Broiler liquid chip based on targeted capture sequencing and application thereof
By designing a 50K liquid phase chip for broilers, the problem of the lack of high-efficiency liquid phase chips in broiler breeding has been solved, enabling high-coverage and functionally relevant genome analysis, supporting broiler breeding and kinship identification, and promoting the development of the broiler industry.
Patent Information
- Application Number
- CN202411896005.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-20
- Publication Date
- 2026-02-06
- Estimated Expiration
- 2044-12-20
AI Technical Summary
The lack of liquid-phase chips for whole-genome selection breeding of broilers has affected the accuracy and efficiency of broiler breeding.
A 50K liquid phase chip for broilers was designed, containing 42,417 SNP sites located on chicken reference genome version 6.0. Through genome-wide association analysis, candidate gene databases, and whole-genome resequencing data screening, SNP sites related to economic traits of broilers were covered. Combined with probe design, high coverage and functional relevance were achieved.
It improves the accuracy and breeding efficiency of broiler genome genetic assessment, enables specific identification of kinship, conducts whole-genome selection breeding and trait analysis, and supports the rapid development of the broiler industry.
Smart Images

Figure CN119736404B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular biology technology, and in particular to a broiler liquid phase chip based on targeted capture sequencing and its application. Background Technology
[0002] SNPs refer to polymorphisms in nucleic acid sequences caused by changes in a single nucleotide base at the genomic level. These variations include transitions, transversions, deletions, and insertions, and are characterized by their large number, wide distribution, and ease of detection. As genetic marker molecules, SNPs contribute to the genetic variation of qualitative traits, economic traits, and some complex disease traits, and are therefore widely used in genetic research.
[0003] Commonly used SNP genotyping techniques can be divided into solid-phase microarrays and liquid-phase microarrays. Traditional solid-phase microarrays are based on fluorescence detection, reacting according to the intensity of fluorescence. Because the reaction sites are fixed and used on a per-plate basis, the development cost is high. Liquid-phase microarrays, based on DNA capture followed by sequencing, can simultaneously quantify multiple different target molecules in the same sample. This not only offers higher accuracy but also more flexible site design and lower cost compared to solid-phase microarrays. They can be applied to various aspects of molecular genetic research and molecular-assisted breeding, providing support for upstream and downstream breeding processes, including germplasm genetic diversity analysis, phylogenetic analysis, genome-wide association studies, quantitative trait (QTL) mapping analysis, and selective evolution studies. A particularly important application is in genomic selection breeding. Genome-wide selection is a major breeding technique in livestock and poultry breeding. It utilizes whole-genome markers to estimate all possible genetic effects, explain all genetic variations, and predict genome-wide breeding values by statistically analyzing the genetic effects of markers. It has advantages such as high accuracy in estimating breeding values and rapid genetic progress, and has been applied to the breeding of commercial breeds of dairy cattle, pigs, and high-yielding laying hens abroad. However, a liquid-phase microarray for genome-wide selection breeding in broilers is currently lacking. Summary of the Invention
[0004] To address the aforementioned issues, this invention provides a broiler liquid phase chip based on targeted capture sequencing and its applications. The 50K broiler liquid phase chip prepared using the SNP molecular marker combination provided by this invention can specifically identify the phylogenetic relationship between commercial broilers and local broiler breeds. It can also be used for genome-wide association analysis, genome-wide selection breeding, QTL mapping analysis of target traits, and population genetics analysis, which can help accelerate the rapid development of the broiler industry and has significant economic, practical, and scientific research value.
[0005] To achieve the above objectives, the present invention provides the following technical solution:
[0006] This invention provides a combinatorial array of SNP molecular markers for the entire broiler genome, including 42,417 SNP loci located on chicken reference genome version 6.0. The location information of the SNP loci is shown in Table 1.
