Use of an IMPDH2 inhibitor in preventing or treating inflammation

Abstract

The present invention discloses an application of an IMPDH2 inhibitor in preventing or treating inflammation. The limonoid compound provided by the present invention can bind to and degrade human inosine-5'-monophosphate dehydrogenase 2 (IMPDH2), inhibit the synthesis of intracellular guanine, inhibit the activation of the NF-κB signaling pathway, and can be used as an IMPDH2 inhibitor; the IMPDH2 inhibitor also has a good preventive or therapeutic effect on inflammation. Compared with existing IMPDH2 inhibitors, the limonoid compound provided by the present invention can degrade the IMPDH2 enzyme, has better inhibitory activity, and has stronger activity in inhibiting inflammatory factors.

Description

Technical Field

[0001] The present invention relates to the field of medical applications, and in particular to an application of an IMPDH2 inhibitor in preventing or treating inflammation. Background Art

[0002] Inflammation is a biological defense that protects the body from damage to biological tissues that may be caused by external physical and chemical stimuli or invasion of microorganisms including bacteria, fungi and viruses. Inflammatory diseases bring great pain to patients and seriously affect their quality of life. Inflammation can cause some cardiovascular and cerebrovascular diseases and diabetes, and even induce cancer. When the inflammatory factors produced by chronic inflammation continue to exist in excessive amounts, it can lead to a decline in body function, such as causing the body to experience chronic inflammatory aging. They can accelerate human aging and induce middle-aged and elderly diseases such as Parkinson's disease, Alzheimer's disease and osteoporosis.

[0003] Human inosine-5'-monophosphate dehydrogenase (IMPDH) is the major rate-limiting enzyme involved in the biosynthesis of guanosine and deoxyguanosine and is widely expressed in immune cells. There are two IMPDH isoforms, IMPDH1 and IMPDH2, which are encoded by different genes. A special feature of many inflammation-related diseases is the high expression of IMPDH isoform II (IMPDH2) in rapidly proliferating immune cells. Therefore, selectively targeting IMPDH2 with small molecule compounds is an attractive target for the development of anti-inflammatory drugs with low side effects.

[0004] Currently, the IMPDH2 inhibitor used clinically includes mycophenolic acid (MPA), as shown in structural formula II. Mycophenolic acid works by inhibiting the activity of IMPDH2 enzyme, but it has poor selectivity, inhibits IMPDH1 at the same time, and causes gastrointestinal side effects.

[0005] Summary of the invention

[0006] In view of the deficiencies of the prior art, the present invention provides an application of an IMPDH2 inhibitor in the preparation of a drug for preventing or treating inflammation. The IMPDH2 inhibitor provided by the present invention is a limonin compound, which can accelerate the degradation of IMPDH2 in cells and can be used to prepare an IMPDH2 inhibitor; in addition, the compound has a significant inhibitory effect on inflammatory factors released by immune cells and can be used as an anti-inflammatory drug for the treatment of inflammatory diseases.

[0007] In order to solve the above technical problems, the technical solution of the present invention is as follows: Use of a limonoid compound in the preparation of an IMPDH2 inhibitor, wherein the compound has a structural formula as shown in Formula I:

[0008] .

[0009] As a further description of the above scheme: the compound can degrade or inhibit IMPDH2, inhibit the synthesis of intracellular guanine and inhibit the activation of NF-κB signaling pathway.

[0010] The present invention also provides an application of the limonoid compound in preparing a drug for treating or preventing inflammation.

[0011] As a further description of the above scheme: the compound can inhibit the expression levels of inflammatory factors IL-1β and IL-6.

[0012] As a further description of the above scheme: the compound is used alone or in combination with other drugs or in combination with a drug carrier.

[0013] As a further description of the above scheme: the compound has the structure shown in Formula I or a pharmaceutically acceptable salt thereof as a pharmaceutically active ingredient.

[0014] Preferably, the mass fraction of the active pharmaceutical ingredient is 0.1% to 99%; further preferably, the mass fraction of the active pharmaceutical ingredient is 0.1% to 30%.

