Application of fusion gene TVP23C-CDRT4 as benzo [g, h, i] perylene exposure biomarker

Abstract

The invention discloses an application of a fusion gene TVP23C-CDRT4 as an exogenous chemical benzo [g, h, i] perylene exposure biomarker in evaluating the exposure risk of cells or organisms in a benzo [g, h, i] perylene environment or the risk of vicious transformation caused by benzo [g, h, i] perylene exposure. According to the invention, a transcriptome technology is utilized to screen a fusion gene TVP23C-CDRT4 with a reduced expression level from a contaminated cell exposed by benzo [g, h, i] perylene, and an experiment speculates that the gene participates in a process of cell DNA damage caused by exposure of benzo [g, h, i] perylene, so that the gene can be used as a benzo [g, h, i] perylene exposure biomarker. The invention provides help for deeply understanding the effect of the fusion gene in the mechanism of malignant transformation of cells or organisms caused by exogenous chemical substances, and also has significant value in the fields of environmental health research and disease prevention.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and more specifically, relates to the application of fusion gene TVP23C-CDRT4 as a biomarker for benzo[g,h,i]perylene exposure. Background Art

[0002] Exogenous chemicals, including air pollutants, pesticides, heavy metals and plastic additives, are widely present in the environment and life. They enter the human body through air, water and food. Long-term exposure to cells may lead to a series of health problems, including cancer, endocrine disruption, immune system damage and nervous system diseases. The pathogenesis is manifested as a complex interaction of multiple pathways, including gene mutation, oxidative stress, abnormal activation of cell signaling pathways and inflammatory response. At present, the research on DNA damage and genome instability in the field of exogenous chemical carcinogenicity (malignant transformation) mainly focuses on DNA sequence changes (such as gene mutation), chromosome number (such as polyploidy and aneuploidy) and structural abnormalities (such as chromosome cross-linking). Genomic instability may cause chromosomal rearrangement, deletion and translocation, causing the fusion of all or part of the sequences of two genes to produce fusion genes. Therefore, it is suggested that fusion genes may serve as a new biomarker for exogenous chemical-induced carcinogenesis (malignant transformation). Screening and identifying fusion genes through reliable technology has important scientific and practical significance for revealing the exposure risk of exogenous chemicals, evaluating their health effects and developing prevention and treatment strategies. However, the research on fusion gene mutations has just begun and is progressing slowly. In the article "Transcriptomic insights into adenoid cystic carcinoma via RNA sequencing", it was disclosed that the high expression of the fusion gene TVP23C-CDRT4 is associated with adenoid cystic carcinoma ACC, but there are no reports on its use as a biomarker for exogenous chemical exposure. Summary of the invention

[0003] The purpose of the present invention is to overcome the above-mentioned defects and shortcomings in the prior art and provide an application of the fusion gene TVP23C-CDRT4 as a biomarker for exposure to the exogenous chemical benzo[g,h,i]perylene in assessing the exposure risk of cells or organisms in a benzo[g,h,i]perylene environment or the risk of malignant transformation caused by benzo[g,h,i]perylene exposure.

[0004] The second object of the present invention is to provide a reagent for detecting the expression level of the fusion gene TVP23C-CDRT4 for use in preparing a product for assessing the exposure risk of cells or organisms in a benzo[g,h,i]perylene environment or the risk of malignant transformation caused by benzo[g,h,i]perylene exposure.

[0005] The third object of the present invention is to provide an application of an agent that promotes overexpression of the fusion gene TVP23C-CDRT4 or a highly specific fragment thereof in the preparation of a product for alleviating cell damage caused by exposure to benzo[g,h,i]perylene.

[0006] The fourth object of the present invention is to provide an application of an agent for inhibiting the expression level of the fusion gene TVP23C-CDRT4 in preparing a malignant transformation cell model caused by an exogenous compound benzo[g,h,i]perylene.

[0007] The above-mentioned object of the present invention is achieved through the following technical solutions:

[0008] The present invention screened and identified a polycyclic aromatic hydrocarbon compound benzo[g,h,i]perylene exposure biomarker-fusion gene TVP23C-CDRT4 based on transcriptomics and bioinformatics technology. The specific process is: ① using RNA-seq to sequence and analyze human lung bronchial epithelial cells after 2 weeks of benzo[g,h,i]perylene exposure to obtain RNA sequencing data; ② quality control management of RNA sequencing data; ③ predicting fusion transcripts and calculating their carcinogenicity; ④ screening benzo[g,h,i]perylene-induced lung cancer-specific chimeric RNA; ⑤ verifying the presence of chimeric RNA and its expression level; ⑥ identifying the function of the fusion gene. Experimental verification found that the expression level of the fusion gene TVP23C-CDRT4 was reduced in cells and mice subacutely exposed to benzo[g,h,i]perylene; in malignant transformed cells chronically exposed to benzo[g,h,i]perylene, the expression level of the fusion gene TVP23C-CDRT4 was also reduced, and the expression level of the fusion gene TVP23C-CDRT4 gradually decreased with the increase in the number of passages.