[0007] Table 1 SNP molecular marker combinations
[0008]
[0009]
[0010]
[0011]
[0012]
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
[0098]
[0099]
[0100]
[0101]
[0102]
[0103]
[0104]
[0105]
[0106]
[0107]
[0108]
[0109]
[0110]
[0111]
[0112]
[0113]
[0114]
[0115]
[0116]
[0117]
[0118]
[0119]
[0120]
[0121]
[0122]
[0123]
[0124]
[0125]
[0126]
[0127]
[0128]
[0129]
[0130]
[0131]
[0132]
[0133]
[0134]
[0135]
[0136]
[0137]
[0138]
[0139]
[0140]
[0141]
[0142]
[0143]
[0144]
[0145]
[0146]
[0147]
[0148]
[0149]
[0150]
[0151]
[0152]
[0153]
[0154]
[0155]
[0156]
[0157]
[0158]
[0159]
[0160]
[0161]
[0162]
[0163]
[0164]
[0165]
[0166]
[0167]
[0168]
[0169]
[0170]
[0171]
[0172]
[0173]
[0174]
[0175]
[0176] Wherein, Ref represents the reference genome base, Alt represents the mutated base, and the position is the physical location of the Ref or Alt base on the corresponding chromosome; "-" indicates a deletion mutation; NO.1 is the nucleotide sequence as shown in SEQ ID NO.1, NO.2 is the nucleotide sequence as shown in SEQ ID NO.2, NO.3 is the nucleotide sequence as shown in SEQ ID NO.3, NO.4 is the nucleotide sequence as shown in SEQ ID NO.4, NO.5 is the nucleotide sequence as shown in SEQ ID NO.5, and NO.6 is the nucleotide sequence as shown in SEQ ID NO.6, as detailed below:
[0177] SEQ ID NO.1: 5'-GCCAGGCAAGGACAGCCAGGCCTGTCCAGGCAAGGCTAGGCAAGGCAA GGCCAGGAAAGGCAAAGGAAGGACATGCAAGGCAAGGGCAGGCAAGGCAAGGCCAGGCCAG TCCAGGCC-3';
[0178] SEQ ID NO.2: 5'-GCCAGGCAAGGACAGCCAGGCCTGTCCAGGCAAGGCTAGGCAAGGCAA GGCCAGGAAAGGCAAAGGAAGGACATGCAAGGCAAGGGCAGGCAAGGCAAGGCCAGGCCAG TCCAGGCC-3';
[0179] SEQ ID NO.3: 5'-ATAAGTAATAAGTTT-3'; SEQ ID NO.4: 5'-ATAAGTAATAAGTTT-3';
[0180] SEQ ID NO.5: 5'-AGTGATTCCC-3'; SEQ ID NO.6: 5'-AGTGATTCCC-3';
[0181] SEQ ID NO.7: 5'-CTTCCCGCTCA-3'; SEQ ID NO.8: 5'-CTTCCCGCTCA-3'.
[0182] This invention provides a 50K liquid phase chip for broilers, wherein the genotyping sites of the 50K liquid phase chip for broilers include 42,417 SNP sites located on the chicken reference genome version 6.0, and the SNP sites are the 42,417 SNP sites in the SNP molecular marker combination described in the above technical solution.
[0183] Preferably, the 50K liquid phase chip for broilers also includes probes designed based on gene sequences covering the SNP sites.
[0184] This invention provides a way to associate the SNP molecular marker combination or the 50K liquid phase chip for broilers described in the above technical solutions with the economic traits of broilers; the economic traits of broilers include one or more of the following: broiler weight, carcass percentage, breast muscle percentage, leg muscle percentage, abdominal fat percentage, intramuscular fat content of breast muscle, post-slaughter muscle pH, meat color and IgY antibody titer.
[0185] This invention provides the application of the SNP molecular marker combination described in the above technical solution or the broiler 50K liquid phase chip described in the above technical solution in broiler targeted capture sequencing.
[0186] This invention provides the application of the SNP molecular marker combination described in the above technical solution or the 50K liquid phase chip for broilers described in the above technical solution in one or more of 1) to 4): 1) broiler breed identification; 2) broiler breeding; 3) broiler germplasm resource improvement; 4) broiler population genetic diversity analysis; 5) broiler target trait QTL mapping analysis; 6) broiler associated loci and candidate gene identification.
[0187] Preferably, the 1) identification of broiler breeds includes: identification of the kinship between commercial broilers and local broiler breeds.
[0188] Preferably, 2) broiler breeding includes whole-genome selection breeding.
