Low-temperature stress biological model, construction method thereof and application

Abstract

The present invention belongs to the field of biotechnology, and specifically relates to a low-temperature stress biological model and a construction method thereof and applications thereof. Through homologous recombination technology, a mouse model of low-temperature stress expressing the NPAFP protein was successfully constructed, and the stable expression of the NPAFP protein in mice was driven by the CAG promoter. These transgenic mice will serve as the basis for studying the function of the NPAFP protein in mammals, especially the physiological responses and mechanism exploration under low-temperature stress. By constructing a tilapia model of low-temperature stress with stable expression of the NPAFP protein, the survival rate of tilapia in low-temperature environments is increased, providing a new solution for the sustainable development of the aquaculture industry. By constructing a zebrafish model of low-temperature stress with stable expression of the NPAFP protein, the cold-resistant function of NPAFP in aquatic organisms is further explored, and its potential in low-temperature stress and oxidative stress protection is verified.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to a low temperature stress biological model, a construction method and an application thereof. Background Art

[0002] During the Cenozoic Era, 65 million years ago, the Antarctic continent began to slowly move, and its temperature gradually dropped, reaching below 0°C around 20 million years ago. Temperature is a key factor affecting the survival, reproduction, and distribution of organisms. As seawater temperatures dropped, most fish became extinct due to their inability to adapt (Verde C, Parisi E, di Prisco G. The evolution of thermal adaptation in polar fish [J]. Gene, 2006, 385: 137-145.). According to statistics, the Southern Ocean, which covers approximately 10% of the Earth's total ocean area, has 50 families and 322 species of fish, accounting for only 1.3% of the Earth's total fish population (Eastman J T. The nature of the diversity of Antarcticfishes [J]. Polar Biology, 2005, 28(2): 93-107.). In extremely cold environments, some homeothermic vertebrates hibernate, while poikilothermic vertebrates that cannot regulate their body temperature, such as Antarctic icefish, have undergone adaptive evolution. They produce antifreeze proteins to prevent their body fluids from freezing, adapting to extreme cold environments and surviving (DeVries AL, Wohlschlag D E. Freezing resistance in some Antarctic fishes[J]. Science,1969, 163(3871): 1073-1075.). In the 1960s, scientists first discovered antifreeze glycoprotein (AFGP) in the blood of Antarctic notothenioid fish (Nototheniidae) (Chen L, DeVries AL, Cheng CH C. Convergent evolution of antifreeze glycoproteins inAntarctic notothenioid fish and Arctic cod[J]. Proceedings of the NationalAcademy of Sciences of the United States of America, 1997, 94(8): 3817-3822.).

[0003] In a previous study (“Evolution of an antifreeze protein byneofunctionalization under escape from adaptive conflict”, Deng et al. PNAS, 2010.), it was first discovered and proved that the Antarctic fish Lycodichthys dearborni evolved an antifreeze protein AFPIII through neofunctionalization in the process of escaping adaptive conflict. It was named LdAFPII. This protein evolved from SAS-B and has multiple repeated functional domains (such as LdAFPIII-1 with one repeated functional domain, LdAFPIII-4 with four repeated functional domains, and LdAFPIII-12 with twelve repeated functional domains). Each AFPIII domain contains 62 amino acids. The sequence of LdAFPII protein was published in a previous study (“Cloning and evolutionary analysis of the multimeric type III antifreeze protein gene of Antarctic eel Pout (Lycodichthys dearborni)”, Yu Jing et al., Acta Genetica Sinica, 2005, 32 (8): 789-794.). Each AFPIII domain contains 62 amino acids. Using alphafold3 to predict and optimize the protein structure, we changed amino acids at positions 36 and 37 from KL to RI and amino acid position 50 from D to E to increase protein structural flexibility. To explore their applications in neurological diseases, they were named NeuroProtection AFPIII (e.g., NPAFP1, NPAFP4, NPAFP12, etc.). NPAFP proteins with different domain structures exhibit varying antifreeze capabilities. NPAFP1 contains one AFPIII domain, while NPAFP4 has four. Research suggests that NPAFP proteins not only play an important role in antifreeze but also have the potential to improve cell and tissue tolerance to cold and oxidative stress.