[0015] The present invention detects the binding ability of limonoid compounds (Compound I) with IMPDH2, and proves that there is a strong binding ability between Compound I and IMPDH2, and the binding signal increases with the increase of the molar concentration of Compound I. Compared with mycophenolic acid (Compound II), Compound I has a higher binding affinity with IMPDH2. Compound I can effectively inhibit intracellular guanine synthesis and reduce intracellular guanine content. Compound I can effectively accelerate IMPDH2 degradation through the proteasome pathway rather than the lysosome pathway. Compound I can also effectively inhibit the expression of the intracellular NF-κB signaling pathway. The compounds provided by the present invention are used to prepare drugs for treating or preventing diseases or conditions mediated by IMPDH2, and the diseases or conditions include: inflammation, immune system diseases or nervous system diseases.

[0016] Lipopolysaccharide (LPS) treatment of immune cells induced increased expression levels of inflammatory factors IL-1β and IL-6. Compound I treatment of immune cells significantly reduced the expression levels of LPS-induced inflammatory factors IL-1β and IL-6, proving that limonoid compound I has anti-inflammatory effects while not significantly affecting cell growth viability. It has a stronger anti-inflammatory effect than compound II.

[0017] Compared with the prior art, the present invention has the following beneficial effects: the present invention finds that compound I can bind to and degrade human inosine-5'-monophosphate dehydrogenase 2 (IMPDH2), inhibit the synthesis of intracellular guanine, and inhibit the activation of the NF-κB signaling pathway. The inhibitory effect of compound I is equivalent to that of small interfering RNA (siRNA) of IMPDH2.

[0018] Compared with existing IMPDH2 inhibitors, the limonoid compounds provided by the present invention degrade IMPDH2 protein faster and more, and have better water solubility; in addition, the compounds also have a good preventive or therapeutic effect on inflammation. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 A is the result of the direct binding of compound I and compound II of the present invention to IMPDH2; A is the result of the direct binding of compound I to IMPDH2 enzyme; B is the result of the direct binding of compound II to IMPDH2 enzyme;

[0020] Figure 2 The results of the determination of the intracellular guanine level reduced by the compound I of the present invention; A is a peak graph of the intracellular guanine content after the immune cells were treated with the compound I detected by liquid chromatography-mass spectrometry (LC-MS / MS); Figure B is a statistical graph of the guanine content in Figure A;

[0021] Figure 3 The results of the determination of the accelerated degradation of IMPDH2 enzyme by the compound I of the present invention; A is the change in the content of IMPDH2 enzyme detected by Western Blot experimental technology after the cells were treated with the compound I (0, 0.5, 1 and 2 µM) at a concentration gradient; B is the change in the content of IMPDH2 enzyme detected by Western Blot experimental technology at different times after the cells were treated with the protein synthesis inhibitor cyclohexyl imine (CHX) together with DMSO or compound I; Figure C is a statistical graph of the IMPDH2 content at different times in Figure B;

[0022] Figure 4 The results of the determination of the inhibition of NF-κB signaling pathway proteins by compound I of the present invention through the inhibition of IMPDH2;

[0023] Figure 5 The results of the determination of the effects of compound I and compound II of the present invention on cell activity; Figure A shows the effects of compound I and compound II on cell activity after treating THP-1 cells; Figure B shows the effects of compound I and compound II on cell activity after treating Raw264.7 cells;

[0024] Figure 6The figures are the results of anti-inflammatory activity determination of compound I and compound II of the present invention; A is the effect of compound I and compound II on the RNA content of IL-6 in immune cells THP-1; B is the effect of compound I and compound II on the RNA content of IL-1β in immune cells THP-1; C is the effect of compound I and compound II on the protein content of IL-6 in immune cells THP-1; D is the effect of compound I and compound II on the protein content of IL-1β in immune cells THP-1; E is the effect of compound I on the RNA content of IL-6 in immune cells Raw264.7; F is the effect of compound I on the RNA content of IL-1β in immune cells Raw264.7. DETAILED DESCRIPTION

[0025] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments, but the present invention is not limited to the following technical solution.

[0026] The compound I mentioned in the following examples is as shown in Formula I, and the compound I is prepared according to the method of the example of CN202410595834.5 patent.

[0027]

[0028] Example 1 Determination of direct binding of compounds Ⅰ and Ⅱ to IMPDH2

[0029] The IMPDH2 enzyme was coupled to a CM5 chip using a Biacore T200 instrument, and the coupling buffer was sodium acetate buffer pH=4.0. The concentration gradients of compound I and compound II were 1 µM, 2 µM, 4 µM, 8 µM, 16 µM, 32 µM and 64 µM, respectively, to conduct binding experiments with the coupled IMPDH2 protein.