[0189] Beneficial effects:
[0190] This invention provides SNP molecular marker combinations containing five categories of SNP loci: the first category comprises 977 significant loci identified through genome-wide association analysis (GWAS) techniques and associated with important economic traits in laying hens (egg production performance, egg quality, feed efficiency, etc.); the second category comprises 9083 SNP loci identified in existing literature and QTL databases and associated with economic traits in broilers; the third category comprises SNP loci selected from public databases related to 28-day-old body weight, 42-day-old body weight, carcass percentage, breast muscle percentage, leg muscle percentage, abdominal fat percentage, breast muscle intramuscular fat content, and slaughter weight. The first category comprises 9654 functional SNPs related to important traits such as hind muscle pH, meat color, and IgY antibody titer; the second category comprises 13345 background backbone sites suitable for liquid-phase microarrays selected based on whole-genome resequencing data of broiler populations; and the third category comprises 9358 SNP sites supplementing the areas not covered by the previous categories from the SNPdatabase (ftp: / / ftp.ncbi.nlm.nih.gov / snp / organisms / archive / chicken_9031 / ).
[0191] The 50K liquid-phase microarray for broilers prepared using the SNP molecular marker combination provided by this invention has the following advantages: 1) Optimized design: The microarray is evenly distributed across all chromosomes of the whole genome, with high coverage, ensuring the accuracy of broiler genome genetic assessment; 2) Functional relevance: The microarray collects significant loci related to traits such as broiler production performance, disease resistance, and feed utilization efficiency, increasing the practicality of the microarray; 3) Applicability: The microarray loci are derived from SNPs with high polymorphism in commercially bred high-yielding egg-laying chicken breeds selected independently and local breeds in my country, meeting both the research needs of researchers and the needs of egg-laying chicken companies for whole-genome molecular breeding; 4) Flexibility: Liquid-phase microarray technology has significant advantages in terms of analysis speed, sensitivity, and throughput. Attached Figure Description
[0192] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly described below.
[0193] Figure 1 This diagram shows the distribution of the broiler liquid phase chip in the chicken genome according to the present invention; where the horizontal axis is 39, 78, 118, 157, 197200 Mb, and the vertical axis, from top to bottom, represents chr1, chr2, chr3, chr4, chr5, chr6, chr7, chr8, chr9, chr10, chr11, chr12, chr13, chr14, chr15, chr16, chr17, chr18, chr19, chr20, chr21, chr22, chr23, chr24, chr25, chr26, chr27, chr28, chr30, chr31, chr32, chr33, chrW, and chrZ;
[0194] Figure 2 This refers to the number of SNP sites on each chromosome of the broiler liquid phase chip in this invention.
[0195] Figure 3 Violin plot of individual detection rates for two batches of samples;
[0196] Figure 4 Manhattan plot of body weight traits at 42 days of age. Detailed Implementation
[0197] This invention provides a combinatorial set of SNP molecular markers for the whole broiler genome, including 42,417 SNP sites located on chicken reference genome version 6.0 (Gallus_gallus-6.0), and the location information of the SNP sites is shown in Table 1.
[0198] This invention provides SNP molecular marker combinations containing five categories of SNP loci: the first category comprises 977 significant loci identified through genome-wide association analysis (GWAS) techniques and associated with important economic traits in laying hens (egg production performance, egg quality, feed efficiency, etc.); the second category comprises 9083 SNP loci identified in existing literature and QTL databases and associated with economic traits in broilers; the third category comprises SNP loci selected from public databases related to 28-day-old body weight, 42-day-old body weight, carcass percentage, breast muscle percentage, leg muscle percentage, abdominal fat percentage, breast muscle intramuscular fat content, and slaughter weight. The first category comprises 9654 functional SNPs related to important traits such as hind muscle pH, meat color, and IgY antibody titer; the second category comprises 13345 background backbone sites suitable for liquid-phase microarrays selected based on whole-genome resequencing data of broiler populations; and the third category comprises 9358 SNP sites supplementing the areas not covered by the previous categories from the SNPdatabase (ftp: / / ftp.ncbi.nlm.nih.gov / snp / organisms / archive / chicken_9031 / ).
[0199] This invention provides a 50K liquid phase chip for broilers, wherein the genotyping sites of the 50K liquid phase chip for broilers include 42,417 SNP sites located on the chicken reference genome version 6.0, and the SNP sites are the 42,417 SNP sites in the SNP molecular marker combination described in the above technical solution.
[0200] As one implementation, the 50K liquid phase chip for broilers also includes probes designed based on gene sequences covering the SNP sites.
[0201] The 50K liquid phase chip for broilers prepared using the SNP molecular marker combination provided by this invention can specifically identify the kinship between commercial broilers and local broiler breeds. It can be used to evaluate the germplasm resources of broiler breeds from China and abroad, and can also be used for genome-wide association analysis, genome-wide selection breeding, QTL mapping analysis of target traits, and population genetic analysis. It can help accelerate the rapid development of the broiler industry and has great economic and scientific research value.