[0004] Animal experimental models are essential tools in medical and biological research, used to mimic human diseases and study their pathogenesis, drug efficacy, and treatments. Mice, as a classic mammalian experimental model, are widely used in genetics, cell biology, and drug development. In addition to mammalian models, studying the cold adaptation of aquatic species also holds important ecological and economic significance. Tilapia (Oreochromis niloticus), a key aquaculture species, has limited cold tolerance, limiting its cultivation in cold waters. Zebrafish (Danio rerio), with its short lifespan, transparent embryos, and ease of genetic manipulation, are ideal model organisms for studying cold tolerance and oxidative stress protection. Zebrafish not only facilitate observation of embryonic development but also allow for the study of specific gene functions through genetic manipulation. Different animal models have their own unique characteristics and scope of application, and selecting the appropriate one is crucial for successful scientific research.

[0005] As global climate change continues to intensify, extreme low temperatures pose a severe challenge to the survival and reproduction of animals, especially those species that are originally adapted to warmer environments. The low temperature stress caused by cold environments not only affects the growth and reproduction of wild animals and plants, but also has a significant impact on aquaculture, agriculture and animal health. Therefore, exploring and developing molecular mechanisms and protection strategies that can enhance species' tolerance to low temperatures has become an important direction of current biological research and agricultural science and technology development. Although existing studies have revealed the potential of NPAFP proteins in antifreeze, how to effectively apply them to improve the cold tolerance of different species, especially mammals, aquaculture species and model organisms, remains a scientific problem that needs to be solved urgently. Summary of the Invention

[0006] The present invention was completed based on the discovery that by constructing an organism model that stably expresses the NPAFP protein, it is possible to study the resistance of organisms to low temperature stress.

[0007] In a first aspect, the present invention provides a low temperature stress biological model, wherein the mammalian model uses gene editing technology to introduce a constructed plasmid expressing NPAFP protein into the mammalian body to obtain an individual that stably inherits and expresses NPAFP protein.

[0008] Furthermore, the NPAFP protein is selected from NPAFP1, NPAFP2, NPAFP3 and / or NPAFP4; the DNA sequences of NPAFP1, NPAFP2, NPAFP3 and / or NPAFP4 are shown in SEQ ID NOs. 1 to 4, respectively.

[0009] Preferably, the NPAFP protein is NPAFP4.

[0010] Furthermore, the individual that stably inherits and expresses the NPAFP protein is a heterozygous individual or a homozygous individual.

[0011] Furthermore, the low temperature stress biological model includes a low temperature stress mammal model and a low temperature stress aquatic organism model.

[0012] Furthermore, the cold stress mammalian model includes a cold stress mouse model, a cold stress rat model and a cold stress monkey model.

[0013] In one embodiment of the present invention, when the low temperature stress mammal model is a low temperature stress mouse model, the constructed plasmid for expressing the NPAFP protein is a Donor vector plasmid, and the insertion site in the mouse body is H11.

[0014] Furthermore, the low temperature stress aquatic organism model includes a low temperature stress fish model, a low temperature stress bivalve model, a low temperature stress shrimp model and a low temperature stress phytoplankton model.

[0015] Furthermore, the low temperature stress fish model includes a low temperature stress tilapia model, a low temperature stress zebrafish model and a low temperature stress crucian carp model.

[0016] In one embodiment of the present invention, when the low temperature stress aquatic organism model is a low temperature stress tilapia model, the plasmid expressing the NPAFP protein and the Tol2 transposase are co-injected into the one-cell stage of the tilapia embryo.

[0017] In one embodiment of the present invention, when the low temperature stress aquatic organism model is a low temperature stress zebrafish model, the plasmid expressing the NPAFP protein and the Tol2 transposase are co-injected into the zebrafish embryo at the one-cell stage.

[0018] In a second aspect, the present invention provides a method for preparing a cold stress mouse model, wherein a plasmid expressing NPAFP protein is introduced into the mouse body through gene editing technology to obtain heterozygous and homozygous individuals that stably inherit and express NPAFP protein; the preparation method comprises the following steps:

[0019] (1) Plasmid construction: Construct a donor vector plasmid expressing NPAFP using the CAG promoter;

[0020] (2) Construction of specific primers: Design specific primers targeting the NPAFP gene at the 5' and 3' ends of the H11 insertion site, as well as the upstream and downstream regions of the H11 insertion site;

[0021] (3) Microinjection: The sample in (1) was microinjected into the fertilized eggs of mice with a C57BL / 6JGpt background. The fertilized eggs that survived the injection were transplanted into pseudopregnant female mice and waited for them to become pregnant and give birth.

