Preparation method and application of Chimonanthus nitens Oliv. leaf volatile oil for treating ulcerative colitis

Abstract

The present invention provides a preparation method for extracting volatile oil from Chimonanthus salicifolius leaves by ultrasonic-assisted steam distillation and its application in drugs for improving ulcerative colitis. The method includes crushing the Chimonanthus salicifolius leaves to a specific particle size and then performing ultrasonic treatment and steam distillation under optimized conditions, ultimately achieving a high extraction efficiency of 2.5% - 4%. The volatile oil is rich in phellandrene, α-terpineol, and (+)-limonene, accounting for more than 50% of the total mass. Pharmacological experiments show that this volatile oil can significantly reduce the levels of pro-inflammatory factors interleukin-6 (IL-6), interleukin-1β (IL-1β), and tumor necrosis factor-α (TNF-α) in the serum of mice, increase the anti-inflammatory factor interleukin-10 (IL-10); increase the expression of tight junction protein ZO-1, protect the integrity of the intestinal epithelial barrier of mice; and significantly down-regulate the expression of the prolyl hydroxylase 3 factor in the HIF-1 pathway to inhibit inflammation.

Description

Technical Field

[0001] The present invention belongs to the field of pharmaceutical technology, and particularly relates to a preparation method and application of volatile oil from Chimonanthus nitens Oliv. leaves for treating ulcerative colitis. Background Art

[0002] Ulcerative colitis (UC) is an important clinical subtype of inflammatory bowel disease (IBD). Currently, the cause of the disease is unknown, and it mainly presents as chronic and diffuse colitis. The disease can occur at any age, but is mainly seen in people aged 20 - 40. The lesion site is mainly limited to the mucosal layer of the colon, and is mainly ulcerative, mostly involving the rectum and distal colon, but can extend proximally and even throughout the colon. The main symptoms of patients are diarrhea and constipation. In the initial stage, the symptoms are relatively mild, with mucus on the surface of the feces. After that, the number of bowel movements increases, and in severe cases, it is in the form of pasty soft stools. Hematochezia is a common symptom of UC, and its cause is related to local ischemia of the colonic mucosa and increased activity of fibrinolytic enzymes. Patients in the acute exacerbation phase may have manifestations such as fever, electrolyte imbalance, protein and vitamin deficiency, anemia, and weight loss. So far, the pathogenesis of UC is still unclear. Current research shows that the onset and progression of UC are related to many factors, such as family genetics, poor eating habits, intestinal microenvironment disorder, intestinal mucosal barrier damage, immune response disorder, etc.

[0003] Existing drugs for treating ulcerative colitis are mostly aminosalicylates, corticosteroids, immunomodulators, etc. However, these drugs have disadvantages such as large toxic and side effects and high recurrence rate. Therefore, it is of great significance to seek more effective treatment means with fewer side effects.

[0004] Chimonanthus nitens Oliv. Chimonanthus salicifolius H. H. Hu is a plant unique to China in the genus Chimonanthus of the family Calycanthaceae, mainly distributed in the southeast of China. In 2014, China recognized Chimonanthus nitens Oliv. as a new food raw material. Chimonanthus nitens Oliv. is also one of the most widely used Chinese herbal medicines by the She ethnic group, and has pharmacological effects such as antibacterial, antioxidant, anti - inflammatory, immunomodulatory, and anti - tumor effects.

[0005] In the prior art, the extraction efficiency of volatile oil from Chimonanthus nitens Oliv. leaves is relatively low. The present invention improves the extraction process of volatile oil, and the extraction rate of volatile oil from Chimonanthus nitens Oliv. leaves is relatively high. Moreover, it is found that the volatile oil from Chimonanthus nitens Oliv. leaves can improve the condition of ulcerative colitis mice and protect the integrity of the intestinal epithelial barrier of mice. Summary of the Invention

[0006] The technical field involved in the present invention is the field of pharmaceutical technology. The purpose of the present invention is to provide a preparation method and application of volatile oil from Chimonanthus nitens Oliv. leaves for treating ulcerative colitis.

[0007] To achieve the above-mentioned invention object, the present invention provides the following technical solutions: After drying the leaves of Chimonanthus nitens Oliv. in the shade, extract them by ultrasonic-assisted steam distillation method, which specifically includes the following steps: ① Crush the leaves of Chimonanthus nitens Oliv.; Step ② Conduct ultrasonic treatment in water; Step ③ Steam distillation, with the extraction temperature being 110 °C; Step ④ Separate water and oil; Obtain the volatile oil of Chimonanthus nitens Oliv. leaves with an extraction rate of 2.5% - 4%.