[0202] This invention provides a way to associate the SNP molecular marker combination or the 50K liquid phase chip for broilers described in the above technical solutions with the economic traits of broilers; the economic traits of broilers include one or more of the following: broiler weight, carcass percentage, breast muscle percentage, leg muscle percentage, abdominal fat percentage, intramuscular fat content of breast muscle, post-slaughter muscle pH, meat color and IgY antibody titer.
[0203] Based on the above advantages, the present invention provides the application of the SNP molecular marker combination described in the above technical solution or the broiler 50K liquid phase chip described in the above technical solution in broiler targeted capture sequencing.
[0204] Based on the above advantages, the present invention provides the application of the SNP molecular marker combination described in the above technical solution or the 50K liquid phase chip for broilers described in the above technical solution in one or more of 1) to 6): 1) broiler breed identification; 2) broiler breeding; 3) broiler germplasm resource improvement; 4) broiler population genetic diversity analysis; 5) broiler target trait QTL mapping analysis; 6) broiler associated loci and candidate gene identification.
[0205] In one implementation, 1) broiler breed identification includes: identifying the kinship between commercial broilers and local broiler breeds. In another implementation, 2) broiler breeding includes whole-genome selection breeding.
[0206] To further illustrate the present invention, the following detailed description, in conjunction with the accompanying drawings and embodiments, provides a broiler liquid phase chip based on targeted capture sequencing and its applications, but these descriptions should not be construed as limiting the scope of protection of the present invention.
[0207] Example 1: Preparation of 50K liquid phase chip for broilers
[0208] The first type of probes obtained in this invention were screened based on the applicant's previous genome-wide association studies (GWAS) of important economic traits in laying hens. These probes consist of two parts: the first part involved GWAS analysis of egg production performance (number of eggs and egg weight) and egg quality using 385 Leghorn hens and 361 Dwarf hens from 40 families, respectively; the second part involved GWAS analysis of egg production performance, feed utilization efficiency, egg quality, and reproductive performance of 1,512 F2 generation hens obtained from reciprocal crosses of Leghorn and Dongxiang Green-shelled chickens. The SNP loci associated with important economic traits in laying hens obtained above were then analyzed using biostatistical methods to remove duplicates, resulting in 977 functional loci that were added to the microarray.
[0209] The second type of probe in this invention was obtained by searching for candidate genes related to broiler growth traits in published literature and the online QTL database (https: / / www.animalgenome.org / cgi-bin / QTLdb / GG / index) to obtain QTLs related to economic traits in broilers. QTLs with large confidence intervals and insignificant P values (P>0.05) were removed, resulting in 1500 candidate QTL intervals. Then, the intersection of SNPs obtained from whole-genome resequencing data with candidate genes and QTLs was used to screen out 9083 SNPs as candidate sites related to traits.
[0210] The third type of probe in this invention was obtained by searching the chicken SNP database of NCBI (https: / / www.ncbi.nlm.nih.gov / snp) for functional SNP sites related to important traits such as 28-day-old body weight, 42-day-old body weight, carcass percentage, breast muscle percentage, leg muscle percentage, abdominal fat percentage, intramuscular fat content of breast muscle, post-slaughter muscle pH, meat color, and IgY antibody titer. Finally, 9654 SNPs were selected to supplement the chip.
[0211] The fourth type of probe obtained in this invention: Whole genome resequencing was performed on a commercially available broiler breed independently bred in China by Beijing Huadu Yukou Poultry Industry Co., Ltd., and SNP sites with a minimum allele frequency of less than 0.05 (MAF<0.05) in each breed were removed, and 13,345 background backbone sites suitable for use in liquid phase chips were selected.
[0212] The fifth type of probe obtained in this invention is obtained by supplementing the regions that were not covered by the previous types of probes across the whole genome from the SNP database (ftp: / / ftp.ncbi.nlm.nih.gov / snp / organisms / archive / chicken_9031 / ).
[0213] SNP locus identification process: Considering the large size differences among different chromosome segments in chickens and the inconsistent recombination rates of mutation sites on different chromosomes, the first step is to use Plink software to detect the linkage disequilibrium (LD) level on each chromosome, thereby setting the optimal window / interval size for each chromosome (window size set to 100bp). These windows / intervals are used to ensure that SNPs are evenly distributed on each chromosome. For each interval, one SNP probe of the first category, which is common to all strains, is selected first. If there is less than one, the SNP from the second category of probes is selected. The third category of probes are SNPs that are forcibly placed in the chip. If the first and second categories of probes still cannot cover the window, the SNP from the fourth category of probes is selected. The fifth category of probes is used to supplement the intervals that cannot be covered by the above categories of probes.