[0009] Therefore, the present invention provides the use of the fusion gene TVP23C-CDRT4 as a biomarker for exposure to the exogenous chemical benzo[g,h,i]perylene in assessing the exposure risk of cells or organisms in a benzo[g,h,i]perylene environment or the risk of malignant transformation caused by benzo[g,h,i]perylene exposure, and the nucleotide sequence of the TVP23C-CDRT4 is shown in SEQ ID No.1.

[0010] In occupational exposure assessment, for workers in industries such as chemical engineering, the expression of the fusion gene in the workers' cells can be regularly tested to monitor their exposure to the polycyclic aromatic hydrocarbon compound benzo[g,h,i]perylene, providing a basis for occupational health protection. In environmental health research, for residents living in polluted areas (such as near chemical parks), the detection of the fusion gene can help assess the long-term effects of the environmental chemical benzo[g,h,i]perylene on them, especially the assessment of carcinogenicity risk.

[0011] Furthermore, the organism includes but is not limited to humans, mice, cows, horses, etc.

[0012] The present invention also provides the use of a reagent for detecting the expression level of the fusion gene TVP23C-CDRT4 in the preparation of a product for evaluating the exposure risk of cells or organisms in a benzo[g,h,i]perylene environment or the risk of malignant transformation caused by benzo[g,h,i]perylene exposure, wherein the nucleotide sequence of the TVP23C-CDRT4 is shown in SEQ ID No. 1.

[0013] Furthermore, the reagent for detecting the expression level of the fusion gene TVP23C-CDRT4 is a real-time fluorescence quantitative PCR primer, and the nucleotide sequences thereof are shown in SEQ ID No. 2 to 3.

[0014] Furthermore, the expression level of the fusion gene TVP23C-CDRT4 is detected to evaluate the degree of toxicity of cells or organisms exposed to benzo[g,h,i]perylene.

[0015] After overexpressing TVP23C-CDRT4 in normal human lung bronchial epithelial cells BEAS-2B, the present invention detected by comet assay that the percentage of DNA content in the comet tail after overexpressing TVP23C-CDRT4, the length of the comet tail and the distance of the comet Olive tail were significantly lower than those in the normal control group, indicating that after overexpressing TVP23C-CDRT4, DNA double-strand breaks can be reduced and DNA damage can be reduced. However, after knocking down TVP23C-CDRT4 in cells overexpressing TVP23C-CDRT4, the results of the comet assay showed that the percentage of DNA content in the comet tail, the length of the comet tail and the distance of the comet Olive tail of the cells in this group were not statistically different from those in the normal control group. The above results speculate that TVP23C-CDRT4 is involved in the DNA damage process caused by exposure to benzo[g,h,i]perylene. Therefore, the fusion gene TVP23C-CDRT4 can also be used as a therapeutic target for cell damage caused by exposure to benzo[g,h,i]perylene.

[0016] Based on this, the present invention provides the use of an agent that promotes overexpression of the fusion gene TVP23C-CDRT4 or a highly specific fragment thereof in the preparation of a product for alleviating cell damage caused by exposure to benzo[g,h,i]perylene, the nucleotide sequence of the TVP23C-CDRT4 being shown in SEQ ID No.1.

[0017] Furthermore, the nucleotide sequence of the high-specificity fragment of the fusion gene TVP23C-CDRT4 is shown in SEQ ID No.7.

[0018] Furthermore, the cell damage is intracellular DNA breakage.

[0019] Furthermore, the above product is a test kit or a test paper.

[0020] The present invention also provides the use of a reagent for inhibiting the expression level of the fusion gene TVP23C-CDRT4 in preparing a malignant transformation cell model caused by an exogenous compound benzo[g,h,i]perylene, wherein the nucleotide sequence of the TVP23C-CDRT4 is shown in SEQ ID No.1.

[0021] Furthermore, the reagent for inhibiting the expression level of the fusion gene TVP23C-CDRT4 is siRNA, and the nucleotide sequences thereof are shown in SEQ ID No. 4 to 6, respectively.

[0022] Compared with the prior art, the present invention has the following beneficial effects:

[0023] The present invention provides the use of the fusion gene TVP23C-CDRT4 as a biomarker of exposure to the exogenous chemical benzo[g,h,i]perylene in assessing the exposure risk of cells or organisms in a benzo[g,h,i]perylene environment or the risk of malignant transformation caused by benzo[g,h,i]perylene exposure. The present invention screens and identifies a benzo[g,h,i]perylene exposure biomarker-fusion gene TVP23C-CDRT4 based on transcriptomics and bioinformatics technology. Experimental verification shows that the expression level of the fusion gene TVP23C-CDRT4 is reduced in the poisoned cells and mice subacutely exposed to benzo[g,h,i]perylene; the expression level of the fusion gene TVP23C-CDRT4 is also reduced in the malignant transformed cells chronically exposed to benzo[g,h,i]perylene, and the expression level of the fusion gene TVP23C-CDRT4 is gradually reduced with the increase of the number of passages. It is speculated that the gene is involved in the DNA damage process induced by benzo[g,h,i]perylene exposure. Therefore, the fusion gene TVP23C-CDRT4 can be used as a benzo[g,h,i]perylene exposure biomarker. The present invention provides a solid foundation for a deep understanding of the role of fusion genes in the mechanism of malignant transformation of cells or organisms caused by exogenous chemicals. It also has significant value in the fields of environmental health research and disease prevention and control, and is of great significance to the fields of public health and environmental science. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 Agarose gel electrophoresis results.

