Method for introducing nucleic acid into cell and application thereof

Abstract

The present invention addresses the problem of providing: a method for introducing a nucleic acid into a cell, said method being capable of efficiently introducing a high-concentration nucleic acid, which is a complex of a nucleic acid and a cationic polymer, into a high-density cell; a method for producing a cell into which a nucleic acid has been introduced; and a method for producing a useful substance. A composition comprising the cationic polymer and a nucleic acid; and a cell culture comprising the composition and cells. The present invention provides a method for introducing a nucleic acid into a cell, the method comprising: (a) a complex formation step for mixing a cationic polymer and a nucleic acid to obtain a solution of a complex of the cationic polymer and the nucleic acid, the concentration of the nucleic acid being 100-1000 [mu] g / mL and the conductivity of the mixed complex solution being 1.0-7.0 mS / cm in the complex formation step; and (b) a transfection step in which the complex solution obtained in step (a) is added to a cell suspension.

Description

Technical Field

[0001] The present invention relates to a method for introducing nucleic acid into cells, comprising the step of transfecting cells with a complex of a cationic polymer and nucleic acid. The present invention also relates to a method for producing cells into which nucleic acid has been introduced and a method for producing a useful substance. The present invention also relates to a composition comprising a cationic polymer and nucleic acid, and a cell culture comprising the composition and cells. Background Art

[0002] In order to produce gene therapy drugs such as adeno-associated virus (AAV) vectors, genes are transiently transfected into cells. As a method for producing AAV vectors, for example, there is a method of transiently introducing an AAV production plasmid as a nucleic acid into HEK (Human Embryonic Kidney cells) 293 cell lines to produce AAV vectors.

[0003] The introduction of nucleic acids into cells is not only required in medical applications such as antibody preparations and gene therapy, but is also essential in basic research in molecular cell biology. For example, as methods for introducing genes into cells, there are known transfection methods using viral vectors and non-viral transfection methods.

[0004] Transfection methods using viral vectors allow for high levels of gene transfer. Viral vectors are effective gene transfer vectors, but their use is limited by the induction of immune responses and virus-related pathogenicity.

[0005] Non-viral transfection methods do not have the problems associated with transfection methods using viral vectors, and are very advantageous when manufacturing pharmaceuticals from nucleic acids. According to non-viral transfection methods, products can be manufactured with high reproducibility and at an affordable price.

[0006] There are many known non-viral transfection methods, and as the main method, methods using cationic lipids and / or cationic polymers can be exemplified. Currently, a series of non-viral transfection reagents containing cationic lipids or cationic polymers as main components are sold and used on the market.

[0007] Polyethyleneimine (hereinafter, PEI) as a representative example of cationic polymer is low price, non-viral and non-lipid transfection reagent, one of the medium with high cost performance.PEI forms complex with nucleic acid, can effectively transfect gene with low toxicity to cell.This PEI / nucleic acid complex is taken into cell by endocytosis.The pH buffer capacity of PEI is high, and the DNA taken in is protected from decomposition in lysosome, and is effectively released to cytoplasm from lysosome.So, PEI is useful as transfection reagent, for the transfection of DNA to mammalian cells.

[0008] For example, Patent Document 1 describes a method of adding free PEI when forming a complex of PEI and nucleic acid. Patent Document 2 describes the use of polyethylene glycol-grafted PEI for transfection of nucleic acid. Patent Document 3 describes the use of polyethylene glycol-modified PEI for transfection of nucleic acid. Patent Document 4 describes the use of a pH of 3.5 to 4.5 when a complex of PEI and nucleic acid is formed. Non-patent Documents 1 and 2 also describe the use of PEI for transfection.

[0009] Prior art literature

[0010] Patent Literature

[0011] Patent Document 1: Japanese Patent Application No. 2020-524498

[0012] Patent Document 2: Japanese Patent Application Publication No. 2021-106580

[0013] Patent Document 3: Japanese Patent Application No. 2002-506441

[0014] Patent Document 4: Japanese Patent Application Publication No. 2011-24493

[0015] Non-patent literature

[0016] Non-patent document 1: Ogris, M. et al., The size of DNA / transferring-PEI complexesis an important factor for gene expression in cultured cells. Gene Ther. 5, (1998) 1425-1433.

[0017] Non-patent document 2: Gonzalez-Dominguez et al (2019) Impact of physicochemicalproperties ofDNA / PEI complexes on transient transfection of mammalian cells, New Biotechnology, Volume 49, 25March 2019, pages 88-97 Summary of the invention

[0018] Technical issues to be solved by the invention

[0019] In conventional gene transfer procedures, in the step of forming a complex of nucleic acid and PEI, it is necessary to set the concentration of the complex within an appropriate range from the viewpoint of controlling the particle size of the complex.

[0020] On the other hand, in order to produce a large amount of target substances, intensive research has found that it is necessary to introduce a high concentration of nucleic acid into cells. However, to this end, from the perspective of maintaining the complex concentration in the step of forming the complex within an appropriate range, the amount of solvent also needs to be increased. This is because when the complex concentration cannot be maintained within an appropriate range, the gene introduction efficiency is significantly reduced and the mass production of the target protein cannot be achieved.

[0021] The problem to be solved by the present invention is to provide a method for introducing nucleic acid into cells, which can effectively introduce high-concentration nucleic acid as a complex of nucleic acid and cationic polymer. The problem to be solved by the present invention is also to provide a method for producing cells into which nucleic acid is introduced and a method for producing useful substances using the above method for introducing nucleic acid into cells. The problem to be solved by the present invention is also to provide a composition containing a cationic polymer and nucleic acid related to the above method, and a cell culture containing the above composition and cells.