[0214] The identified SNP loci were submitted to Shijiazhuang Borui Biotechnology Co., Ltd., where they were scored using the company's scoring system. Loci with scores <0.8 were removed. For the deleted unqualified SNP loci, the nearest SNP loci were selected as replacements, and the scoring was repeated. Following the above steps for identification and screening, a total of 42,417 SNP loci were obtained. The location information of these SNP loci is shown in Table 1.
[0215] Based on the locations of the aforementioned 42,417 SNP loci, Shijiazhuang Borui Biotechnology Co., Ltd. was commissioned to prepare a 50K liquid-phase chip covering these 42,417 SNP loci. The distribution of the SNP loci on the 50K liquid-phase chip in the chicken genome is shown in [see figure]. Figure 1 The number of SNP sites on each chromosome of the whole genome is shown in the figure. Figure 2 .
[0216] Figure 3 To test the detection rate of the chip sites, two batches of broiler chickens were tested separately (D1 and D2). In the first batch of 5902 samples and the second batch of 3064 samples, the average detection rate of the chip was 99.96%. This proves that the liquid phase chip has a high detection rate and strong applicability in practical use.
[0217] Table 2. Average distances of the 50K liquid-phase chip sites of this invention on each chromosome.
[0218] chromosome Average distance between adjacent sites (kb) chromosome Average distance between adjacent sites (kb) 1 24.1585 18 22.7019 2 24.411 19 20.856 3 23.1357 20 19.6022 4 22.4537 21 20.373 5 23.6036 22 29.196 6 22.8208 23 20.2299 7 23.6599 24 20.7397 8 24.3519 25 34.3166 9 22.3236 26 22.5969 10 22.35 27 32.194 11 23.3267 28 22.3455 12 20.8682 30 69.9442 13 22.2104 31 146.502 14 22.9745 32 45.3654 15 21.4849 33 62.0777 16 91.7623 Z 55.2419 17 21.4831 / /
[0219] As shown in Table 2, the 50K liquid phase chip provided by the present invention can make SNP sites evenly distributed on all chromosomes.
[0220] Example 2: Application of the 50K liquid phase chip for broilers in genome-wide association analysis.
[0221] Genotyping of 460 White Locker chickens provided by Beijing Huadu Yukou Poultry Co., Ltd. was performed using the 50K liquid phase chip for broilers provided in this invention. Pre-slaughter body weight (BW) phenotypic data of these roosters at 42 days of age were also collected. The quality control criteria for SNP genotyping were: sample call rate > 95% and MAF > 0.01. After quality control, 421 individuals and 41207 SNPs remained for subsequent genome-wide association studies (GWAS). A linear mixed model was used for the analysis, with p-values of 1.6e-05 and 3.2e-04 for the SNP independence test as thresholds for genome-wide significance and potential significance, respectively. The Manhattan plot of the GWAS results is shown below. Figure 4As shown. The results showed that there was a significant region on chromosome 4 that was associated with body weight, which is consistent with previous reports [Gu X, Feng C, Ma L, Song C, Wang Y, Da Y, Li H, Chen K, Ye S, Ge C, Hu X, Li N. Genome-wide association study of body weight inchicken F2 resource population. PLoS One. 2011;6(7):e21872. doi:10.1371 / journal.pone.0021872.Epub 2011Jul 14.PMID:21779344;PMCID:PMC3136483.].
[0222] Example 3: Application of the 50K liquid phase chip of the present invention in broiler selection breeding—genetic parameter estimation
[0223] Genotyping of 460 White Locker chickens provided by Beijing Huadu Yukou Poultry Co., Ltd. was performed using the 50K liquid phase chip for broilers provided by this invention. At the same time, phenotypic data of pre-slaughter weight (BW), feed intake (FRI), and liver weight (LW) of these roosters at 42 days of age were collected, and their heritability was estimated using GCTA software. The results showed that the heritability of the three traits was 0.37, 0.19, and 0.17, respectively. The heritability obtained by this chip was consistent with the results of previous studies [Yuan J, Dou T, Ma M, Yi G, Chen S, Qu L, Shen M, Qu L, Wang K, Yang N. Genetic parameters offered efficiency traits in laying period of chickens. Poult Sci. 2015 Jul;94(7):1470-5. doi:10.3382 / ps / pev122. Epub 2015 May 25. PMID:26009751;PMCID:PMC4991064.].