[0008] Further, in the above-mentioned step ①, after the leaves of Chimonanthus nitens Oliv. are crushed, the particle size is larger than 20 mesh;

[0009] Preferably, in the above-mentioned step ②, the ultrasonic frequency of the ultrasonic treatment is 30 - 40 kHz, the ultrasonic time is 1 - 3 h, and the ultrasonic temperature is 30 - 50 °C;

[0010] Preferably, in the above-mentioned step ②, the mass ratio of water to the leaves of Chimonanthus nitens Oliv. is 1:10 - 1:30;

[0011] Preferably, between step ② and step ③, there is also an immersion step, and the immersion time is 0 - 4 h;

[0012] Preferably, the steam extraction time in the above-mentioned step ③ is 3 - 7 h;

[0013] Further, the volatile oil of the leaves of Chimonanthus nitens Oliv. contains phellandrene, α-terpineol, and (+)-limonene, and the sum of the masses of phellandrene, α-terpineol, and (+)-limonene is greater than 50% of the total mass of the volatile oil;

[0014] Further, the volatile oil obtained by the above-mentioned scheme can be used for preparing drugs for treating ulcerative colitis;

[0015] Further, the above-mentioned drug includes directly using the volatile oil of the leaves of Chimonanthus nitens Oliv. or mixing the volatile oil of the leaves of Chimonanthus nitens Oliv. with other pharmaceutically acceptable excipients.

[0016] The pharmacological experiments of the present invention show that the volatile oil of the leaves of Chimonanthus nitens Oliv. can protect the integrity of the intestinal epithelial barrier of mice by increasing the expression of tight junction protein ZO-1; (+)-limonene, α-terpineol, and phellandrene in the volatile oil of the leaves of Chimonanthus nitens Oliv. significantly down-regulate the high expression of prolyl hydroxylase 3 factor in the HIF-1 pathway, and significantly reduce the expression of inflammatory factors such as IL-6, IL-1β, and TNF-α, and significantly reduce the level of inflammatory factors in the serum of mice, thereby inhibiting the occurrence of inflammation.

[0017] (1) The extraction process of the present invention is different from the prior art, and the prepared volatile oil of the leaves of Chimonanthus nitens Oliv. has a special composition. Through experiments, it has a more significant effect on improving ulcerative colitis.

[0018] (2) By screening and combinatorially optimizing relevant factors during the extraction process, such as the leaf treatment method, distillation time, solid-liquid ratio, and soaking time, the present invention has a simple preparation method and improves the extraction efficiency of volatile oils.

[0019] (3) The volatile oil from Chimonanthus salicifolius leaves provided by the present invention can inhibit the high expression of the prolyl hydroxylase 3 factor in the HIF-1 pathway. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 : A shows the change in the body weight of mice during the construction of an ulcerative colitis animal model, and B shows the DAI score of mice.

[0021] Figure 2 : A shows the colon pictures of mice during the construction of an ulcerative colitis animal model, and B shows the colon length of mice.

[0022] Figure 3 : Effects of the volatile oil from Chimonanthus salicifolius leaves on the organ coefficients of mice with colitis.

[0023] Figure 4 : A shows the HE staining pictures of the colon of mice in each group, B shows the AB-PAS staining pictures of the colon of mice in each group, and C shows the pathological scores of the colon of mice in each group.

[0024] Figure 5 : Levels of related inflammatory factors in the serum of mice.

[0025] Figure 6 : Effects of the volatile oil from Chimonanthus salicifolius leaves on the mRNA expression levels of related inflammatory factors in mice with colitis.

[0026] Figure 7 : Effects of the volatile oil from Chimonanthus salicifolius leaves on the expression level of the tight junction protein ZO-1 in the colon of mice.

[0027] Figure 8 : Explore the KEGG analysis of the volatile oil from Chimonanthus salicifolius leaves on mice with colitis.

[0028] Figure 9 : Effects of the volatile oil from Chimonanthus salicifolius leaves on the mRNA expression of prolyl hydroxylase 3 in the HIF-1 pathway.