[0022] Means for solving technical problems

[0023] As a result of intensive research conducted by the present inventors to solve the above-mentioned problems, it was found that in the complex formation of a solution of a complex of a cationic polymer and a nucleic acid obtained by mixing a cationic polymer and a nucleic acid, the above-mentioned problems can be solved by setting the conductivity of the complex solution to 1.0 to 7.0 mS / cm. The present invention was completed based on the above-mentioned findings.

[0024] According to the present invention, the following inventions are provided.

[0025] <1> A method for introducing a nucleic acid into a cell, comprising: (a) a complex formation step of mixing a cationic polymer and a nucleic acid to obtain a solution of a complex of the cationic polymer and the nucleic acid, wherein the concentration of the nucleic acid in the complex formation step is 100 to 1000 μg / mL, and the conductivity of the complex solution after mixing is 1.0 to 7.0 mS / cm; and

[0026] (b) Transfection step: adding the complex solution obtained in step (a) to the cell suspension.

[0027] <2> The method according to <1>, wherein

[0028] The period when the conductivity is 1.0 to 7.0 mS / cm is any time between 0 minutes and 10 minutes after the start of mixing of the cationic polymer and the nucleic acid.

[0029] <3> The method according to <1> or <2>, wherein:

[0030] The concentration of the nucleic acid is 110 μg / mL to 300 μg / mL.

[0031] <4> The method according to any one of <1> to <3>, wherein

[0032] The mass ratio of the cationic polymer to the nucleic acid is 8:1 to 1:1.

[0033] <5> The method according to any one of <1> to <4>, wherein

[0034] The cell density of the cell suspension in contact with the above complex solution was 1×10 5 Cells / mL~5×10 8 cells / mL.

[0035] <6> The method according to any one of <1> to <5>, wherein

[0036] The cell density of the cell suspension in contact with the above complex solution was 5×10 6 Cells / mL~3×10 7 cells / mL.

[0037] <7> The method according to any one of <1> to <6>, wherein

[0038] The total amount of nucleic acid used to form the above complex is 0.1 to 1 μg per 1 million cells.

[0039] <8> The method according to any one of <1> to <7>, wherein

[0040] The conductivity of the composite solution is 3.0 to 5.0 mS / cm.

[0041] <9> The method according to any one of <1> to <8>, wherein

[0042] The average particle size of the composite is 200 nm to 1200 nm.

[0043] <10> The method according to any one of <1> to <9>, wherein

[0044] The complex formation step (a) includes the step of mixing the cationic polymer and the nucleic acid before the step (b) and then leaving the complex solution to stand for 10 seconds to 4 hours.

[0045] <11> The method according to any one of <1> to <10>, wherein

[0046] The volume ratio of the complex solution to the cell suspension is 1:2 to 1:500.

[0047] <12> The method according to any one of <1> to <11>, wherein

[0048] The cationic polymer is a polyamine.

[0049] <13> The method according to any one of <1> to <12>, wherein

[0050] The cationic polymer is polyethyleneimine.

[0051] <14> The method according to any one of <1> to <13>, wherein

[0052] The above nucleic acid is a plasmid.

[0053] <15> The method according to any one of <1> to <14>, wherein

[0054] The above cells are animal cells.

[0055] <16> The method according to any one of <1> to <14>, wherein

[0056] The above cells are HEK cells.

[0057] <17> A method for producing a cell into which a nucleic acid has been introduced, comprising the method according to any one of <1> to <16>.

[0058] <18> A method for producing a useful substance, comprising:

[0059] A step of introducing a nucleic acid into a cell by the method of any one of <1> to <16>; and

[0060] The process of culturing the above cells to produce useful substances.

[0061] <19> The method according to <18>, wherein

[0062] Useful substances are viral vectors.

[0063] <20> The method according to <19>, wherein

[0064] Viral vectors are pharmaceutical raw materials.

[0065] <21> A composition comprising a cationic polymer and a nucleic acid, wherein:

[0066] The nucleic acid concentration is 100-1000 μg / mL, and the conductivity is 1.0-7.0 mS / cm.

[0067] <22> The composition according to <21>, which is a composition for gene transfer.

[0068] <23> A cell culture comprising the composition described in <21> or <22> and a cell density of 1×10 5 Cells / mL~5×10 8 cells / mL of cells.

[0069] Effects of the Invention

[0070] According to the present invention, a high concentration of nucleic acid as a complex of nucleic acid and cationic polymer can be effectively introduced into cells. According to the present invention, a complex of nucleic acid and cationic polymer at a high concentration can be formed, and a substantial reduction in culture scale can be avoided as cells into which the complex is introduced become high density. DETAILED DESCRIPTION

[0071] Hereinafter, an example of an embodiment of the present invention will be described. However, the present invention is not limited by the following embodiments and can be implemented by appropriately changing within the scope of the purpose of the present invention. In this specification, the numerical range represented by "~" represents the range including the numerical values ​​recorded before and after "~" as the minimum value and the maximum value, respectively.

[0072] The present invention relates to a method for introducing a nucleic acid into a cell, comprising:

[0073] (a) a complex formation step of mixing a cationic polymer and a nucleic acid to obtain a solution of a complex of the cationic polymer and the nucleic acid, wherein the concentration of the nucleic acid in the complex formation step is 100 to 1000 μg / mL, and the conductivity of the complex solution after mixing is 1.0 to 7.0 mS / cm; and

[0074] (b) Transfection step: adding the complex solution obtained in step (a) to the cell suspension.

[0075] The first feature of the present invention is that the concentration of the nucleic acid is high, ie, 100 to 1000 μg / mL, in the complex formation step. The second feature of the present invention is that the conductivity of the complex solution after mixing is set to 1.0 to 7.0 mS / cm.