[0224] Example 4 Industrial Applicability
[0225] The SNP loci on the 50K liquid phase chip for broilers provided by this invention are derived from SNP loci associated with economic traits in laying hens; SNP loci associated with economic traits in broilers were screened from known QTL databases; and liquid phase chip backbone loci were obtained through screening of whole-genome resequencing data of broiler populations. The 50K liquid phase chip for broilers provided by this invention can specifically identify the phylogenetic relationship between commercial broilers and local broiler breeds. It can also be used for genome-wide association studies, genome-wide selection breeding, QTL mapping analysis of target traits, and population genetic analysis. It is applicable to both domestic and foreign chicken breeds, and can help accelerate the rapid development of the broiler industry, possessing significant economic, practical, and scientific research value.
[0226] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. A 50K liquid phase chip for broiler chickens, characterized in that, The genotyping loci of the 50K liquid phase chip for broiler chickens are 42,417 SNP loci located on the chicken reference genome version 6.
0. The broiler chickens are White Locker chickens. The location information of the SNP loci is shown in the table below: The 50K liquid phase chip for broilers is associated with economic traits of broilers; the economic traits of broilers are one or more of the following: broiler weight, carcass percentage, breast muscle percentage, leg muscle percentage, abdominal fat percentage, intramuscular fat content of breast muscle, post-slaughter muscle pH, meat color and IgY antibody titer. Wherein, Ref represents the reference genome base, Alt represents the mutated base, and the position is the physical location of the Ref or Alt base on the corresponding chromosome; "-" indicates a deletion mutation; NO.1 is the nucleotide sequence as shown in SEQ ID NO.1, NO.2 is the nucleotide sequence as shown in SEQ ID NO.2, NO.3 is the nucleotide sequence as shown in SEQ ID NO.3, NO.4 is the nucleotide sequence as shown in SEQ ID NO.4, NO.5 is the nucleotide sequence as shown in SEQ ID NO.5, and NO.6 is the nucleotide sequence as shown in SEQ ID NO.6, as detailed below: SEQ ID NO.1: 5'-GCCAGGCAAGGACAGCCAGGCCTGTCCAGGCAAGGCTAGGCAAGGCAAGGCCAGGAAAGGCAAAGGAAGGACATGCAAGGCAAGGGCAGGCAAGGCAAGGCCAGGCCAGTCCAGGCC-3'; SEQ ID NO.2: 5'-GCCAGGCAAGGACAGCCAGGCCTGTCCAGGCAAGGCTAGGCAAGGCAAGGCCAGGAAAGGCAAAGGAAGGACATGCAAGGCAAGGGCAGGCAAGGCAAGGCCAGGCCAGTCCAGGCC-3'; SEQ ID NO.3: 5'-ATAAGTAATAAGTTT-3'; SEQ ID NO.4: 5'-ATAAGTAATAAGTTT-3'; SEQ ID NO.5: 5'-AGTGATTCCC-3'; SEQ ID NO.6: 5'-AGTGATTCCC-3'; SEQ ID NO.7: 5'-CTTCCCGCTCA-3'; SEQ ID NO. 8: 5'-CTTCCCGCTCA-3'.
2. The 50K liquid phase chip for broiler chickens according to claim 1, characterized in that, The 50K liquid phase chip for broilers also includes probes designed based on gene sequences covering the SNP sites.
3. The application of the 50K liquid phase chip for broilers as described in claim 1 in broiler targeted capture sequencing.
4. The application of the 50K liquid phase chip for broilers according to claim 1 in one or more of 1) to 4): 1) Broiler breed identification; 2) Broiler breeding; 3) Improvement of broiler breed resources; 4) Analysis of genetic diversity in broiler populations; 5) QTL mapping analysis of target traits in broilers; 6) Identification of broiler-associated loci and candidate genes.
5. The application according to claim 4, characterized in that, The 1) identification of broiler breeds includes: identification of the kinship between commercial broilers and local broiler breeds.
6. The application according to claim 4, characterized in that, The second point is that broiler breeding includes whole-genome selection breeding.
Citation Information
Patent Citations
60K SNP (Single Nucleotide Polymorphism) liquid phase breeding chip for broiler chickens
CN118834964A