[0022] (4) Genotyping: The F0 pups born to the recipient mice were tail-clipped and toe-clipped at 5-7 days old and numbered. Genomic DNA was extracted for PCR and sequencing to identify the genotype of the mice.

[0023] (5) Revealing the function of the NPAFP gene: Self-crossing of positive F1 generation mice was performed to obtain 3-month-old heterozygous and WT sibling mice to further reveal the function of the NPAFP gene;

[0024] (6) The model with NPAFP function is the low temperature stress mouse model.

[0025] Furthermore, the NPAFP protein is selected from NPAFP1, NPAFP2, NPAFP3 and / or NPAFP4; the DNA sequences of NPAFP1, NPAFP2, NPAFP3 and / or NPAFP4 are shown in SEQ ID NOs. 1 to 4, respectively.

[0026] Preferably, the NPAFP protein is NPAFP4.

[0027] In a third aspect, the present invention provides a method for preparing a low-temperature stress tilapia model, wherein a constructed plasmid expressing NPAFP protein and Tol2 transposase are co-injected into tilapia embryos using gene editing technology to obtain heterozygous individuals that stably inherit and express NPAFP protein; the preparation method comprises the following steps:

[0028] (1) Plasmid construction: Construct a plasmid expressing NPAFP using the CMV promoter;

[0029] (2) Construction of specific primers: Design of primers specific for the NPAFP gene sequence;

[0030] (3) Microinjection: The expression plasmid and Tol2 transposase were co-injected into tilapia embryos at the one-cell stage;

[0031] (4) Genotyping: Extract genomic DNA for PCR and sequencing to identify the genotype of tilapia;

[0032] (5) Revealing the function of NPAFP gene: Using the offspring of self-pollinated positive F1 generation tilapia, heterozygous siblings of 3-month-old and WT tilapia, further research revealed the function of NPAFP gene;

[0033] (6) The model with NPAFP function is the low temperature stress tilapia model.

[0034] Furthermore, the NPAFP protein is selected from NPAFP1, NPAFP2, NPAFP3 and / or NPAFP4; the DNA sequences of NPAFP1, NPAFP2, NPAFP3 and / or NPAFP4 are shown in SEQ ID NOs. 1 to 4, respectively.

[0035] Preferably, the NPAFP protein is NPAFP4.

[0036] In a fourth aspect, the present invention provides a method for preparing a low-temperature stress zebrafish model, wherein a constructed plasmid expressing NPAFP protein and Tol2 transposase are co-injected into zebrafish embryos using gene editing technology to obtain heterozygous individuals that stably inherit and express NPAFP protein; the preparation method comprises the following steps:

[0037] (1) Plasmid construction: Construct a plasmid expressing NPAFP using the CMV promoter;

[0038] (2) Construction of specific primers: Design of primers specific for the NPAFP gene sequence;

[0039] (3) Microinjection: co-inject the expression plasmid and Tol2 transposase into zebrafish embryos at the one-cell stage;

[0040] (4) Genotype identification: Extract genomic DNA for PCR and sequencing identification to identify the genotype of zebrafish;

[0041] (5) Revealing the function of the NPAFP gene: Using the offspring of self-pollinated positive F1 generation zebrafish, heterozygous siblings of 3-month-old zebrafish and WT zebrafish, further studies were conducted to reveal the function of the NPAFP gene;

[0042] (6) The model with NPAFP function is the low temperature stress zebrafish model.

[0043] Furthermore, the NPAFP protein is selected from NPAFP1, NPAFP2, NPAFP3 and / or NPAFP4; the DNA sequences of NPAFP1, NPAFP2, NPAFP3 and / or NPAFP4 are shown in SEQ ID NOs. 1 to 4, respectively.

[0044] Preferably, the NPAFP protein is NPAFP4.