[0025] Figure 2 This is a diagram of the Sanger sequencing results.

[0026] Figure 3 Schematic diagram of the fusion gene TVP23C-CDRT4.

[0027] Figure 4The expression level of the fusion gene TVP23C-CDRT4 in the subacute (acute) cell model of benzo[g,h,i]perylene exposure.

[0028] Figure 5 The expression level of the fusion gene TVP23C-CDRT4 in the malignant transformation (chronic) cell model exposed to benzo[g,h,i]perylene.

[0029] Figure 6 The expression level of the fusion gene TVP23C-CDRT4 in the subacute (acute) mouse model of benzo[g,h,i]perylene exposure.

[0030] Figure 7 Results for constructing a cell model of overexpression of the fusion gene TVP23C-CDRT4.

[0031] Figure 8 Shown are the comet assay results after overexpression of the fusion gene TVP23C-CDRT4.

[0032] Fig. 9 These are the comet assay results after knocking down the TVP23C-CDRT4 fusion gene in an overexpressed version of the TVP23C-CDRT4 fusion gene. DETAILED DESCRIPTION

[0033] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0034] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0035] 1. Cell lines, experimental animals and test substances

[0036] Human lung bronchial epithelial cells BEAS-2B were purchased from the American Type Culture Collection (ATCC). Experimental animals BALB / c mice were purchased from the Guangdong Experimental Animal Center, and all animals were approved by the Animal Ethics Committee of Guangzhou Medical University (approval number: GY2024-036). Benzo[g,h,i]perylene analytical standards were purchased from Shanghai Aladdin Biochemical Materials Technology Co., Ltd., China.

[0037] 2. Main reagents

[0038] 2.1 Cell culture: DMSO (MP Biomedicals, USA), fetal bovine serum (Zhejiang Tianhang Biotechnology Co., Ltd.), MEM medium, PBS buffer (Zhejiang Senrui Biotechnology Co., Ltd.), DMEM / F12 medium (Gibco, USA), 0.25% trypsin containing 0.02% EDTA (Guangzhou Jingxin Biotechnology Co., Ltd.). Cells were cultured at 37°C in a humidified incubator containing 5% CO2.

[0039] 2.2 Extraction of total RNA from cells: anhydrous ethanol (Guangzhou Xincheng Fine Chemical Co., Ltd.), isopropanol, chloroform (Guangzhou Chemical Reagent Factory), TRIzol Reagent lysis buffer (Thermo Fisher Scientific, USA), 75% ethanol (Shandong Lierkang Company).

[0040] 2.3 Reverse transcription conversion RNA and qRT-PCR experiment: qPCR Master Mix, GoScript TM Reverse Transcription System (Promega, USA).

[0041] 2.4 Agarose gel electrophoresis: Nucleic Acid Red NA-Red (Beyond Biotech Co., Ltd., Guangzhou, China), 5×TBE electrophoresis buffer, 50 bp Ladder DNA Marker (Guangzhou Jingxin Biotechnology Co., Ltd.), and normal melting point agarose (Guangzhou Yisheng Technology Co., Ltd., Guangzhou, China).

[0042] 3. Main instruments

[0043] LS-75HD vertical pressure steam sterilizer (Jiangyin Binjiang Company, China), high temperature constant temperature blast drying oven (Shanghai Fuma Company, China), ultrapure water system (millipore), clean bench (Thermo Fisher Scientific, USA), cell culture incubator (Thermo Fisher Scientific, USA), CoolCell program cooling box (Biocision, USA), -80℃ ultra-low temperature refrigerator (Thermo Fisher Scientific, USA), liquid nitrogen tank (Leshan Company, Sichuan, China), electric constant temperature water bath (Changfeng Company, Suzhou, China), low speed centrifuge (ScanSpeed), ice maker (SANYO), BSA124S analytical balance (Sartorius), persistent low temperature operation platform module (Biocision, USA), inverted microscope (Nikon), refrigerator (Haier, Samsung), Heraeus Fresco17 refrigerated centrifuge (ThermoFisher, USA) Scientific Company), LX-300 mini centrifuge (Qilin Bell), VORTEX-5 vortex mixer (Qilin Bell), electrophoresis power supply (Bio-Rad), horizontal electrophoresis tank (Bio-Rad), BLT GV1500 Pro fully automatic gel imaging system and Gel View 6000 high-sensitivity chemiluminescence imaging system (Guangzhou Bo Lu Teng Company, China), Epoch multi-function microplate reader (Bio-Tek Company, USA), micropipette and supporting consumables (Eppendorf Company, Germany), 10 cm culture dish (Eppendorf Company, Germany), 6 cm culture dish (Corning Company, USA), 15 mL and 50 mL centrifuge tubes (Corning Company, USA), 0.2 mL, 1.5 mL, 2 mL EP tubes and 0.2 mL eight-row flat-cap thin-wall tubes (Axygen Company, USA), HOPE-MED 8052H single-concentration oral and nasal inhalation exposure system (Hepu Industry and Trade Co., Ltd., Tianjin Development Zone, China).