[0076] Although not limiting the present invention, in the present invention, it is not necessary to add a stabilizer (polyethylene glycol, etc.) or a reinforcing agent (a cationic polymer such as PEI is added later). In addition, although not limiting the present invention, in the present invention, it is not necessary to set the pH when the complex of PEI and nucleic acid is formed to an acidic condition of 3.5 to 4.5.

[0077] In the present invention, even if the concentration of nucleic acid in the complex formation process is as high as 100 to 1000 μg / mL, the increase in the particle size of the complex can be controlled by setting the conductivity of the complex solution within the range of 1.0 to 7.0 mS / cm, thereby enabling the complex of nucleic acid and cationic polymer to be effectively introduced into cells.

[0078] In the present invention, a cationic polymer and a nucleic acid are mixed to obtain a solution of a complex of a cationic polymer and the nucleic acid.

[0079] The cationic polymer is not particularly limited, and for example, one or a combination of the group consisting of chitosan, poly-L-lysine (pLL), polyamine (PA), polyalkylene imine (PAI), polyethylene imine (PEI), poly[a-(-aminobutyl)-L-glycolic acid], polyamidoamine, poly(2-dimethylamino)ethyl methacrylate, polyhistidine, polyarginine, poly(4-vinylpyridine), poly(vinylamine) and poly(4-vinyl-N-alkyl pyridine halide) can be used.

[0080] As the cationic polymer, polyamine is preferred, and polyethyleneimine (hereinafter also referred to as PEI) is particularly preferred. As the cationic polymer, a non-lipid cationic polymer is preferably used.

[0081] PEI may be a linear PEI or a branched PEI, and is preferably a linear PEI.

[0082] Taking into account its transfection efficiency, the molecular weight of PEI is preferably 10,000 to 800,000Da, more preferably 10,000 to 50,000Da, further preferably 10,000 to 27,000Da, and particularly preferably about 25,000Da. As an example, a straight-chain PEI with a molecular weight of about 25,000Da can be used. PEI is a commercially available product and can be easily obtained. For example, PEIpro (101000033) manufactured by Polyplus can be preferably used.

[0083] Nucleic acid refers to a chain polynucleotide composed of purine or pyrimidine bases, sugars and phosphates as basic units, and the phosphates form diester bonds between the 3' and 5' carbons of the sugars between the nucleotides. According to the difference in sugars, it is roughly divided into deoxyribonucleic acid (DNA) whose sugar part is deoxyribose and ribonucleic acid (RNA) whose sugar part is ribose. As a nucleic acid, it can be any of genes, DNA (linear DNA or circular DNA), RNA, oligonucleotides and polynucleotides.

[0084] In this specification, nucleic acid, gene, DNA, RNA, oligonucleotide and polynucleotide are used interchangeably.

[0085] An example of the nucleic acid in the present invention is a plasmid.

[0086] The concentration of the nucleic acid in the complex formation step is 100 μg / mL to 1000 μg / mL, preferably 110 μg / mL to 1000 μg / mL, more preferably 110 μg / mL to 500 μg / mL, further preferably 110 μg / mL to 300 μg / mL, particularly preferably 110 μg / mL to 200 μg / mL, and most preferably 110 μg / mL to 150 μg / mL.

[0087] The nucleic acid concentration can be measured using a Nanodrop (trademark) 2000c (ND-2000c, Thermo Fisher Scientific) microspectrophotometer.

[0088] In the complex formation step, the mass ratio of the cationic polymer to the nucleic acid is preferably 8:1 to 1:1, more preferably 5:1 to 1:1, and even more preferably 3:1 to 1:1.

[0089] In the present invention, the conductivity of the complex solution is 1.0 to 7.0 mS / cm. The period when the conductivity of the complex solution is 1.0 to 7.0 mS / cm may be any time between 0 minutes and 10 minutes after the start of mixing of the cationic polymer and the nucleic acid.

[0090] The conductivity of the composite solution is preferably 2.0 mS / cm to 6.0 mS / cm, more preferably 3.0 mS / cm to 5.0 mS / cm.

[0091] The electrical conductivity of the composite solution can be measured by inserting an electrode of a conductivity meter into each sample whose temperature is adjusted to 25° C., and measuring the electrical conductivity.

[0092] The average particle size of the composite formed in the composite forming step is preferably 200 nm to 1200 nm, more preferably 300 nm to 1200 nm, further preferably 400 nm to 1100 nm, and particularly preferably 500 nm to 1000 nm.

[0093] The average particle size of the composite can be measured by a dynamic light scattering method as a scattering intensity standard. The analysis method is an accumulation method, and the viscosity and refractive index can be measured by using values ​​actually measured by a viscometer and a refractometer.

[0094] In the complex formation step (a), it is preferred that the complex solution be allowed to stand for 10 seconds to 4 hours after mixing the cationic polymer and the nucleic acid before step (b), more preferably for 1 minute to 60 minutes, and even more preferably for 10 minutes to 30 minutes. Furthermore, the temperature during the standing is preferably 15°C to 35°C, more preferably 20°C to 30°C, and particularly preferably 22°C to 28°C.

[0095] In the present invention, a transfection step is performed in which the complex solution obtained in step (a) is added to a cell suspension. Transfection refers to the introduction of a nucleic acid into a cell.

[0096] The cell density of the cell suspension when contacting with the complex solution is not particularly limited, but is preferably 1×10 5 Cells / mL~5×10 8 cells / mL, preferably 1×10 5 Cells / mL~1×10 8 cells / mL, more preferably 5×10 5 Cells / mL~5×10 7 cells / mL, particularly preferably 1×10 6 Cells / mL~3×10 7 cells / mL, preferably 5×10 6 Cells / mL~3×10 7 cells / mL.