[0045] In a fifth aspect, the present invention provides a use of the low temperature stress biological model as described in the first aspect in studying oxidative stress-related diseases, wherein the oxidative stress-related diseases include but are not limited to oxidative stress caused by low temperature.

[0046] In a sixth aspect, the present invention provides an application of the low temperature stress biological model as described in the first aspect in aquaculture.

[0047] Beneficial effects

[0048] This study successfully constructed a mouse model expressing NPAFP protein using homologous recombination technology and used the CAG promoter to drive stable expression of NPAFP protein in mice. These transgenic mice will serve as a foundation for studying the function of NPAFP protein in mammals, particularly the physiological responses and mechanisms under cold stress.

[0049] By constructing a transgenic tilapia model that stably expresses NPAFP protein, the survival rate of tilapia in low temperature environments can be improved, providing a new solution for the sustainable development of the aquaculture industry.

[0050] By constructing a zebrafish model that stably expresses NPAFP protein, we further explored the cold-resistance function of NPAFP in aquatic organisms and verified its potential in protecting against low temperature stress and oxidative stress. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 Construction and experimental design of mice stably expressing and inheriting NPAFP.

[0052] Figure 2 Construction and experimental design of tilapia stably expressing and genetically encoding NPAFP.

[0053] Figure 3 Construction and experimental design of zebrafish stably expressing and genetically encoding NPAFP.

[0054] Figure 4 Low temperature stress experiment on NPAFP-transfected mouse tilapia and zebrafish. DETAILED DESCRIPTION

[0055] The following is a further description of specific embodiments of the present invention. It should be noted that the description of these embodiments is intended to facilitate understanding of the present invention and does not constitute a limitation of the present invention. In addition, the technical features involved in the embodiments described below may be combined with each other as long as they do not conflict with each other.

[0056] The experimental methods in the following examples are conventional methods unless otherwise specified, and the experimental materials used in the following examples are commercially available unless otherwise specified.

[0057] Example 1 NPAFP and its nucleotide sequence

[0058] NPAFP is a protein composed of multiple tandem repeats of the AFPIII domain. NPAFP1 contains one AFPIII domain, NPAFP2 contains two AFPIII domains, NPAFP3 contains three AFPIII domains, and NPAFP4 contains four AFPIII domains; specifically:

[0059] Nucleotide sequence of NPAFP1:

[0060] ATGAAGTCAGTTGTTTTAACTGGTTTGCTGTTCGTCCTCCTTTGTGTCGACCACATGAGTTCAGCCAACAAGGCGTCCGGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGA TGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAATAA

[0061] Nucleotide sequence of NPAFP2:

[0062] ATGAAGTCAGTTGTTTTAACTGGTTTGCTGTTCGTCCTCCTTTGTGTCGACCACATGAGTTCAGCCAACAAGGCGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAATAA

[0063] Nucleotide sequence of NPAFP3:

[0064] ATGAAGTCAGTTGTTTTAACTGGTTTGCTGTTCGTCCTCCTTTGTGTCGACCACATGAGTTCAGCCAACAAGGCGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAA

[0065] Nucleotide sequence of NPAFP4:

[0066] ATGAAGTCAGTTGTTTTAACTGGTTTGCTGTTCGTCCTCCTTTGTGTCGACCACATGAGTTCAGCCAACAAGGCGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAAGATGTGACGACATGTCCAGGCTTTAAGTCCGTGGTGGCCAACCAGCTGATCCCCATAAATACTGCCCTGACTCTAGTGATGATGAAGGCGGAGGAAGTCAGCCCAAAGGGCATCCCTGCCGAGGAGATCCCCAGAATAGTGGGAATGCAAGTGAACAGGGCAGTGTATCTGGAGCAAACCCTCATGCCAGATATGGTGAAAAACTATGAATAA

[0067] Example 2 Construction of a mouse model stably expressing and genetically inheriting NPAFP

[0068] 2.1 Experimental method

[0069] Plasmid construction: The donor vector plasmid expressing NPAFP was constructed using the CAG promoter;

[0070] Construction of specific primers: Design specific primers targeting the NPAFP gene at the 5' and 3' ends of the H11 insertion site, as well as upstream and downstream regions of the H11 insertion site (Tables 1 and 2);

[0071] Microinjection: CRISPR / Cas9 and the donor vector are used to microinject the sample into fertilized eggs of C57BL / 6JGpt mice. Surviving fertilized eggs are then transplanted into pseudopregnant female mice, which are then allowed to become pregnant and give birth.