[0044] 4. Preparation of main solutions

[0045] 4.1 Complete medium containing 5% fetal bovine serum: Add fetal bovine serum (Shanghai Sijiqing Company) to MEM medium (Hyclone Company, USA) and DMEM / F12 medium (Hyclone Company, USA) to prepare complete medium containing 5% fetal bovine serum, and store it in a refrigerator at 4°C for use.

[0046] 4.2 Cell freezing solution: Mix DMSO and fetal bovine serum in a volume ratio of 1:9 and store in a refrigerator at 4°C for later use.

[0047] 4.3TBE electrophoresis buffer: Add 1200 mL of pure water to a beaker, add 300 mL of 5×TBE electrophoresis buffer and mix well to prepare 1500 mL of 1×TBE electrophoresis buffer and store at room temperature.

[0048] Example 1 Total RNA Extraction

[0049] The cells were exposed to exogenous chemicals according to the experimental protocol. After the exogenous chemical exposure, the treated cell samples (human lung bronchial epithelial cells BEAS-2B) were gently collected using RNase-free tools and then total RNA was extracted.

[0050] Subacute poisoning (acute) model: Use DMSO to dissolve benzo[g,h,i]perylene (BghiP) analysis standards, and the BghiP concentration gradient is set to 0, 5, 50, 500 and 5000 ng / mL. After 24 hours of poisoning, the appropriate exposure concentration is determined, and time gradient exposure (0, 1, 2, 3 and 4 weeks) is carried out. Preliminary experiments are carried out on human lung bronchial epithelial BEAS-2B cells. The volume fraction of DMSO is 0.1% to control the effect of the solvent on the cells. According to the results of the preliminary experiment, BEAS-2B cells exposed to 500 ng / mL BghiP for 2 weeks were selected to construct a subacute poisoning model, and the first generation of poisoned cells were selected for subsequent experiments.

[0051] Malignant transformation (chronic) model: Use DMSO to dissolve the benzo[g,h,i]perylene (BghiP) analysis standard to obtain 50 ng / mL of benzo[g,h,i]perylene, and infect human lung bronchial epithelial BEAS-2B cells. Continuously infect and subculture to obtain a malignant transformation cell line, which was deposited in Guangdong Provincial Microbiological Culture Collection Center on June 27, 2024, with the deposit number GDMCC No: 64810.

[0052] Control group: BEAS-2B cells continuously exposed to 0.1% DMSO for 2 weeks were selected to construct a control group model, and the first generation of exposed cells were selected for subsequent experiments.

[0053] 1. Total RNA Extraction

[0054] (1) Cell collection: After the cell confluence reaches 70% or more, wash the cells twice with PBS, add 1 mL of Trizol reagent, pipette for 4 min to allow Trizol to fully contact and digest the cells, and place the cells in a 1.5 mL EP tube.

[0055] (2) Cell extraction: Add 200 μL of chloroform to the Trizol suspension containing cells, shake vigorously for 30 s, and let stand for 10 min. Centrifuge at 4°C, 12,000 rcf for 15 min, then use a 200 μL pipette to draw 400 μL of supernatant into a new 1.5 mL EP tube and discard the rest.

[0056] (3) Cell precipitation: Add 400 μL of isopropanol at a ratio of 1:1. Gently invert the tube 10 times to mix, mark the group information, and let it stand for 10 minutes. Centrifuge at 4°C, 12,000 rcf for 10 minutes, discard the supernatant, and retain the RNA precipitate.

[0057] (4) RNA washing: Add 1 mL of pre-cooled 75% ethanol, vortex, centrifuge at 4°C, 12000 rcf for 5 min, and discard the supernatant. Add 1 mL of pre-cooled anhydrous ethanol, vortex, centrifuge at 4°C, 12000 rcf for 5 min, and discard the supernatant.

[0058] (5) RNA dissolution: Place the EP tube containing the cell pellet upside down on filter paper, air dry for 10 min, add 15 μL of enzyme-free water, mix well, and store in a refrigerator at -80°C for later use.