[0097] The cell density can be determined using Vi-cell (trademark) XR (manufactured by Beckman Coulter).

[0098] The total amount of nucleic acid used to form the complex is not particularly limited, but is preferably 0.1 to 1 μg per 1 million cells, more preferably 0.2 to 0.9 μg per 1 million cells, further preferably 0.3 to 0.8 μg per 1 million cells, and particularly preferably 0.4 to 0.7 μg per 1 million cells.

[0099] The volume ratio of the complex solution to the cell suspension is not particularly limited, but is preferably 1:2 to 1:500, more preferably 1:5 to 1:300, particularly preferably 1:10 to 1:200, and most preferably 1:20 to 1:200. The lower limit of the volume ratio of the complex solution to the cell suspension may be 1:5, 1:10, or 1:20. The upper limit of the volume ratio of the complex solution to the cell suspension may be 1:300 or 1:200.

[0100] The cells used in the present invention may be isolated cells, cells contained in isolated living tissues, or cultured cells. When the cells are isolated cells or cultured cells, the cells may be adherent cells or floating cells.

[0101] As a cell, an animal cell is preferred. As an animal cell, it is not particularly limited, preferably a mammalian cell or an insect cell, more preferably a mammalian cell. As a mammalian cell, for example, human cells, mouse cells, rat cells, monkey cells, hamster cells, etc. can be cited, but it is not particularly limited. Human cells can be preferably used. As examples of cells, mouse myeloma (NSO) cell lines, Chinese hamster ovary (CHO) cell lines, HT1080, H9, HepG2, MCF7, MDBK Jurkat, NIH3T3, PC12, BHK (baby hamster kidney cells), VERO, SP2 / 0, YB2 / 0, Y0, C127, L cells, COS (such as COS1 and COS7), QC1-3, HEK (Human Embryonic Kidney cells: kidney cells derived from human fetuses) cells (such as HEK293, etc.), VERO, PER.C6, HeLa, EB1, EB2, EB3, oncolytic or hybridoma cell lines can be cited. Preferably, the cell is a HEK cell or a CHO cell, more preferably a HEK293 cell.

[0102] According to the present invention, there is provided a method for producing a cell into which a nucleic acid has been introduced, including the method for introducing a nucleic acid into a cell according to the present invention.

[0103] According to the present invention, there is also provided a method for producing a useful substance, comprising: a step of introducing a nucleic acid into a cell by the method of the present invention; and a step of culturing the cell to produce the useful substance.

[0104] The useful substance is not particularly limited, and examples thereof include viral vectors and proteins. The useful substance is preferably a viral vector. The produced protein or viral vector can be used as a pharmaceutical raw material, for example.

[0105] Viruses are viruses produced by introducing nucleic acids into cells. Examples of viruses include adeno-associated viruses, lentiviruses, baculoviruses, and retroviruses, and adeno-associated viruses are preferred among the above.

[0106] Adeno-associated virus (AAV) refers to a family of Parvoviridae and Dependent Parvovirus that contains a single-stranded DNA consisting of about 4700 bases, a small non-enveloped virus with incomplete replication ability. It is known that there are more than 100 serotypes in AAV, and the host range or the characteristics of the virus are different depending on the serotype. It is known that serotype 2 (AAV2) is one of the serotypes that has been widely studied for a long time, and the host range is very wide. Serotype 1 (AAV1), serotype 5 (AAV5), and serotype 6 (AAV6) are serotypes with higher tissue orientation. It can be said that AAV1 has a high efficiency of gene introduction to muscle, liver, respiratory tract, central nervous system, etc., AAV5 has a high efficiency of gene introduction to the central nervous system, liver, retina, etc., and AAV6 has a high efficiency of gene introduction to the heart, muscle, liver, etc. In the present invention, it is preferably used in serotype 2 or serotype 5. Serotype 5 is particularly preferred.

[0107] Adeno-associated virus gene refers to a gene composed of one or more nucleic acid sequences derived from one or more serotypes of adeno-associated virus. Adeno-associated virus gene is preferably a gene involved in the replication and packaging of AAV and a gene encoding AAV constituent protein.

[0108] AAV is a non-enveloped virus that proliferates in the presence of helper viruses such as adenovirus and herpes virus. When making AAV for gene therapy or nucleic acid introduction, the classic approach is to replicate AAV by co-infecting adenovirus with host cells. In addition, the gene responsible for the auxiliary effect of adenovirus is clearly identified, and plasmids carrying the gene are also used. For example, by simultaneously transfecting cells with a plasmid containing Rep gene and Cap gene, an adenovirus helper plasmid, and a plasmid containing a gene for treatment or prevention, it can be packaged into a recombinant AAV (rAAV).

[0109] The Rep gene and the Cap gene encode proteins involved in the replication and packaging of virions. In the wild type, the Rep gene is expressed by the P5 promoter and the p19 promoter. The Cap region expresses VP1, VP2, and VP3. As a promoter naturally maintained by the Cap gene, the p40 promoter can be cited.

[0110] Adeno-associated virus genes (Rep gene, Cap gene, etc.) may be wild-type genes, but any gene modified by substitution, deletion, insertion, or addition of bases to the wild-type gene may be used as long as the gene exerts its original function.

[0111] When the Rep gene and the Cap gene are introduced into the cell, a vector containing the Rep gene and the Cap gene can be introduced into the cell. The Rep gene refers to a region of the AAV genome encoding a viral replication protein required for the replication of the viral genome known to those skilled in the art, or a functional homolog thereof such as the human herpes virus 6 (HHV-6) Rep gene (known to mediate AAV-2 DNA replication). The Cap gene refers to a region in the AAV genome encoding a viral capsid protein known to those skilled in the art.

