUD1 WT GLUD1 K212T The content of IL-17 in mouse epidermis was significantly increased.

[0139] Among them, GLUD1 WTMouse refers to Glud1-K212T-flox+ / KRT14-Cre negative mouse; Glud1 K212T Mouse refers to Glud1-K212T-flox+ / KRT14-Cre positive mouse.

[0140] In the fifth step, the Glud1-K212T-flox+ / KRT14-Cre+(IMQ+K212T) and Glud1-K212T-flox- / KRT14-Cre+(IMQ+WT) mice obtained in the fourth step were induced with imiquimod (IMQ) to obtain a psoriasis mouse model.

[0141] Specific induction method: respectively in GLUD1 WT Mouse and GLUD1 K212T After the back hair of heterozygous mice with point mutations was removed, imiquimod cream was applied to the hair removal area on the back of the mice every day. The back area was (2cm×3cm). 62.5mg / d was applied for 5 days. Obvious psoriasis lesions appeared in the hair removal area on the back. The changes of skin lesions during the modeling period are shown in the attached figure. Fig.12 As shown in the figure, there was no significant change in the hair loss area on the back of the two groups of mice two days before modeling. On the second day after modeling, GLUD1 K212T The mouse skin is slightly red, the epidermis is raised, and GLUD1 WT The changes in mice were not obvious; on day 3, GLUD1 K212T There is obvious erythema, some lesions are covered with scales, the lesions are moderately raised, and GLUD1 WT The skin was slightly red and the lesions were slightly raised; on the 4th day, the skin was treated with GLUD1 WT Compared with mice, GLUD1 K212T The erythema of the mice deepened, the surface was covered with thick scales, and the skin lesions were significantly thickened, which was consistent with psoriasis-like changes. K212T Under imiquimod stimulation, the mutant mice began to show psoriasis-like features on the second day, and obvious features appeared on the fourth day. The duration was short, and the inflammatory response and epidermal thickening were more obvious than those with simple application of imiquimod. Fig.13 The PASI (psoriasis area and severity index) score was used. Since imiquimod was only applied to the back of the mice, the PASI score was based on the size of the back lesions, the redness, thickening and desquamation of the plaques. Mild PASI <3; moderate PASI 3-10; severe PASI ≥10. The PASI score is relatively complex and is currently the "gold standard" for clinical and research evaluation of psoriasis. On the fifth day of imiquimod induction, the GLUD1 WT Mouse comparison, GLUD1 K212T The PASI scores of mice were significantly increased.

[0142] To further verify the GLUD1 K212T The histopathological appearance of lesions in mice heterozygous for the point mutation is similar to that of psoriasis, and wild-type mice and GLUD1 K212T The heterozygous mice with the point mutation were induced with imiquimod. On the fifth day of imiquimod induction, the mice in both groups were anesthetized to death and the local skin lesions were taken. HE staining was used to observe the pathological changes of skin tissue under a microscope. Figure 14-1 GLUD1 treatment for imiquimod WT Mouse, 14-2 for GLUD1 K212T Skin histopathology of mice. WT Mouse comparison, GLUD1 K212T The thickness of the mouse epidermis increased, the infiltration of inflammatory factors was enhanced, and obvious microabscesses were visible in the stratum corneum. Fig.15 The thickness of mouse epidermis is related to GLUD1 WT Mouse comparison, GLUD1 K212T The thickness of the mouse epidermis increased, which was statistically significant. Fig.15 is the content of inflammatory factors in mouse epidermal lysate,

[0143] Based on the previous research results, this invention is the first in the world to construct a psoriasis mouse animal model based on the dihydroxyisobutyrylation modification level of proteins and combined with imiquimod stimulation. WT Mouse comparison, GLUD1 K212T The content of mouse IL-17 increased significantly. During the construction of psoriasis mouse animal model stimulated by imiquimod, inflammatory infiltration appeared earlier, the skin lesions thickened significantly, and the psoriasis-like symptoms lasted for a long time.

[0144] Compared with the previously reported methods for constructing psoriasis mouse models, the present invention has at least the following beneficial effects:

[0145] ① The present invention constructs a psoriasis mouse model based on the post-translational modification level, avoiding the influence of factors such as transcription and translation on the mouse phenotype, reducing the influence of non-experimental factors on the results to a certain extent, and ensuring the comparability of the results;

[0146] ② The present invention is the first to construct a psoriasis mouse model starting from dihydroxyisobutyrylation, which plays an important role in exploring the dihydroxyisobutyrylation modification of psoriasis;

[0147] ③ The modeling cycle of the present invention is short, and obvious psoriasis skin manifestations can appear on the 4th day of imiquimod induction, while the modeling cycle reported in the literature previously lasted for about 2 weeks;

[0148] ④ The mouse model constructed by the present invention has more severe skin lesions and inflammatory cell infiltration, which is most consistent with the characteristics of skin lesions in patients with psoriasis and meets the requirements for animal models in the primary stage of psoriasis research.