[0059] (6) RNA detection: Take 1.8 μL of dissolved RNA sample and use 1.8 μL of enzyme-free water as blank control to detect RNA concentration and quality. 260 / OD 280 A value between 1.8 and 2.0 indicates that the RNA quality is qualified. The closer to 2.0, the better the quality. A value below 1.8 indicates that the quality is unqualified and the sample is discarded.

[0060] Example 2 Transcriptome Sequencing and Bioinformatics Analysis

[0061] 1. Experimental Methods

[0062] 1. Experimental Design and Sample Preparation

[0063] The RNA extracted in Example 1 (subacute poisoning (acute) group and control group) was subjected to transcriptome sequencing, and the sequencing results were provided by Beijing Biomarker Biotechnology Co., Ltd.

[0064] 2. RNA-seq data sequencing

[0065] The extracted total RNA must undergo quality control and library construction before high-throughput sequencing can be performed. RNA-seq is performed using a sequencing platform to generate raw sequence data. The sequenced data is stored in FASTQ format, which contains sequence information and corresponding quality information. Ensure that the data obtained by sequencing is of high quality and has sufficient coverage, providing a reliable data basis for the subsequent analysis stage.

[0066] 3. Quality Assessment

[0067] Use FastQC (v0.11.9) software to perform quality assessment on each FASTQ file and produce a detailed quality assessment report. The report will contain multiple key indicators, such as sequence quality distribution, adapter contamination, and GC content distribution, which will help identify potential problems. The red, yellow, and green icons in the report can quickly determine whether each indicator is qualified. When all indicators are green (indicating qualified), you can enter the next stage of data analysis; conversely, if any indicator is unqualified, you need to make necessary corrections to the FASTQ file or eliminate samples that have not passed quality control.

[0068] 4. Data Preprocessing

[0069] Trimmomatic (v0.39) was used to preprocess the FASTQ files that passed the quality assessment. This step includes identifying and cutting the adapter sequence to ensure that the adapter does not interfere with the sequence alignment. At the same time, it is also necessary to set reasonable quality values ​​and length filtering standards to filter out low-quality or shorter reads than the threshold, ensuring that the data used in subsequent analysis is more accurate and reliable.

[0070] 5. Sequence Alignment

[0071] The processed FASTQ format reads were aligned with the human reference genome (GRCh38) using STAR (v2.7.8a) software. STAR is fast and efficient, capable of processing large amounts of data in a short time while ensuring the accuracy of the alignment results. The alignment results will be output in BAM format, laying a solid foundation for subsequent fusion transcript analysis.

[0072] 6. Fusion transcript prediction

[0073] Next, STAR-Fusion (v1.10.0) was used to analyze the alignment results generated by STAR and predict possible fusion transcripts. This step aims to identify any gene rearrangements that may be caused by exposure to exogenous chemicals, and the generated data will help in the subsequent analysis of malignant transformation.

[0074] 7. Carcinogenicity Analysis

[0075] After obtaining the fusion transcripts, DEEPrior software was used to conduct in-depth analysis of the results generated by STAR-Fusion. The software helps evaluate the potential carcinogenicity of each fusion gene by calculating the probability of each fusion transcript undergoing oncogenic mutations or activating oncogenic pathways, providing a scientific basis for understanding the role of exogenous chemicals in the carcinogenic process.

[0076] 8. Data integration and screening

[0077] After completing the carcinogenicity analysis, the “ComplexUpset” package in R language was used to perform intersection analysis on all analysis results. This step integrates the results of various experiments, screens out specific fusion genes related to exogenous chemicals, and further focuses on finding targets with the potential to become biomarkers.

[0078] 2. Experimental Results

[0079] A total of 22 chimeric RNAs were identified and screened by STAR-Fusion. Based on the difference in chimeric RNA expression levels between the control group (DMSO poisoning) and the experimental group (subacute poisoning (acute) group), TVP23C-CDRT4 was screened out.

[0080] Example 3 Fusion gene verification

[0081] 1. Experimental Methods

[0082] 1. Reverse Transcription

[0083] Using GoScript TM Reverse Transcription System kit, reverse transcribe the RNA extracted in Example 1 into cDNA. Prepare the first step reaction mixture: add 8 μL RNA sample, 1 μL Oligo (dT) Primer and 1 μL Random Primer to a 200 μL EP tube and mix well. Use a multi-functional gradient thermal cycler to denature at 70°C for 5 minutes, and place in a refrigerator at 4°C for 5 minutes.

[0084] Prepare the second step reaction mixture: 0.5μL Recombinant Rnasin RibonucleaseInhibitor, 1μL PCR Nucleotide Mix (10mmol / L), 1μL GoScriptTM ReverseTranscriptase, 2μL MgCl2 (25mmol / L), 4μL GoScriptTM 5×Reaction Buffer and 1.5μL Nuclease-Free Water were mixed evenly. 10μL of the mixture was added to the denatured mixture, and a multifunctional gradient thermal cycler was used at 25℃ for 5min; 42℃ for 60min; 70℃ for 15min; and cooled at 4℃. The sample cDNA was stored in a refrigerator at -20℃.