[0112] As the vector containing the Rep gene and the Cap gene, for example, a plasmid, a nucleic acid sequence derived from a virus, an artificially synthesized nucleic acid, etc. can be used, and a plasmid is preferred.

[0113] In the present invention, therapeutic or preventive genes can be introduced into cells.

[0114] As therapeutic or preventive genes, genes that are incomplete or missing in the genome of the target cell, or genes encoding non-natural proteins with desired biological or therapeutic effects (e.g., antiviral functions), etc. can be used, but are not particularly limited. As specific examples of therapeutic or preventive genes, genes for treating or preventing inflammatory diseases, autoimmune, chronic and infectious diseases (including diseases such as AIDS, cancer, nervous system diseases, cardiovascular diseases, hypercholesterolemia), various blood diseases such as anemia and hemophilia, and gene defects (e.g., cystic fibrosis, Gaucher disease, adenosine deaminase (ADA) deficiency, emphysema, etc.) can be cited.

[0115] The therapeutic or preventive gene may be some antisense oligonucleotides useful in antisense therapy for cancer and viral diseases (for example, short-chain oligonucleotides complementary to the sequence around the translation start site (AUG codon) of mRNA).

[0116] The therapeutic or preventive gene can be connected to a promoter for expressing the therapeutic or preventive gene. The promoter for expressing the therapeutic or preventive gene is not particularly limited, but can include a promoter derived from cytomegalovirus (including enhancers as required), SV40 early promoter, human elongation factor-1α (EF-1α) promoter, human ubiquitin C promoter, Rous sarcoma virus LTR promoter of retrovirus, dihydrofolate reductase promoter, β-actin promoter and phosphoglycerate kinase (PGK) promoter, etc. The therapeutic or preventive gene and the promoter for expressing the gene are preferably sandwiched between the ITR sequences.

[0117] In the present invention, it is preferred that a viral helper gene derived from an adenovirus can be introduced into a cell. A viral helper gene refers to a non-adeno-associated viral gene that enables replication and packaging of an adeno-associated virus. As a viral helper gene, genes derived from other types of viruses other than an adeno-associated virus can be used. As specific examples of viral helper genes, viral helper genes derived from adenovirus or herpes virus can be cited, and preferably the viral helper gene is derived from an adenovirus.

[0118] As viral helper genes derived from adenovirus, E1A, E1B, E2A, E4, and VA-RNA can be cited. In host cells having all or part of the E1 region, the genome of AAV will be replicated and packaged into the capsid, and the regions of the adenovirus genome required for forming viral virions are the E2A region, the E4 region, and the VA1 RNA region. Regarding the functions based on the E4 region, the E4 34kDa protein encoded by the open reading frame 6 (E4ORF6) of the E4 region is required for the replication of AAV. Preferably, the viral helper genes are the E2 gene, the E4 gene, and the VA-RNA gene. The VA-RNA gene is preferably the VA-RNAI gene.

[0119] The viral helper genes (E1A, E1B, E2A, E4 and VA-RNA, etc.) derived from adenovirus can be wild-type genes, but as long as the genes exert their original functions, genes modified by base substitution, deletion, insertion or addition to the wild-type genes can be used.

[0120] When the viral helper gene is introduced into the cell, a vector containing the viral helper gene can be introduced into the cell.

[0121] As the vector containing a viral helper gene, for example, a plasmid, a sequence derived from a virus, an artificially synthesized nucleic acid, etc. can be used, and a plasmid is preferred.

[0122] Preferably the viral helper gene is under the control of a promoter.

[0123] As a specific example of a promoter, there is no particular limitation, but a promoter derived from cytomegalovirus (CMV promoter) (including enhancers as required), SV40 early promoter, human elongation factor-1α (EF-1α) promoter, human ubiquitin C promoter, retroviral Rous sarcoma virus (RSV) LTR promoter, dihydrofolate reductase promoter, β-actin promoter and phosphoglycerate kinase (PGK) promoter, etc. can be cited. As a promoter, it can be under the control of a promoter that can be regulated in expression. The promoter that can be regulated in expression can be a promoter that can be regulated in expression by tetracycline, i.e., a Tet on / off system, or a Tet on system.

[0124] In the present invention, proteins can also be produced as useful substances. Proteins are preferably recombinant proteins. Examples of proteins include recombinant polypeptide chains, recombinant secretory polypeptide chains, antigen-binding proteins, antibodies (e.g., human antibodies, humanized antibodies, chimeric antibodies, mouse antibodies, bispecific antibodies, etc.), Fc fusion proteins, fragmented immunoglobulins, and single-chain antibodies (scFv).

[0125] The protein is preferably an antibody, more preferably a human antibody, a humanized antibody, a chimeric antibody or a mouse antibody. As fragmented immunoglobulins, Fab, F(ab')2, Fv, etc. can be mentioned. The type of antibody is not particularly limited, and can be any of IgG, IgA, IgD, IgE, IgM, etc., such as IgG1, IgG2, IgG3, IgG4, but when used as medicine, IgG and IgM are preferred.

[0126] The antibody is not particularly limited, and examples thereof include anti-IL-6 receptor antibodies, anti-IL-6 antibodies, anti-glypican-3 antibodies, anti-CD3 antibodies, anti-CD20 antibodies, anti-GPIIb / IIIa antibodies, anti-TNF antibodies, anti-CD25 antibodies, anti-EGFR antibodies, anti-Her2 / neu antibodies, anti-RSV antibodies, anti-CD33 antibodies, anti-CD52 antibodies, anti-IgE antibodies, anti-CD11a antibodies, anti-VEGF antibodies, and anti-VLA4 antibodies.