[0029] Figure 10 : Effects of (+)-limonene, α-terpineol, and phellandrene on the mRNA expression of prolyl hydroxylase 3 in the HIF-1 pathway. DETAILED DESCRIPTION OF THE INVENTION

[0030] The following further elaborates in detail on the improvement of ulcerative colitis by the volatile oil from Chimonanthus salicifolius leaves provided by the present invention in conjunction with the accompanying drawings and specific embodiments. The Chimonanthus salicifolius leaves used in the present invention are produced in Quzhou, Zhejiang. The reagents and materials used in the embodiments are all obtained by purchasing commercially available products.

[0031] All statistical analyses were performed using SPSS, Origin, and AI software. One-way analysis of variance (ANOVA) was used for multiple group comparisons. The data were expressed as the mean ± standard deviation (SD) of the number of independent experiments. p＜0.05 For there to be a statistically significant difference, compared with the control group, ## p≤0.01 , # p＜0.05 ; compared with the model group, ** p≤0.01 , ** p＜0.05 ).

[0032] Example 1 Preparation of the Volatile Oil from Chimonanthus salicifolius Leaves

[0033] After the Chimonanthus salicifolius leaves were dried in the shade, the volatile oil from the Chimonanthus salicifolius leaves was extracted by ultrasonic-assisted steam distillation, and treatments were carried out at different solid-liquid ratios, leaf fragmentation degrees, soaking times, and distillation times. The above variables were subjected to single-factor and orthogonal experiments.

[0034] (1) Single-factor experiment

[0035] The shade-dried Chimonanthus salicifolius leaves were subjected to the following single-factor treatments: distillation times of 3, 4, 5, 6, and 7 h; solid-liquid ratios of 1:10, 1:15, 1:20, 1:25, and 1:30; soaking times of 0, 1, 2, 3, and 4 h; medicinal material particle sizes of: whole leaves, fragmented, and passed through a 20-mesh sieve; the Chimonanthus salicifolius leaves were ultrasonically treated for 1 - 3 h under an ultrasonic frequency of 30 - 40 kHz, steam distilled for 3 - 7 h, and the extraction temperature was 110°C. After the distillation ended, the water and oil were separated to obtain the volatile oil from the Chimonanthus salicifolius leaves. Single-factor experiments were carried out, with three replicates for each group of experiments. The experimental results are shown in Tables 1, 2, 3, and 4 respectively.

[0036] Table 1 Effect of distillation time on the yield of volatile oil

[0037]

[0038] Table 2 Effect of solid-liquid ratio on the yield of volatile oil

[0039]

[0040] Table 3 Effect of soaking time on the yield of volatile oil

[0041]

[0042] Table 4 Effect of Medicinal Material Granularity on Yield of Volatile Oil

[0043]

[0044] There is no simple positive correlation between the comminution fineness of Chimonanthus nitens Oliv. leaves and the extraction rate of its volatile oil. In fact, excessive comminution will instead lead to a decrease in the extraction rate of volatile oil. Different extraction processes and different active substances required may also have different requirements for the comminution degree of raw materials. Therefore, it is necessary to adjust and optimize the extraction process according to specific circumstances.

[0045] (2) Orthogonal Experiment

[0046] When the distillation time is 5, 6, 7, the solid-liquid ratio is 1:15, 1:20, 1:25, the soaking time is 1 h, 2 h, 3 h, and the medicinal material granularity is whole leaves, crushed leaves, and 20-mesh sieve, the extraction rate of volatile oil is relatively high and the extraction rate error is relatively small. Therefore, these factors are selected for orthogonal experiment. Taking the yield of Chimonanthus nitens Oliv. leaf volatile oil as the evaluation index, each experiment is repeated three times and the average value is taken. It can be seen from Table 5 that R 药材粒度 >R 浸泡时间 >R 料液比 >R 蒸馏时间 , that is, the medicinal material granularity has the greatest influence on the extraction yield of volatile oil, followed by the soaking time, the solid-liquid ratio, and the distillation time in turn. The optimal process conditions for the extraction of Chimonanthus nitens Oliv. leaf volatile oil are a distillation time of 7 h, a solid-liquid ratio of 1:15, a soaking time of 3 h, and a medicinal material granularity of crushed leaves. It can be seen from Table 6 that the distillation time, the solid-liquid ratio, the soaking time, and the medicinal material granularity all have significant effects on the test results ( p <0.01), which is consistent with the range analysis results. To further verify the reliability and repeatability of the orthogonal experiment results, 3 parallel experiments are carried out according to the optimal process conditions, and the extraction rates of Chimonanthus nitens Oliv. leaf volatile oil obtained are 3.85%, 3.875%, and 3.90%, and the average extraction rate is 3.875%. It can be seen that the established experimental process conditions have good reproducibility.