[0085] 2. Conventional PCR

[0086] use The qPCR Master Mix kit was used to verify the presence of chimeric RNA. The reaction system was configured as follows: 7.2 μL of enzyme-free water, 0.4 μL of forward primer (10 μmol / L), 0.4 μL of reverse primer (10 μmol / L), and 10 μL of qPCR Master Mix, and 2μL sample cDNA were mixed evenly. The EP tube was placed in a multifunctional gradient thermal cycler, and reverse transcription was performed at 50°C for 10min (1 cycle), and pre-denaturation was performed at 95°C for 2min (1 cycle); 95°C, 15s later, the mixture was converted to 60°C for 1min, and then 72°C for 1min (40 cycles) for thermal cycling, and finally 72°C for 10min for amplification. The primers for TVP23C-CDRT4 are as follows:

[0087] Forward primer (5'-3'): ACTGTGTCAGAGGCTGAATCAAGAA

[0088] Reverse primer (5'-3'): CACAGGTTCAGATTCCAGCCACTT

[0089] 3. Agarose gel electrophoresis and Sanger sequencing

[0090] Use an electronic balance to weigh 2.0g of normal melting point agarose powder, add 100mL 1×TBE electrophoresis buffer, place in a microwave oven and heat for 90s. The agarose powder is completely dissolved and boiled, then take it out, add 100μL of NA-Red dye and mix well. Pour it into the mold, suck out the bubbles with a 100uL gun, insert the comb, and wait for 30min at room temperature. After pulling out the comb, put the gel into the horizontal electrophoresis tank, put the hole end on the black pole, and add 1×TBE electrophoresis buffer. Mix 4μL 6×DNA loading buffer and 20μL RT-PCR product and add them to the hole, and add 10μL 50bp Ladder DNA Marker on both sides. Electrophoresis at a constant voltage of 100V for 50min, place the gel on the UV Tray ultraviolet excitation plate, and take pictures in the fully automatic dye-free gel imaging system. The length of the chimeric RNA fragment was confirmed by agarose gel electrophoresis, and the unpurified PCR product and the chimeric RNA forward and reverse primers were handed over to Sangon Biotech (Shanghai) Co., Ltd., which completed the Sanger sequencing.

[0091] 4. Quantitative reverse transcript-polymerase chain reaction (qRT-PCR)

[0092] use The qPCR Master Mix kit was used for the experiment. The 20 μL reaction system was configured as follows: 7 μL enzyme-free water, 0.2 μL C×R, 0.4 μL Forward primer (10 μmol / L), 0.4 μL Reverse primer (10 μmol / L), 10 μL qPCR Master Mix, and 2 μL sample cDNA were mixed evenly. The eight tubes were placed in the PCR instrument and pre-denatured at 95°C for 10 min (1 cycle); 95°C, 15 s later, converted to 60±3°C for 1 min (40 cycles) for amplification, and entered the melting curve stage. -ΔΔCt The differential expression fold was calculated based on the GAPDH internal reference gene, ΔCt = Ct target gene - Ct internal reference gene, ΔΔCt = ΔCt experimental group - ΔCt control group. The differential expression fold of the target gene in the experimental group compared with the control group = 2 -ΔΔCt The gene primers were synthesized by Guangzhou Aiji Biotechnology Co., Ltd. and the primers were designed as follows:

[0093] GAPDH:

[0094] Forward primer (5'-3'): ACAGTCAGCCGCATCTTCTT

[0095] Reverse primer (5'-3'): GACTCCGACCTTCACCTTCC

[0096] TVP23C-CDRT4:

[0097] Forward primer (5'-3'): ACTGTGTCAGAGGCTGAATCAAGAA

[0098] Reverse primer (5'-3'): CACAGGTTCAGATTCCAGCCACTT

[0099] 2. Experimental Results

[0100] 1. Agar gel electrophoresis test results are as follows Figure 1 As shown in Figure 2, TVP23C-CDRT4 has specific bands in both the subacute benzo[g, h, i]perylene poisoning and malignant transformation cell models; the Sanger sequencing results are shown in Figure 2. Figure 2 As shown, it is shown that TVP23C-CDRT4 is formed by the fusion of parental genes TVP23C and CDRT4, wherein the schematic diagram of TVP23C-CDRT4 is shown in Figure 3 shown.

[0101] 2. Analysis of TVP23C-CDRT4 expression levels

[0102] (1) The expression level of TVP23C-CDRT4 in subacute (acute) cell models Figure 4 As shown, in the in vitro subacute poisoning cell model of benzo[g,h,i]perylene, the expression level of TVP23C-CDRT4 in the benzo[g,h,i]perylene group was significantly reduced compared with the Control group.