[0127] In the present invention, cells into which nucleic acid has been introduced can be cultured to produce useful substances.

[0128] The culturing of cells can be performed under usual conditions for culturing cells.

[0129] The cell culture temperature is not particularly limited, and the culture is carried out at a temperature at which the cells can survive. The culture temperature is usually 25°C to 45°C, preferably 30°C to 42°C, more preferably 35°C to 40°C, and as an example, is 37°C.

[0130] The CO 2 concentration is usually 3 to 10% CO 2 , preferably 5 to 10% CO 2 , and as an example, it is 8% CO 2 .

[0131] The period for producing useful substances such as viruses is preferably 24 hours to 30 days, more preferably 24 hours to 20 days, further preferably 24 hours to 10 days, further preferably 24 hours to 7 days, and particularly preferably 24 hours to 72 hours.

[0132] The culture can be performed by batch culture, fed-batch culture, perfusion culture or shaking culture. At least a part of the virus production process is preferably perfusion culture.

[0133] The culture container is not particularly limited, and may be, for example, a flask or a bioreactor.

[0134] The culture scale is not particularly limited, and cells can be cultured in any volume of culture medium. For example, cells can be cultured in 1 mL to 2500 L of culture medium, preferably 1 L to 2300 L, more preferably 50 L to 2200 L, and particularly preferably 300 L to 2100 L.

[0135] The culture may be carried out while vibrating and stirring. The stirring speed during vibrating and stirring is usually 50 rpm to 200 rpm, preferably 80 to 150 rpm.

[0136] The stirring culture may be a rotary stirring culture based on a propeller or the like in a reactor. The stirring speed during the rotary stirring is usually 50 rpm to 200 rpm, preferably 80 to 150 rpm. Furthermore, stirring may be performed by wave-type vibration stirring or by moving the stirring blade up and down, but is not particularly limited.

[0137] Examples of culture media include, but are not limited to, BalanCD (registered trademark) medium, Expi293 Expression Medium (Thermo Fisher Scientific, A1435101), Dulbecco's modified Eagle's medium (DMEM) containing 10% (vol / vol) fetal bovine serum (FBS), Gibco (trademark) Viral Production Medium (Thermo Fisher Scientific, A4817901), serum-free UltraCULTURE (trademark) medium (Lonza), HuMEC basal serum-free medium, KNOCKOUT (trademark) CTS (trademark) XenoFREE ESC / iPSC medium, STEMPRO(trademark)-34SFM medium, STEMPRO(trademark) NSC medium, ESSENTIAL(trademark)-8 medium, medium 254, medium 106, medium 131, medium 154, medium 171, medium 171, medium 200, medium 231, HeptoZYME-SFM, human endothelial-SFM, GIBCO(registered trademark) FREESTYLE(trademark) 293 expression medium, medium 154CF / PRF, medium 154C, medium 154CF, medium 106, medium 200PRF, medium 131, Essential(trademark)-6 medium, STEMPRO(trademark)-34 medium, Gibco(registered trademark) astrocyte medium, AIM V(registered trademark) medium CTS(trademark), AMINOMAX(trademark) C-100 basal medium, AMINOMAX(trademark)-II complete medium, CD FORTICH O (trademark) medium, CD CHO AGT medium, CHO-S-SFM medium, GIBCO (registered trademark) FREESTYLE (trademark) CHO expression medium, CD OPTICHO (trademark) medium, CD CHO medium, CD DG44 medium, SF-900 (trademark) medium, EXPI293 (trademark) expression medium, LHC basal medium, LHC-8 medium, 293SFM medium, CD 293 medium, AEM growth medium, PER.C6 (registered trademark) cell culture medium, AIM V (registered trademark) medium, EXPILIFE (registered trademark) medium, keratinocyte SFM medium, LHC medium, LHC-8 medium, LHC-9 medium, and any derivatives or modifications thereof.In certain specific non-limiting embodiments, the high-density culture medium may be CD FORTICHO (trademark) medium, CD CHO AGT medium, CHO-S-SFM medium, GIBCO (registered trademark) FREESTYLE (trademark) CHO expression medium, CD OPTICHO (trademark) medium, CD CHO medium, CD DG44 medium, GIBCO (registered trademark) FREESTYLE (trademark) 293 expression medium, EXPI293 (trademark) expression medium, LV-MAX (trademark) production medium, FREESTYLE (trademark) F17 expression medium, DYNAMIS (trademark) medium, or the same medium or a modified form thereof. The culture medium may be supplemented with 1xGlutaMAX (TM) (manufactured by Thermo Fisher Scientific) or the like as needed. Among these, particularly preferred are BalanCD (registered trademark) medium, Expi29 Expression Medium (Thermo Fisher Scientific, A1435101), Dulbecco's modified Eagle's medium (DMEM) containing 10% (vol / vol) fetal bovine serum (FBS), Gibco (trademark) Viral Production Medium (ThermoFisher Scientific, A4817901), and FREESTYLE (trademark) F17 expression medium.

[0138] In the case where the useful substance manufactured in the present invention is a virus, the titer of the manufactured virus can be measured by a common method known to those skilled in the art. For example, the cell culture fluid after culture is recovered, and after the cells are broken by freeze-thaw, the supernatant is recovered by centrifugation. By adding MgCl2 and Benzonase (nuclease) to the recovered supernatant to react, gDNA (genomic DNA) and residual plasmids can be digested. The sample containing the target virus obtained above is used as a ddPCR (Droplet Digital PCR: droplet digital PCR) sample, and by performing ddPCR, the titer of the target virus can be measured.