[0072] Genotyping: The F0 pups born to the recipient mice were tail-clipped and toe-clipped at 5-7 days old and numbered. Genomic DNA was extracted for PCR and sequencing to identify the genotype of the mice.

[0073] The function of the NPAFP gene was revealed: positive F1 mice were self-crossed to obtain WT and positive sibling mice, and the function of the NPAFP gene was further revealed.

[0074] The model with NPAFP function is the low temperature stress mouse model.

[0075] Table 1. Specific primers for constructing a homozygous mouse model of low temperature stress

[0076] 5'arm F 1: AGTCTTTCCCTTGCCTCTGCT R 1: AGGCGGGCCATTTACCGTAAGTTA 3'arm F 2: TCAATCCAGCGGACCTTCCTT R 2: ATATCCCCTTGTTCCCTTTCTGC WT F 3: AGTCTTTCCCTTGCCTCTGCT R 3: GGGTCTTCCACCTTTCTTCAG

[0077] Table 2. Specific primers for the construction of a heterozygous mouse model of low temperature stress

[0078] 5'arm F 1: AGTCTTTCCCTTGCCTCTGCT R 1: AGGCGGGCCATTTACCGTAAGTTA 3'arm F 2: TCAATCCAGCGGACCTTCCTT R 2: GGGTCTTCCACCTTTCTTCAG WT F 3: AGTCTTTCCCTTGCCTCTGCT R 3: GGGTCTTCCACCTTTCTTCAG

[0079] 2.2 Test results

[0080] like Figure 1 As shown in Figure A, a donor vector plasmid expressing NPAFP was constructed using the CAG promoter, and the NPAFP expression plasmid was inserted into the H11 site of C57BL / 6 mice using homologous recombination technology. Figure 1 As shown in Figure B, specific primers targeting the NPAFP gene were designed at the 5' and 3' ends of the H11 insertion site, as well as the upstream and downstream regions of the H11 insertion site. Figure 1 Middle C and Figure 1Figure D shows the results of mouse genotyping using PCR electrophoresis. This indicates that homozygous and heterozygous mice that stably express NPAFP1 protein were successfully generated, and heterozygous mice that stably express NPAFP4 protein were also successfully constructed. These transgenic mice can be used to study the role of NPAFP in resistance to cold stress and diseases related to oxidative stress.

[0081] Example 3 Construction of a Tilapia Model Stably Expressing and Genetically Expressing NPAFP

[0082] 3.1 Test method

[0083] Plasmid construction: The plasmid expressing NPAFP was constructed using the CMV promoter;

[0084] Construction of specific primers: Design primers specific for the NPAFP gene sequence (Table 3);

[0085] Microinjection: The expression plasmid and Tol2 transposase were co-injected into tilapia embryos at the one-cell stage;

[0086] Genotyping: Extract genomic DNA for PCR and sequencing to identify the genotype of tilapia;

[0087] The function of NPAFP gene was revealed: The function of NPAFP gene was further revealed by using the offspring of self-pollinated positive F1 generation tilapia, heterozygous siblings of 3-month-old and WT tilapia;

[0088] The model with NPAFP function is the low temperature stress tilapia model.

[0089] Table 3. Specific primers for constructing the low temperature stress model of tilapia

[0090] F ATGAAGTCAGTTGTTTTAACTGG R CTCATAGTTTTTCACCATATCTGG

[0091] 3.2 Test results

[0092] like Figure 2 As shown in Figure A, the CMV promoter was used to drive the expression of NPAFP protein, and the expression plasmid and Tol2 transposase were co-injected into the one-cell stage of tilapia embryos. Figure 2 As shown in Figure B, the Tol2 transposase randomly inserts the NPAFP gene containing the CMV promoter into the tilapia genome, forming stable transgenic individuals. Due to the randomness of the insertion, the insertion site cannot be predicted in advance. Therefore, PCR amplification of the NPAFP gene sequence was performed using designed specific primers, and transgenic individuals were identified by PCR electrophoresis ( Figure 2 C). The test results are as follows Figure 2As shown in middle D, heterozygous tilapia individuals that stably inherited and expressed NPAFP1 and NPAFP4 proteins were obtained.