[0030] Experimental results: Figure 1 The ordinate in A represents the binding ability of compound I to IMPDH2. The larger the value, the stronger the binding ability. The abscissa represents the reaction time. The binding signal increases with the increase of the molar concentration of compound I. Figure 1 As shown in A, 2 µM compound I began to have the ability to bind to the IMPDH2 protein (RU>0). According to the results, the maximum dissociation constant of compound I binding to IMPDH2 is KD=1.973E -5 (M). Figure 1 As shown in B, compound II begins to bind to IMPDH2 at 1 µM, and the maximum dissociation constant for binding to IMPDH2 is KD=3.523E -5 (M). The results show that compound I can directly bind to IMPDH2, and its binding affinity is stronger than that of compound II.

[0031] Example 2 Compound I reduces intracellular guanine levels

[0032] In order to evaluate whether compound I affects intracellular guanine levels after binding to IMPDH2, cells were inoculated in 10 cm culture dishes and treated with compound I or DMSO for 24 hours. The cells were then digested and washed with PBS. The precipitate was centrifuged and the cells were resuspended in 80% methanol solution (80% methanol and 20% water mixed). The resuspended cells were sonicated and lysed on ice for 30 minutes. The resuspended cells were centrifuged to obtain the supernatant, and the samples were analyzed for intracellular guanine content by liquid chromatography-mass spectrometry (LC-MS / MS).

[0033] Test results: Figure 2 AB shows that A is the peak graph of intracellular guanine content after treating immune cells with different concentrations of compound I (0, 0.5, 1 and 2 µM) detected by liquid chromatography-mass spectrometry (LC-MS / MS), and B is the statistical graph of A; NC group is the control group treated with DMSO, ns represents no significant difference, ** represents p <0.01. Compound I can effectively reduce the intracellular guanine content. The percentage of intracellular guanine abundance (NL) of the experimental group (compound I treatment group) in Figures A and B relative to the control group (DMSO treatment group) represents the intracellular guanine content value, that is, the control group is 100%.

[0034] Example 3 Compound I accelerates IMPDH2 protease degradation

[0035] In order to evaluate the effect of compound I on the IMPDH2 enzyme level, Western Blot experimental technology was used to detect the effect of different concentration gradients of compound I on the IMPDH2 enzyme.

[0036] The Western Blot protocol was as follows: After cell culture was completed under experimental conditions, cells were collected after washing with cold phosphate buffered saline (PBS). The cell pellet was dissolved with 2× protein sample buffer (1M Tris-HCl pH=6.8, 50% glycerol, 10% SDS, 2-mercaptoethanol and 1% bromophenol blue) and boiled at 100°C for 10 min. The prepared protein samples were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis and then transferred to a PVDF membrane (Millipore). Blocking was performed in a 5% skim milk solution for the specific coupling reaction between the protein and the antibody on the PVDF membrane. The skim milk solution was then discarded and the membrane was washed with PBST (PBS with 0.5% Tween 20). The coupling reaction between the protein and the antibody on the membrane was carried out overnight at 4°C and then washed again with PBST. Finally, the secondary antibody conjugated with horseradish peroxidase (HRP) (Cell signaling Technology) was diluted in PBST and reacted at room temperature for 2 hours. The protein content on the membrane was determined using Luminata Forte HRP substrate (Millipore).

[0037] In order to detect whether compound I shortens the half-life of IMPDH2 enzyme, cells were plated in 6-well plates, and CHX (50 μg / mL) was added with compound I or DMSO to continue to treat cells for 0, 6, 8 and 10 hours (h). Western blot experiments were performed after samples were collected at different time periods. The percentage of protein content value of the experimental group relative to the control group in Figure C represents the protein level of IMPDH2, that is, the control group (DMSO treatment group) was 100% at 0 hours.

[0038] Test results: Figure 3 As shown in A, compared with the control group DMSO (dimethyl sulfoxide), as the concentration of compound I increased, compound I reduced the IMPDH2 protein level in a concentration-dependent manner. Figure 3 BC showed that after treating cells with the protein synthesis inhibitor cycloheximide (CHX) together with compound I, compound I significantly shortened the half-life of the IMPDH2 enzyme. The above results indicate that compound I can accelerate the degradation of IMPDH2.