[0139] According to the present invention, there is also provided a composition comprising a cationic polymer and a nucleic acid, wherein the nucleic acid concentration is 100 to 1000 μg / mL and the conductivity is 1.0 to 7.0 mS / cm. The preferred ranges of the cationic polymer, the nucleic acid, the nucleic acid concentration and the conductivity are as described above in this specification. The above composition is useful as a composition for gene introduction.

[0140] According to the present invention, there is also provided a method comprising the above composition and a cell density of 1×10 5 Cells / mL~5×10 8 Cells / mL of cell culture. The preferred ranges of cell density and cells are as described above in the present specification.

[0141] The present invention will be described in more detail by the following examples, but the present invention is not limited to the examples.

[0142] Example

[0143] <Cell culture medium>

[0144] HEK-293 cells (Expi293, A14527, manufactured by ThermoFisher Scientific) were cultured in BalanCD medium (manufactured by Fujifilm Irvine Scientific) supplemented with 1xGlutaMAX(TM) (manufactured by Thermo Fisher Scientific).

[0145] The cells were cultured in a shake flask (Corning Incorporated) or a bioreactor. In the shake flask, the cells were cultured in an incubator at 37°C with stirring at 120 rpm and a humidified atmosphere of 8% CO2. 6 Cells were inoculated at a cell density of about 2×10 6 cells / mL, gene introduction was performed by adding nucleic acid complex.

[0146] <Nucleic Acid>

[0147] In order to prepare adeno-associated virus vector (rAAV), three plasmid DNAs were used: 1) a plasmid containing the target gene to be introduced adjacent to ITR, 2) a packaging plasmid containing rep and cap genes, and 3) an adenovirus helper plasmid containing adenovirus E2, E4 and VARNA genes. All plasmids used AAVpro Packaging Plasmid (AAV5, 6650, manufactured by Takara Bio Inc.). Regarding 1), as a target gene, EGFP (Enhanced Green Fluorescent Protein) was inserted downstream of the CMV promoter for use.

[0148] <Cationic polymer>

[0149] Linear polyethyleneimine (PEI) "PEI pro" with a molecular weight of 25 KDa (manufactured by Polyplus) was used as a gene transfer agent.

[0150] <Transfection>

[0151] The total amount of plasmid DNA used in transfection was 0.5 μg per 1 million cells.

[0152] PEI and plasmid DNA were mixed in a ratio of 1:1, 2:1 or 3:1 to prepare PEI / DNA complexes, incubated at room temperature for 15 minutes, and the plasmid DNA / PEI complexes were added to the cell culture medium. The results of the preliminary test showed that the mixing ratio of PEI to plasmid DNA was preferably 2:1 from the perspective of gene introduction efficiency, so the following examples describe the mixing ratio of 2:1.

[0153] At this time, the process of mixing plasmid DNA and PEI to form a complex is described below in comparison with standard conditions.

[0154] Standard conditions (reference example):

[0155] Plasmid and PEI (solvent: BalanCD medium, conductivity 10.1 mS / cm) were mixed to a final concentration of 13 μg / mL for plasmid and 26 μg / mL for PEI, and the mixture was incubated at 2 × 10 6 cells / mL of HEK cells were transfected.

[0156] High concentration conditions (the present invention):

[0157] The plasmid and PEI were mixed (the conductivity-adjusting solvents prepared by mixing BalanCD medium and 10 mM HEPES at a ratio of 3:7, 4:6, 5:5, and 6:4 were used as the solvent, and the conductivity of the solvent before mixing the plasmid and PEI was set to 3.7, 4.8, 5.6, and 6.8 mS / cm, respectively) to adjust the final concentrations of the plasmid to 130 μg / mL and the final concentration of PEI to 260 μg / mL, and the concentrations were adjusted to 2 × 10 7 cells / mL of HEK cells were transfected.

[0158] *The conductivity adjustment solvent was prepared by mixing BalanCD medium and 10 mmol / L HEPES (ThermoFisher Scientific) at a ratio of 4:6.

[0159] Samples containing cells and cell culture medium were collected 24 hours after transfection to determine the cell number and gene transfer efficiency, and recovered 72 hours after transfection to evaluate the AAV production amount.

[0160] [Electrical conductivity]

[0161] Using a conductivity meter, the electrodes of the conductivity meter were inserted into each sample whose temperature was adjusted to 25° C., and the conductivity was measured.

[0162] [Measurement of average particle size of composite]

[0163] The average particle size (based on scattering intensity) of the composite was measured by a dynamic light scattering method at 25° C. The analysis method was an accumulation method, and the viscosity and refractive index were values ​​measured by a viscometer and a refractometer.

[0164] [Cell density]

[0165] The cell density was determined using Vi-cell (trademark) XR (manufactured by Beckman Coulter).

[0166] [Gene transfer efficiency]

[0167] Regarding the gene transfer efficiency, the ratio of EGFP-expressing cells 24 hours after the gene transfer operation was evaluated using a flow cytometer (Attune Flow Cytometer, manufactured by Thermo Fisher).

[0168] Based on the comparison of gene transfer efficiency with the conventional method, the relative value of the ratio of EGFP expressing cells to the conventional method was evaluated. In addition, regarding the ratio of the three plasmid DNAs, the molar ratio of the three plasmids was set to 1:1:1 in both the reference example and the present invention.