[0149] The applicant declares that the present invention illustrates the detailed process of the present invention through the above-mentioned embodiments, but the present invention is not limited to the above-mentioned detailed process, that is, it does not mean that the present invention must rely on the above-mentioned detailed process to be implemented. Those skilled in the art should understand that any improvement of the present invention, equivalent replacement of the methods and steps selected by the present invention, addition of auxiliary steps, selection of specific methods, etc., all fall within the protection scope and disclosure scope of the present invention.

[0150] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, a variety of simple modifications can be made to the technical solution of the present invention, and these simple modifications all belong to the protection scope of the present invention.

[0151] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any suitable manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0152] In addition, various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. A method for constructing a mouse model for psoriasis research, comprising: In the first step, the DNA sequences of Cas9 and guide were synthesized by PCR, and then transcribed into Cas9 mRNA and gRNA using a transcription kit. The gRNA is a protein containing GLUD1. K212 The base before the site mutation; select GLUD1 K212 The oligo donor DNA is synthesized by using the sequence of about 100 bases upstream and downstream of the mutation site, including the mutation base sequence; In the second step, the Cas9 mRNA, gRNA and oligo donor DNA obtained in the first step are microinjected into the male pronucleus of the fertilized egg of C57BL / 6J mice, and the injected fertilized eggs are transplanted into the uterus of pseudo-pregnant female mice. The mice born in this way are F0 generation mice; The third step is to identify the genotype of the F0 generation mice by PCR amplification and sequencing, mate the identified F0 generation positive mice with C57BL / 6J mice to breed F1 generation mice, and identify the genotype of the F1 generation mice by PCR amplification and gene sequencing to obtain F1 generation positive mice, i.e., F1 generation GLUD1-K212T-FLOX heterozygous mice; The fourth step is to cross-breed the F1 generation GLUD1-K212T-FLOX heterozygous mice with the specific cre tool mice KRT14-Cre mice, and identify the genotypes of the bred mice by PCR identification and gene sequencing to obtain Glud1-K212T-flox+ / KRT14-Cre positive mice and Glud1-K212T-flox+ / KRT14-Cre negative mice.

2. The method of claim 1, further comprising: In the fifth step, the Glud1-K212T-flox+ / KRT14-Cre positive mice and Glud1-K212T-flox+ / KRT14-Cre negative mice obtained in the fourth step were induced with imiquimod, and experimental controls were performed.

3. The method of claim 1, further comprising: The gene sequence of the gRNA is SEQ ID NO.

2.

4. The method of claim 1, further comprising: The gene sequence of the oligo donor DNA is SEQ ID NO.

3.

5. The method of claim 1, further comprising: The third step is to use the 5' homology arm recombination positive F0 generation mouse PCR identification method to identify the genotype of the F0 generation mouse through PCR amplification and sequencing, and the primer gene sequences used are SEQ ID NO.4 and SEQ ID NO.

5.

6. The method of claim 1, further comprising: The third step is to use the PCR identification method for F0 generation mice positive for 3' homology arm recombination to identify the genotype of the F0 generation mice through PCR amplification and sequencing. The primer gene sequences used are SEQ ID NO.6 and SEQ ID NO.

7.

7. The method of claim 2, wherein the fifth step further comprises: After depilating the backs of Glud1-K212T-flox+ / KRT14-Cre positive mice and Glud1-K212T-flox+ / KRT14-Cre negative mice, imiquimod cream was applied to the depilated area on the backs of mice daily, with an area of ​​2cm×3cm on the back, at 62.5mg / d for 5 consecutive days, and then an experimental control was performed.

8. The method of claim 7, further comprising: Glud1-K212T-flox+ / KRT14-Cre-positive mice and Glud1-K212T-flox+ / KRT14-Cre-negative mice were induced with imiquimod. On the 5th day after imiquimod induction, the two groups of mice were anesthetized to death, and the local skin lesions were obtained for HE staining and observation of pathological changes in skin tissue under a microscope.

9. The method of claim 7, further comprising: The PASI scoring criteria were used to evaluate imiquimod-induced Glud1-K212T-flox+ / KRT14-Cre positive mice and Glud1-K212T-flox+ / KRT14-Cre negative mice.

Images