[0047] Table 5 Results and Analysis of Orthogonal Experiment

[0048]

[0049] Table 6 Results of Variance Analysis of Orthogonal Experiment

[0050]

[0051] Example 2 GC-Q / TOF MS Analysis of Chimonanthus nitens Oliv. Leaf Volatile Oil

[0052] GC-Q / TOF MS analysis conditions for the volatile oil from Chimonanthus nitens Oliv. leaves: HP-5MS capillary column (30 m × 0.25 mm × 0.25 μm, Agilent Technologies, USA); Program temperature rising process: The initial temperature is 50 °C, rising to 200 °C at a rate of 5 °C / min, and then rising to 300 °C at a rate of 20 °C / min; Carrier gas: Helium, purity 99.999%, flow rate 1.0 mL / min; Injection port temperature: 280 °C; Injection volume: 1 μL; Split ratio: 80∶1. Standard mode: EI source voltage: 70 eV; Ion source temperature: 250 °C; GC-MS interface temperature: 300 °C; Data scanning mode: TOF-Scan full scan, mass scanning range m / z 50 - 600 amu; Acquisition rate 5 spectrum / s; Solvent delay: 4 min.

[0053] A total of 50 components were identified in the volatile oil from Chimonanthus nitens Oliv. leaves, mainly monoterpenes, sesquiterpenes and their derivatives such as alcohols, ketones, aldehydes, and the contents of fatty acids and their esters were also relatively high. In addition, there were some aldehydes and alkanes. The components with relative content greater than 10% included phellandrene, α-terpineol and (+)-limonene, and the results are shown in Table 7.

[0054] Table 7 Chemical composition analysis of the volatile oil from Chimonanthus nitens Oliv. leaves

[0055]

[0056] Example 3 Establishment and grouping of ulcerative colitis mouse models

[0057] S1. Preparation of the volatile oil from Chimonanthus nitens Oliv. leaves;

[0058] The leaves of Chimonanthus nitens Oliv. were dried in the shade and then extracted by ultrasonic-assisted steam distillation method. Specifically, the leaves were crushed, ultrasonically treated for 2 h at a solid-liquid ratio of 1:15, a temperature of 40 °C and an ultrasonic frequency of 30 kHz, then soaked for 3 h and steam-distilled for 7 h. The extraction temperature was 110 °C. After distillation, the water and oil were separated to obtain the volatile oil from Chimonanthus nitens Oliv. leaves.

[0059] S2. Preparation of the water extract from Chimonanthus nitens Oliv. leaves;

[0060] Weighed 100 g of Chimonanthus nitens Oliv. leaves and placed them in a round-bottom flask. Added 8 times the amount of water for the first time and 6 times the amount of water for the second time, and refluxed and extracted twice in total, each time for 2 h. Filtered through gauze, combined the two filtrates, and concentrated them by rotary evaporation to obtain an extract, which was stored in a refrigerator at 4 °C for later use.

[0061] S3. Model establishment and grouping;

[0062] Healthy and mature male Balb / c mice at 6 - 7 weeks of age were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. After 1 week of adaptive feeding, they were grouped.

[0063] The mice were randomly divided into 6 groups: a control group, a model group, a high - dose volatile oil group (200 mg / kg), a low - dose volatile oil group (50 mg / kg), a water extract of Chimonanthus nitens Oliv. leaves group (200 mg / kg), and a mesalazine group (200 mg / kg). The volatile oil, water extract, and mesalazine were dissolved in 1% Tween 80.

[0064] Except for the control group, the other groups freely drank 3% DSS solution. Mice in the volatile oil group were gavaged with volatile oil according to the dose, mice in the water extract group were gavaged with the water extract according to the dose, mice in the mesalazine group were gavaged with mesalazine, and mice in the control group and the model group were gavaged with 1% Tween 80 for 8 consecutive days. After the successful establishment of the model, the mice were fasted but allowed to drink water for 24 h. During the modeling period, the disease activity index (DAI) and the overall condition of the mice were observed. The DAI score results are shown in Table 8; the body weight changes of the mice and the DAI scores of the mice are as Figure 1 shown.