[0093] Example 4 Construction of a zebrafish model stably expressing and genetically expressing NPAFP

[0094] 4.1 Test method

[0095] Plasmid construction: The plasmid expressing NPAFP was constructed using the CMV promoter;

[0096] Construction of specific primers: Design primers specific for the NPAFP gene sequence (Table 4);

[0097] Microinjection: The expression plasmid and Tol2 transposase were co-injected into tilapia embryos at the one-cell stage;

[0098] Genotype identification: Extract genomic DNA for PCR and sequencing identification to identify the zebrafish genotype;

[0099] The function of the NPAFP gene was revealed: The function of the NPAFP gene was further revealed using the offspring of self-pollinated positive F1 generation zebrafish, heterozygous siblings of 3-month-old zebrafish, and WT zebrafish;

[0100] The model with NPAFP function is the low temperature stress zebrafish model.

[0101] Table 4. Specific primers for constructing a low temperature stress zebrafish model

[0102] F ATGAAGTCAGTTGTTTTAACTGG R CTCATAGTTTTTCACCATATCTGG

[0103] 4.2 Test results

[0104] like Figure 3 As shown in Figure A, the CMV promoter was used to drive the expression of NPAFP protein, and the expression plasmid was co-injected with Tol2 transposase into the one-cell stage of zebrafish embryos. Figure 3 As shown in Figure B, the Tol2 transposase randomly inserts the NPAFP gene containing the CMV promoter into the zebrafish genome, forming stable transgenic individuals. Due to the randomness of the insertion, the insertion site cannot be predicted in advance. Therefore, PCR amplification of the NPAFP gene sequence was performed using designed specific primers, and transgenic individuals were identified by PCR electrophoresis ( Figure 3 C). The test results are as follows Figure 3 As shown in middle D, zebrafish heterozygous individuals that stably inherit and express NPAFP1 and NPAFP4 proteins were obtained.

[0105] Example 5: Low temperature tolerance of animal models

[0106] The obtained transgenic mouse, tilapia and zebrafish models were subjected to low temperature stress experiments.

[0107] 5.1 Mouse cold stress test

[0108] Figure 4 China A and Figure 4 Middle B is a low temperature stress experiment on mice transfected with NPAFP.

[0109] like Figure 4 As shown in center A, transgenic mice and their WT siblings were treated at 4°C, and the tails of the mice were observed after 6 weeks.

[0110] like Figure 4 As shown in Figure B, NPAFP significantly improved the transgenic mice's ability to tolerate low temperatures. Compared with the tails of WT mice, the tails of NPAFP mice were less severely frostbitten, and the tails of mice expressing NPAFP4 were more normal than those of mice expressing NPAFP1, and had a stronger ability to resist low temperatures.

[0111] 5.2 Tilapia low temperature stress test

[0112] Figure 4 Middle C and Figure 4 Figure D shows the low temperature stress experiment of NPAFP-transgenic tilapia.

[0113] like Figure 4 As shown in middle C, the transgenic tilapia and their WT tilapia were cooled in a gradient manner and maintained at 10°C for 5 h before being rewarmed to observe the survival of the fish.

[0114] like Figure 4 As shown in D, the statistical results show that NPAFP significantly improves the low temperature tolerance of transgenic tilapia, and the low temperature tolerance of tilapia expressing NPAFP4 is stronger than that of NPAFP1.

[0115] 5.3 Zebrafish low temperature stress test

[0116] Figure 4 Zhong E and Figure 4 Figure F in the middle shows a low temperature stress experiment on zebrafish transfected with NPAFP.

[0117] like Figure 4 As shown in E, transgenic zebrafish and their WT zebrafish were treated at 12°C for 12 h and then rewarmed to observe their body conditions.

[0118] like Figure 4 As shown in F, the phenotype observation indicated that NPAFP significantly improved the cold tolerance of transgenic zebrafish, and the effect of NPAFP4 was better than that of NPAFP1.

[0119] In summary, NPAFP significantly improves cold tolerance in transgenic tilapia and zebrafish, and this tolerance is proportional to the number of AFPIII domains. These transgenic mice, tilapia, and zebrafish can be used to functionally validate cold stress resistance and for applications in oxidative stress-related disease models.