[0169] [AAV titer determination]

[0170] The culture medium of HEK cells cultured at 37°C and 8% CO2 for 72 hours after gene introduction was recovered. Then, a final concentration of 0.1% TritonX (manufactured by Thermo Fisher), a final concentration of 2mmol / L MgCl2, and 25U / mL Benzonase (manufactured by Merck) were added, and the reaction was carried out at 37°C for 2 hours to digest gDNA (genomic DNA) or residual plasmid. The reacted samples were incubated at 95°C for 15 minutes, at 70°C for 3 minutes, at 40°C for 3 minutes, and at 20°C for 3 minutes to inactivate Benzonase and prepare them into ddPCR (Droplet Digital PCR) samples. The ddPCR samples were diluted 50 times with TE buffer (pH8.0, containing 0.05% Pluronic F-68 and 10μg / mL bovine thymus DNA). In a test tube on ice, 10 μL of ddPCRtm Supermix for Probes (ddPCR probe premix) (no dUTP) (BIORAD), 2 μL of diluted ddPCR sample, primers (seq1, seq2, final concentration 900 nmol / L) and probes (seq3, final concentration 250 nmol / L, with FAM (fluorescein amide) added as a fluorescent probe), and nuclease-free water (Thermo Fisher Scientific, 10977015) were mixed and the total liquid volume was adjusted to 22 μL for ddPCR.

[0171] In ddPCR, droplets were formed from the preparation solution using a droplet formation device, followed by incubation at 95°C for 10 minutes, 94°C for 30 seconds, 55°C for 40 cycles, and 98°C for 10 minutes. The AAV genome titer (vg / mL) was calculated by measuring with a droplet reader.

[0172] seq1 GGAACCCCTAGTGATGGAGTT (sequence number 1)

[0173] seq2 CGGCCTCAGTGAGCGA (sequence number 2)

[0174] seq3 CACTCCCTCTCTGCGCGCTCG (sequence number 3)

[0175] About transfection 2×10 6 In the case of cells / mL, the conductivity of the complex solution, the average particle size of the complex, and the gene transfer efficiency (relative value) are shown in Table 1.

[0176] About transfection 2×10 7In the case of cells / mL, the conductivity of the complex solution, the average particle size of the complex, the gene introduction efficiency (relative value) and the AAV5 genome titer (relative value) are shown in Table 2.

[0177] As shown in Tables 1 and 2, by controlling the complex formation in a solvent having a predetermined conductivity, the introduction efficiency can be maintained even under high-concentration complex formation conditions.

[0178] As shown in Table 2, by controlling the complex formation and performing transfection in a solvent with a predetermined conductivity, an AAV titer equal to or higher than that of conventional methods can be achieved.

[0179] [Table 1]

[0180]

[0181] [Table 2]

[0182]

Claims

1. A method for introducing a nucleic acid into a cell, comprising: (a) a complex formation step of mixing a cationic polymer and a nucleic acid to obtain a complex solution of the cationic polymer and the nucleic acid, wherein the concentration of the nucleic acid in the complex formation step is 100 to 1000 μg / mL and the conductivity of the complex solution after mixing is 1.0 to 7.0 mS / cm; and (b) Transfection step: adding the complex solution obtained in step (a) to the cell suspension.

2. The method according to claim 1, wherein: The period when the conductivity is 1.0 to 7.0 mS / cm is any time between 0 minutes and 10 minutes after the start of mixing of the cationic polymer and the nucleic acid.

3. The method according to claim 1 or 2, wherein: The concentration of the nucleic acid is 110 μg / mL to 300 μg / mL.

4. The method according to claim 1 or 2, wherein: The mass ratio of the cationic polymer to the nucleic acid is 8:1 to 1:

1.

5. The method according to claim 1 or 2, wherein: The cell density of the cell suspension when contacted with the complex solution was 1×10 5 Cells / mL~5×10 8 cells / mL.

6. The method according to claim 1 or 2, wherein: The cell density of the cell suspension when contacted with the complex solution was 5×10 6 Cells / mL~3×10 7 cells / mL.

7. The method according to claim 1 or 2, wherein: The total amount of nucleic acid used to form the complex is 0.1 to 1 μg per 1 million cells.

8. The method according to claim 1 or 2, wherein: The conductivity of the composite solution is 3.0-5.0 mS / cm.

9. The method according to claim 1 or 2, wherein: The average particle size of the complex is 200nm to 1200nm.

10. The method according to claim 1 or 2, wherein: The complex formation step (a) includes the step of mixing the cationic polymer and the nucleic acid before the step (b) and then leaving the complex solution to stand for 10 seconds to 4 hours.

11. The method according to claim 1 or 2, wherein: The volume ratio of the complex solution to the cell suspension is 1:2 to 1:

500.

12. The method according to claim 1 or 2, wherein: The cationic polymer is a polyamine.

13. The method according to claim 1 or 2, wherein: The cationic polymer is polyethyleneimine.

14. The method according to claim 1 or 2, wherein: The nucleic acid is a plasmid.

15. The method according to claim 1 or 2, wherein: The cells are animal cells.

16. The method according to claim 1 or 2, wherein: The cells are HEK cells.

17. A method for producing a cell into which a nucleic acid has been introduced, comprising the method according to claim 1 or 2.

18. A method for producing a useful substance, comprising: A step of introducing a nucleic acid into a cell by the method of claim 1 or 2; and The process of culturing the cells to produce useful substances.

19. The method according to claim 18, wherein: Useful substances are viral vectors.

20. The method according to claim 19, wherein: Viral vectors are pharmaceutical raw materials.

21. A composition comprising a cationic polymer and a nucleic acid, wherein: The nucleic acid concentration is 100-1000 μg / mL, and the conductivity is 1.0-7.0 mS / cm.

22. The composition according to claim 21, which is a composition for gene introduction.

23. A cell culture comprising the composition of claim 21 or 22 and a cell density of 1×10 5 Cells / mL~5×10 8 cells / mL of cells.

Images