[0065] Table 8 DAI scores

[0066]

[0067] Six days after DSS modeling, compared with the control group, the body weights of the mice in the model group, low - dose volatile oil group, high - dose volatile oil group, and water extract of Chimonanthus nitens Oliv. leaves group all showed a downward trend. On the 8th day, compared with the control group, the model group had a significant decrease. The disease activity index (DAI) mainly consists of three parts: the body weight loss rate, fecal shape, and bleeding condition, and is often used to evaluate the severity of colitis in patients. During the DSS modeling period, the DAI scores of the mice in the model group, low - dose volatile oil group, and high - dose volatile oil group gradually increased and reached the highest value on the 8th day of modeling. Compared with the control group, the DAI scores of the mice in the model group, low - dose volatile oil group, high - dose volatile oil group, and water extract of Chimonanthus nitens Oliv. leaves group all showed a significant increase; the DAI scores of the mice in the low - dose volatile oil group, high - dose volatile oil group, and water extract of Chimonanthus nitens Oliv. leaves group were significantly better than those of the model group ( Figure 1 ).

[0068] Example 4 Determination of mouse colon length and organ coefficient

[0069] The mice were sacrificed by cervical dislocation. After sacrificing the mice, they were quickly dissected, the colon length was measured and pictures were collected, and the results are as Figure 2 shown. The low - dose and high - dose volatile oils of Chimonanthus nitens Oliv. leaves can significantly inhibit the effect of model treatment on colon length. The volatile oil of Chimonanthus nitens Oliv. leaves significantly improved the symptoms of colitis and alleviated the colon shortening caused by colitis, while the water extract of Chimonanthus nitens Oliv. leaves group had no significant effect on the colon shortening of mice (Figure 2 ), indicating that the volatile oil from Chimonanthus salicifolius leaves can improve the status of model mice. Then, the visceral weights were measured, and the organ coefficients were calculated as the mass of mouse organs / body weight × 100%. The results are as Figure 3 shown.

[0070] Example 5 Staining of mouse colon tissue and histopathological scoring

[0071] Mouse colons were fixed with 4% paraformaldehyde, embedded in paraffin, sectioned routinely, and stained with hematoxylin and eosin (H&E) and Alcian blue and periodic acid-Schiff (AB-PAS). Then, the histopathological changes were observed under an optical microscope. The results are as Figure 4 shown.

[0072] The results of HE staining showed that compared with the control group, the intestinal tissue of mice in the model group was significantly damaged, mainly manifested as the destruction of crypt structure, the destruction of colonic mucosa, and the increase of inflammatory infiltration. However, alleviated intestinal tissue damage was observed in mice treated with volatile oil. The goblet cells in the colon were detected by Alcian blue staining method. Compared with the control group, the number of goblet cells in mice in the model group was significantly reduced. Compared with the model group, the number of goblet cells was significantly increased in mice treated with volatile oil. These results indicate that the volatile oil from Chimonanthus salicifolius leaves can significantly improve the colonic tissue lesions caused by the model.

[0073] Example 6 Detection of levels of related inflammatory factors in mouse serum

[0074] Blood (1.5 mL) was collected by orbital enucleation method, centrifuged at 3500 rmp for 10 min, stored at -80 °C for later use. Then, the content detection of interleukin 6 (IL-6), interleukin 1β (IL-1β), interleukin 10 (IL-10), and tumor necrosis factor α (TNF-α) was carried out using detection kits. The operation was carried out according to the instructions of the detection kits. The results are as Figure 5 shown. It can be seen that the volatile oil from Chimonanthus salicifolius leaves can significantly reduce the contents of pro-inflammatory factors IL-6, IL-1β, and TNF-α, and increase the content of anti-inflammatory factor IL-10. The results indicate that the volatile oil from Chimonanthus salicifolius leaves can significantly improve the inflammatory response in the serum of model mice. Therefore, the volatile oil from Chimonanthus salicifolius leaves was selected for subsequent research.