[0039] Example 4 Compound I inhibits NF-κB signaling pathway by inhibiting IMPDH2

[0040] The cells were plated in a 6-well plate. After the cells adhered to the wall, 200 μL Opti-MEM (serum-free transfection medium) was added to two 1.5 mL EP tubes, one of which was added with 5 μL siIMPDH2 1# or siIMPDH2 2# (interfering RNA 1 and RNA 2 for knocking down IMPDH2, a total of 2 sequences), and the other was added with 5 μL lipo2000 (interfering RNA transfection reagent). Each was allowed to stand for 5 minutes, and then the two solutions were mixed and allowed to stand at room temperature for 20 minutes. After the end, 400 μL of the solution was added to the adhered cells, and the solution was changed after 6-8 hours. After 48 hours, when siRNA was successfully expressed, compound I or DMSO was added to continue treatment for 48 hours. TNFα was added for stimulation 15 minutes before collecting the samples, and the samples were collected for Westren bolt experiment to detect the expression of NF-κB downstream proteins.

[0041] Interfering RNA No. 1 SEQ ID No. 1: GGUAUGGGUUCUCUCGAUG;

[0042] Interfering RNA No. 2 SEQ ID No. 2: AAGGGUCAAUCCACAAAUU.

[0043] Test results: Figure 4 It can be seen that compound I can effectively inhibit the protein levels of phosphorylated IKBα and phosphorylated IKKα / Β, and can also inhibit the protein levels of both after knocking down IMPDH2. Moreover, when IMPDH2 is knocked down and compound I is added, the inhibition level is more significant, indicating that compound I can inhibit the expression of NF-κB signaling pathway by inhibiting the IMPDH2 protein level.

[0044] Example 5 Results of the measurement of the effects of compound I and compound II on cell activity

[0045] In order to detect whether compound I, compound II and LPS (lipopolysaccharide) can cause cell damage and death, the CCK8 kit was used to detect cell viability. The CCK8 method was used to detect cell growth inhibition. The CCK-8 experiment, full name Cell Counting Kit-8, is a commonly used method for detecting cell proliferation and cytotoxicity. The CCK-8 experimental principle is based on the compound WST-8 (2-(2-methoxy-4-nitrophenyl)-3-(4-nitrophenyl)-5-(2,4-disulfonic acid phenyl)-2H-tetrazole monosodium salt). In the presence of the electron carrier 1-Methoxy PMS (menadione phosphate), WST-8 can be reduced by intracellular mitochondrial dehydrogenase to generate a highly water-soluble orange-yellow formazan product. The amount of formazan generated is proportional to the number of living cells, and the color depth can reflect the metabolic activity of the cells. The absorbance at a wavelength of 450nm can be measured by an enzyme reader to indirectly reflect the number of living cells. Therefore, CCK-8 can be used to evaluate cell proliferation, cytotoxicity or the cellular effects of drugs. The specific steps of CCK8 are as follows: When performing CCK-8 detection, 3×10 5 Cells (THP-1 cells or Raw264.7 cells) were inoculated into 5 replicate wells in a 96-well plate with 90 µL of culture medium. After culturing for 24 hours, the cells were treated with different concentrations of compound I or compound II. After 48 hours of treatment, 10 µL of CCK-8 reagent was added to each well, and then the 96-well plate was incubated at 37 °C for 2 hours, and the absorbance was measured at a wavelength of 450 nm by a microplate reader. The average OD value of each well was calculated, and the changes in cell proliferation or viability were analyzed by comparing with the control group (DMSO). The percentage of the absorbance value of the experimental group relative to the absorbance value of the control group represents the cell survival rate or the cell proliferation level, that is, the control group defaults to 100%.

[0046] Test results: Figure 5 As shown in A and B, after adding LPS, compound I did not inhibit the viability of THP-1 cells and Raw264.7 cells, but compound II significantly impaired the survival of both cells at 1 μM. This shows that compound I has good tolerance and does not inhibit the growth of immune cells. ns represents no significant difference, * represents p <0.05, *** represents p <0.0001.