Claims

1. A method for preparing a low temperature stress mouse model, wherein the low temperature stress mouse model is prepared by introducing a constructed plasmid expressing NPAFP protein into a mouse body through gene editing technology to obtain heterozygous and homozygous individuals that stably inherit and express NPAFP protein; the NPAFP protein is selected from NPAFP1, NPAFP2, NPAFP3 or NPAFP4; the DNA sequences of NPAFP1, NPAFP2, NPAFP3 and NPAFP4 are shown in SEQ ID NO.1-4 respectively; the preparation method comprises the following steps: (1) Plasmid construction: Use CAG promoter to construct the Donor vector plasmid expressing NPAFP; (2) Construction of specific primers: Design specific primers targeting the NPAFP gene at the 5' and 3' ends of the H11 insertion site, as well as in the upstream and downstream regions of the H11 insertion site; (3) Microinjection: The sample in (1) was microinjected into the fertilized eggs of mice with a C57BL / 6JGpt background. The fertilized eggs that survived the injection were transplanted into pseudopregnant female mice and waited for them to become pregnant and give birth. (4) Genotyping: The F0 pups born to the recipient mice were tail-clipped and toe-clipped at 5-7 days old and numbered. Genomic DNA was extracted for PCR and sequencing to identify the genotype of the mice. (5) Revealing the function of the NPAFP gene: Using positive F1 generation mice for self-fertilization, we obtained 3-month-old heterozygous and WT mice of the same generation to further study and reveal the function of the NPAFP gene; (6) The model with NPAFP function is the cold stress mouse model.

2. A method for preparing a low temperature stress tilapia model, wherein the low temperature stress tilapia model is injected into tilapia embryos with a constructed plasmid expressing NPAFP protein and Tol2 transposase by gene editing technology to obtain a heterozygous individual that stably inherits and expresses NPAFP protein; the NPAFP protein is selected from NPAFP1, NPAFP2, NPAFP3 or NPAFP4; the DNA sequences of NPAFP1, NPAFP2, NPAFP3 and NPAFP4 are shown in SEQ ID NO.1-4 respectively; the preparation method comprises the following steps: (1) Construction of plasmid: Use CMV promoter to construct a plasmid expressing NPAFP; (2) Construction of specific primers: Design of primers specific to the NPAFP gene sequence; (3) Microinjection: The expression plasmid and Tol2 transposase were co-injected into tilapia embryos at the one-cell stage; (4) Genotype identification: Extract genomic DNA for PCR and sequencing to identify the genotype of tilapia; (5) Revealing the function of the NPAFP gene: Using the self-fertilized offspring of the positive F1 generation tilapia, the heterozygous siblings of 3-month-old and WT tilapia, further studies revealed the function of the NPAFP gene; (6) The model with NPAFP function is the low temperature stress tilapia model.

3. A method for preparing a low temperature stress zebrafish model, wherein the low temperature stress zebrafish model is injected into zebrafish embryos with a constructed plasmid expressing NPAFP protein and Tol2 transposase by gene editing technology to obtain a heterozygous individual that stably inherits and expresses NPAFP protein; the NPAFP protein is selected from NPAFP1, NPAFP2, NPAFP3 or NPAFP4; the DNA sequences of NPAFP1, NPAFP2, NPAFP3 and NPAFP4 are shown in SEQ ID NO.1-4 respectively; the preparation method comprises the following steps: (1) Construction of plasmid: Use CMV promoter to construct a plasmid expressing NPAFP; (2) Construction of specific primers: Design of primers specific to the NPAFP gene sequence; (3) Microinjection: The expression plasmid and Tol2 transposase were co-injected into zebrafish embryos at the one-cell stage; (4) Genotype identification: Extract genomic DNA for PCR and sequencing identification to identify the genotype of zebrafish; (5) Revealing the function of the NPAFP gene: Using the offspring of self-fertilized positive F1 generation zebrafish, heterozygous siblings of 3-month-old zebrafish and WT zebrafish, further studies revealed the function of the NPAFP gene; (6) The model with NPAFP function is the low temperature stress zebrafish model.

Images