[0103] (2) The expression level of TVP23C-CDRT4 in the malignant transformation (chronic) cell model Figure 5 As shown, in the benzo[g,h,i]perylene malignant transformation cell model, compared with the control group, with the increase of the generation number (degree) of benzo[g,h,i]perylene poisoning, the expression level of TVP23C-CDRT4 was significantly and gradually decreased.

[0104] Example 4 Effects of benzo[g,h,i]perylene exposure on TVP23C-CDRT4 in mice

[0105] 1. Experimental Methods

[0106] 1. Experimental animals and groups

[0107] Sixteen 3-4 week old SPF grade BALB / c mice, half male and half female, were purchased and quarantined to adapt to the environment for one week. They were randomly divided into a control group and a benzo[g,h,i]perylene poisoning group, with 4 males and 4 females in each group.

[0108] 2. Setting of exposure conditions

[0109] According to the conversion formula for internal and external exposure doses in respiratory toxicology and the description of the toxic concentration for the subacute toxic cell model in Example 1, 500 μg / m 3 As the concentration for mice to be exposed to. The mice were in good condition after adapting to this concentration for one week, so this concentration was selected as the final exposure concentration, and a DMSO solvent control group was set up. At the same time, the exposure conditions for in vivo subacute inhalation toxicity experiments were set with reference to international standards and guidelines (OECD TG 412), and the exposure time and frequency were set to 28 days, 6h / day, and 7d / week. The growth status of the mice was also observed during the exposure period.

[0110] 3. Collection of mouse lung tissue and extraction of total RNA from lung tissue

[0111] After the exposure, the mice were killed by cervical dislocation and the mouse lung tissues were collected and stored at -80°C for future use. About 20 mg of lung tissue was added with 1 mL of Trizol solution and fully ground by a tissue grinder. The subsequent extraction of total RNA from mouse lung tissue was consistent with the extraction method of total cell RNA in Example 1.

[0112] 4. Detection of TVP23C-CDRT4 expression level in mouse lung tissue

[0113] After total RNA was extracted from the lung tissue of the mouse model, reverse transcription and qRT-PCR experiments were performed according to the experimental method in Example 3 to detect the expression level of TVP23C-CDRT4.

[0114] 2. Experimental Results

[0115] The expression level of TVP23C-CDRT4 in mouse models Figure 6 As shown, the expression level of TVP23C-CDRT4 was significantly decreased in benzo[g,h,i]perylene-exposed mice compared with the Control group.

[0116] Example 5 Functional analysis of TVP23C-CDRT4

[0117] 1. Experimental Methods

[0118] 1. Construction and transfection method of TVP23C-CDRT4 overexpression vector

[0119] The virus was placed in a beaker and dissolved in an ice bath overnight. According to the instructions, the MOI was set to 200, and a blank control group (Control) was set up in which cells were cultured with only complete medium; a negative control group (Vector) was added with negative vector virus solution, complete medium and 4 μg / mL puromycin; an overexpression TVP23C-CDRT4 group (OE-TC) was added with overexpression target virus solution, complete medium and 4 μg / mL puromycin, and two replicates were repeated for each well.

[0120] 40,000 cells / well (human lung bronchial epithelial cells BEAS-2B) were inoculated in a 24-well plate and placed in a constant temperature incubator for 24 hours for virus infection. The virus volume was calculated according to the virus titer, and the virus volume = (MOI × number of cells) / virus titer. 20 μL of HiTransG P solution and the calculated virus volume were added to a 1.5 mL EP tube, and complete culture medium was added to make the final volume 500 μL and mixed evenly. The 24-well plate was removed, the complete culture medium was discarded, and the virus infection solution was added after washing twice with PBS buffer. After 24 hours of infection, the culture medium was discarded, and complete culture medium was added for 24 hours. Puromycin at a concentration of 4 μg / mL was added, and the cells were cultured continuously for 2 weeks. GFP fluorescence was observed under a microscope, and the infection effect was detected using qRT-PCR experiments. The vector was constructed by Shanghai JiKai Gene Co., Ltd.

[0121] 2. Construction and transfection methods of TVP23C-CDRT4 knockdown vector

[0122] 200,000 cells were inoculated into each well of a 6-well plate and the cells (TVP23C-CDRT4 overexpressing OE-TC obtained in step 1) were treated with toxins according to the experimental design for transfection experiments. Si-1 group, Si-2 group, Si-3 group, negative control siRNA (Negative control, NC group) and Control group were set up. 2 mL Reduced serum medium was added to the control group, and 245 μL of Reduced serum medium was added, 5 μL of siRNA of the corresponding group was mixed evenly and incubated for 5 min. Reduced serum medium and LipofectamineTM2000 diluent were mixed at a ratio of 50:1, blown evenly, and then 250 μL was pipetted into the EP tube and incubated at room temperature for 25 min. 500 μL of the mixed solution was added to a 6-well plate, and the plate was cultured in a constant temperature incubator for 24 h, then replaced with complete medium and continued to be cultured for 24 h. Guangzhou Ruibo Biotechnology Co., Ltd. provides siRNA kits.