[0047] Example 6 Determination of anti-inflammatory activity of compound I and compound II

[0048] In order to identify whether compound I has anti-inflammatory activity, the following experiment was conducted: by treating immune cells THP-1 with lipopolysaccharide LPS, THP-1 cells were converted into inflammatory cells that release inflammatory factors. The specific experimental steps are to treat THP-1 or Raw264.7 cells with LPS for 24 hours, add compound I or II for 12 hours, extract RNA, and then perform RT-qPCR to detect the content of 18S, IL-1Β, and IL-6, and use 18S as an internal reference for statistical analysis. The RT-qPCR primer sequences are as follows:

[0049] IL-6: Forward: SEQ ID NO.3 5′-TAGTCCTTCCTACCCCAATTTCC -3′,

[0050] Reverse: SEQ ID NO. 4 5′-TTGGTCCTTAGCCACTCCTTC-3′;

[0051] IL-1β: forward: SEQ ID NO.5 5′-TGGACCTTCCAGGATGAGGACA -3′,

[0052] Reverse: SEQ ID NO.6 5′- GTTCATCTCGGAGCCTGTAGTG -3′;

[0053] 18S: Forward: SEQ ID NO.7 5′- CCTGAGAAACGGCTACCACATC -3′,

[0054] Reverse: SEQ ID NO. 8 5′- GCCTCGAAAGAGTCCTGTATTG -3′.

[0055] In addition, the ELASA kit (Shanghai Duma Biotechnology Co., Ltd., catalog number: DM4670) was used. The specific experimental steps were as follows: after THP-1 cells were treated with LPS for 24 h, compound I or II was added to treat the cells for 12 h, the treated cell suspension was collected, the precipitate was discarded after centrifugation, and the supernatant was absorbed. The levels of IL-1β and IL-6 secreted by THP-1 cells were detected according to the instructions of the ELASA kit ( Figure 6 The vertical axis represents the expression level of inflammatory factors, the horizontal axis represents the treatment conditions, ns represents no significant difference, and * represents p <0.05, ** represents p <0.01, *** represents p <0.001, *** represents p <0.0001).

[0056] Experimental results: IL-6 is a marker of early inflammation in inflammatory response. IL-6 is associated with a variety of autoimmune diseases. For example, the level of IL-6 in the serum of patients with rheumatoid arthritis, psoriasis and systemic lupus erythematosus is usually high. Figure 6 As shown in A and C, after LPS treatment of THP-1 cells, the mRNA expression level and protein content of the inflammatory factor IL-6 were induced. Compound I can significantly reduce the mRNA and protein content of the inflammatory factor IL-6 induced by LPS, and compared with compound II, compound I has stronger inhibitory ability. IL-1β plays an important role in the pathogenic process of acute and chronic inflammation, and is closely related to the pathological process of diabetes, rheumatoid arthritis and periodontitis. Figure 6 As shown in B and D, lipopolysaccharide (LPS) treatment of THP-1 cells induced an increase in the mRNA expression level and protein content of the inflammatory factor IL-1β. Compound I significantly reduced the mRNA and protein content of the inflammatory factor IL-1β induced by LPS, and compared with compound II, compound I had a stronger inhibitory ability. Figure 6 Compound I shown in E significantly reduced the mRNA content of the inflammatory factor IL-6 induced by lipopolysaccharide (LPS) treatment in Raw264.7 cells. Figure 6 Compound I shown in F significantly reduced the mRNA content of inflammatory factor IL-1β induced by lipopolysaccharide LPS treatment in Raw264.7 cells. In summary, compound I significantly reduced the expression levels of LPS-induced inflammatory factors IL-1β and IL-6, and did not affect the survival of immune cells, proving that compound I can inhibit the expression of inflammatory factors and has anti-inflammatory effects, while compound II has a weaker anti-inflammatory effect.

[0057] The above is a preferred embodiment of the present invention and is not intended to limit the present invention. Any simple modification, change and equivalent structural transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A use of a limonoid compound or a pharmaceutically acceptable salt thereof as a pharmaceutical active ingredient in the preparation of a drug for treating or preventing inflammation, characterized in that: The structural formula of the compound is shown in Formula I: Formula I.

2. Use of the limonoid compound or a pharmaceutically acceptable salt thereof according to claim 1 as a pharmaceutical active ingredient in the preparation of a drug for treating or preventing inflammation, characterized in that: The compound is used alone, or in combination with other drugs, or in combination with a drug carrier.

3. Use of the limonoid compound or a pharmaceutically acceptable salt thereof according to claim 1 as a pharmaceutical active ingredient in the preparation of a drug for treating or preventing inflammation, characterized in that: The mass fraction of the active ingredient of the medicine is 0.1%~99%.

Images