[0075] Example 7 mRNA expression of related inflammatory factors in colitis mice

[0076] Accurately weigh 40 mg of tissue samples into a 1.5 mL centrifuge tube containing 4 sterile steel beads, add 1 mL of RNAiso Plus reagent, and grind in a pre-cooled homogenizer at 70 Hz for 3 min to obtain tissue homogenate. Extract total RNA and perform reverse transcription operation, and the obtained cDNA is used for subsequent experiments.

[0077] Mix the reagents for fluorescence quantitative PCR experiment. The primer sequences are shown in Table 9. Using GAPDH as an internal standard, the 2 -△△CT -ΔΔCt method is used to determine the gene expression level.

[0078] Table 9 Primer sequences

[0079] gene <![CDATA[Sequence (5 ， -3 ， )]]> GAPDH F (SEQ ID NO.1) CATCACTGCCACCCAGAAGACTG GAPDH R (SEQ ID NO.2) ATGCCAGTGAGCTTCCCGTTCAG β-actin F (SEQ ID NO.3) TGTCCACCTTCCAGCAGATGT β-actin R (SEQ ID NO.4) AGCTCAGTAACAGTCCGCCTAGA IL-6 F (SEQ ID NO.5) TACCACTTCACAAGTCGGAGGC IL-6 R (SEQ ID NO.6) CTGCAAGTGCATCATCGTTGTTC IL-1β F (SEQ ID NO.7) ACTCATTGTGGCTGTGGAGA IL-1β R (SEQ ID NO.8) AGCCTGTAGTGCAGTTGTCT TNF-α F (SEQ ID NO.9) TGCTTTCTGTGCTCATGGTG TNF-α R (SEQ ID NO.10) GACTAGCCAGGAGGGAGAAC PHD3 F (SEQ ID NO.11) AAGGAGCGGTCCAAGGCAAT PHD3 R (SEQ ID NO.12) ATACAGCGGCCATCACCATT

[0080] The effects of the volatile oil from Chimonanthus salicifolius leaves on the mRNA expression levels of related inflammatory factors in colitis mice are as Figure 6 shown. It can be seen from the figure that the volatile oil from Chimonanthus salicifolius leaves can significantly down-regulate the contents of pro-inflammatory factors IL-6, IL-1β and TNF-a in colon tissues, indicating that the volatile oil from Chimonanthus salicifolius leaves has significant anti-inflammatory ability.

[0081] Example 8 Detection of the expression level of tight junction protein ZO-1 in mouse colon tissues

[0082] S1. Sample preparation;

[0083] Total protein extraction from tissues: Weigh 30 mg of colon tissues, add approximately 10 times the sample volume of complete lysis buffer (protein lysis buffer RIPA: protease inhibitor: phosphatase inhibitor = 298:1:1), and homogenize in a tissue grinder.

[0084] S2. Protein concentration determination;

[0085] To accurately determine the protein concentration, we used a BCA protein detection kit and followed the instructions to obtain the actual protein concentration of the samples.

[0086] S3. Protein denaturation;

[0087] Add 5× protein loading buffer (protein sample: loading buffer = 4:1, v:v) to the quantified protein samples, heat in a PCR instrument at 95°C for 10 min, and store in a -80°C refrigerator.

[0088] S4. SDS polyacrylamide gel electrophoresis and membrane transfer;

[0089] S4.1. Gel preparation;

[0090] Rinse the glass plates of the electrophoresis tank with clear water, rinse with pure water and then air dry naturally; select the appropriate concentration of SDS-PAGE lower layer gel according to the molecular weight of the target protein, let it stand for about 15 - 30 minutes, wait for the gel to polymerize, and pour out the isopropanol; fill the gel chamber with the prepared upper layer gel solution, and slowly insert a loading comb with the appropriate number of wells. Let it stand for about 15 - 30 minutes, the gel polymerizes, and the gel preparation is completed.

[0091] Table 10 Preparation Table of Stacking Gel and Separating Gel

[0092]

[0093] S4.2, Electrophoresis;

[0094] After the stacking gel solidifies, load the sample and perform electrophoresis; stop electrophoresis when it runs to about 1 cm from the bottom of the gel.

[0095] S4.3, Blotting;

[0096] Cut the gel according to the Marker indication, cut a mark at the upper left corner, and cover the PVDF membrane on the gel. Place the transfer tank on ice, with the black side of the transfer clip facing the black side of the transfer tank. Transfer at 150 mA for 1 h 15 min - 40 min, and the transfer time is less for smaller molecular weights.