[0123] si-h-TVP23C-CDRT4_001:GTGGCTGGAATCTGAACCT;

[0124] si-h-TVP23C-CDRT4_002:ACAGTAAAGTGGCTGGAAT;

[0125] si-h-TVP23C-CDRT4_003: AGTAAAGTGGCTGGAATCT.

[0126] 3. Comet assay

[0127] After cleaning the slide, prepare the first layer of gel, place it on a slide rack and store it in a 4°C refrigerator for later use. Mix the cell suspension and agarose gel to prepare the second layer of gel, immerse the slide in the cell lysis solution to lyse the cells, put it in the electrophoresis tank for unwinding after lysis, and perform electrophoresis after unwinding. After the electrophoresis is completed, use NA-Red for staining, use a fluorescent microscope to take cell images under a 10x microscope, and use CSAP analysis software to analyze DNA damage indicators including comet Olive tail moment, comet tail length, and comet tail DNA content percentage (TailDNA%).

[0128] 2. Experimental Results

[0129] 1. The results of overexpression of TVP23C-CDRT4 are as follows Figure 7As shown, both the vector control Vector and the chRNATVP23C-CDRT4 overexpression group (OE-TC) expressed green fluorescence, and the expression level of TVP23C-CDRT4 in the OE-TC group was significantly higher than that in the Control and Vector groups, and the TVP23C-CDRT4 overexpression cell line was successfully constructed.

[0130] 2. Comet assay results after overexpression of TVP23C-CDRT4 Figure 8 As shown, the percentage of DNA content in the comet tail, the length of the comet tail and the distance of the comet Olive tail in the OE-TC group were significantly lower than those in the Control and Vector groups. After overexpression of TVP23C-CDRT4, DNA double-strand breaks were reduced and DNA damage was reduced.

[0131] 3. Comet assay results after knocking down TVP23C-CDRT4 in overexpressed TVP23C-CDRT4 Fig. 9 As shown, there was no statistical difference in the percentage of DNA content in the comet tail, the length of the comet tail and the distance of the comet Olive tail between the OE-TC+Si-TC group and the Control group, indicating that TVP23C-CDRT4 is involved in the DNA damage process caused by benzo[g,h,i]perylene exposure.

[0132] Therefore, the fusion gene TVP23C-CDRT4 can also serve as a therapeutic target for cell damage caused by benzo[g,h,i]perylene exposure.

Claims

1. Use of the fusion gene TVP23C-CDRT4 as a biomarker of exposure to an exogenous chemical benzo[g,h,i]perylene in assessing the risk of exposure of cells or organisms to a benzo[g,h,i]perylene environment or the risk of malignant transformation caused by benzo[g,h,i]perylene exposure, characterized in that: The nucleotide sequence of TVP23C-CDRT4 is shown in SEQ ID No.

1.

2. Use of a reagent for detecting the expression level of the fusion gene TVP23C-CDRT4 in the preparation of a product for assessing the exposure risk of cells or organisms in a benzo[g,h,i]perylene environment or the risk of malignant transformation caused by benzo[g,h,i]perylene exposure, characterized in that: The nucleotide sequence of TVP23C-CDRT4 is shown in SEQ ID No.

1.

3. The application according to claim 2, characterized in that: The reagent for detecting the expression level of the fusion gene TVP23C-CDRT4 is a real-time fluorescence quantitative PCR primer, and the nucleotide sequences thereof are shown in SEQ ID No. 2-3.

4. The application according to claim 2, characterized in that: The expression level of the fusion gene TVP23C-CDRT4 is detected to evaluate the degree of toxicity of cells or organisms exposed to benzo[g,h,i]perylene.

5. Use of an agent that promotes overexpression of the fusion gene TVP23C-CDRT4 or a highly specific fragment thereof in the preparation of a product for alleviating cell damage caused by exposure to benzo[g,h,i]perylene, characterized in that: The nucleotide sequence of TVP23C-CDRT4 is shown in SEQ ID No.

1.

6. The use according to claim 5, characterized in that: The nucleotide sequence of the high-specificity fragment of the fusion gene TVP23C-CDRT4 is shown in SEQ ID No.

7.

7. The use according to claim 5, characterized in that: The cell damage is intracellular DNA breakage.

8. Use of an agent for inhibiting the expression level of the fusion gene TVP23C-CDRT4 in preparing a malignant transformation cell model caused by an exogenous compound benzo[g,h,i]perylene, characterized in that: The nucleotide sequence of the TVP23C-CDRT4 is shown in SEQ ID No.

1.

9. The use according to claim 8, characterized in that: The reagent for inhibiting the expression level of the fusion gene TVP23C-CDRT4 is siRNA, and the nucleotide sequences thereof are shown in SEQ ID No. 4-6 in sequence.

10. The use according to any one of claims 2 or 5, characterized in that: The product is a test kit or a test paper.

Images