[0097] S4.4, Primary Antibody and Secondary Antibody;

[0098] After the blotting is completed, wash the membrane with TBST solution. Prepare a 1% skim milk solution and incubate at room temperature for 2 h. After the blocking is completed, wash the membrane with TBST. Dilute the primary antibody with buffer (dilute the antibody according to the instructions), incubate at room temperature for 2 h or overnight in a 4°C refrigerator. Wash the membrane with TBST at room temperature. Add the secondary antibody (dilution ratio refer to the instruction manual), incubate gently at room temperature for 1.5 h and then wash the membrane with TBST.

[0099] S4.5, Development;

[0100] Use ECL developing solution, place the PVDF strip in the developing area, and drop the developing solution on the strip. After development is completed, use ImageJ software to accurately measure and count the gray value of the image, and the results are as Figure 7 shown.

[0101] As Figure 7 can be seen, the content of tight junction-related protein ZO-1 in the mice of the model group decreased significantly. The disruption of tight junctions led to the destruction of the paracellular barrier, and the decrease in the protein content controlling this barrier resulted in the destruction of the function of controlling the entry and exit of substances. The entry of some bacteria, endotoxins, etc. into the blood may trigger inflammation and other related diseases. While the volatile oil group of Chimonanthus nitens Oliv. leaves can up-regulate the expression level of tight junction ZO-1. It shows that the volatile oil group of Chimonanthus nitens Oliv. leaves can inhibit the occurrence of inflammation from the perspective of controlling the integrity of the intestinal barrier.

[0102] Example 9 Mechanism of Action of the Volatile Oil from the Leaves of Chimonanthus salicifolius and Ulcerative Colitis in Colonic Tissue

[0103] S1. Screening of Active Ingredients in the Volatile Oil from the Leaves of Chimonanthus salicifolius

[0104] Screen the action targets of the volatile oil from the leaves of Chimonanthus salicifolius in the TCMSP, Swiss Target Prediction, and SuperPerd databases

[0105] S2. Screening of Targets for Ulcerative Colitis

[0106] In the disease target databases (OMIM, Genecards), search for candidate targets for ulcerative colitis using "Ulcerative colitis" as the keyword. Then perform an intersection mapping with the component action targets obtained in S1 to obtain the component-disease intersection target genes, that is, the action targets of the volatile oil from the leaves of Chimonanthus salicifolius against ulcerative colitis. S3. GO and KEGG Analyses

[0107] Import the common targets into the DAVID database to obtain GO and KEGG data, and the results are as Figure 8 shown. It can be Figure 8 seen that through network pharmacology analysis, the pathway related to ulcerative colitis for the volatile oil from the leaves of Chimonanthus salicifolius may be the HIF-1 pathway

[0108] Figure 9 The results show that the expression of prolyl hydroxylase 3 factor in the mice of the model group increased, while the volatile oil group from the leaves of Chimonanthus salicifolius was able to down-regulate the expression of prolyl hydroxylase 3 factor. It indicates that prolyl hydroxylase 3 may be a key factor for the volatile oil from the leaves of Chimonanthus salicifolius to improve ulcerative colitis

[0109] Example 10 Detection of the Expression of Phellandrene, α-Terpineol, and (+)-Limonene in Cells and Prolyl Hydroxylase 3 in the HIF-1 Pathway

[0110] Take RAW264.7 cells in the logarithmic growth phase and inoculate them in 6-well plates at a density of 5×10 5 cells / well, and place them in 5% CO 2After the cells adhered to the wall in the constant temperature incubator, they were divided into a control group, a model group (lipopolysaccharide), a phellandrene group (lipopolysaccharide + phellandrene), an α-terpineol group (lipopolysaccharide + α-terpineol), and a (+)-limonene group (lipopolysaccharide + (+)-limonene). Among them, the control group was added with culture medium, and the model group was added with 125 ng / mL of lipopolysaccharide and cultured for 24 h. The phellandrene group was pretreated with phellandrene solutions at concentrations of 12.5, 25, and 50 μM for 1 h, the α-terpineol group was pretreated with α-terpineol solutions at concentrations of 12.5, 25, and 50 μM for 1 h, and the (+)-limonene group was pretreated with (+)-limonene solutions at concentrations of 12.5, 25, and 50 μM for 1 h, and then 125 ng / mL of lipopolysaccharide was added and cultured for 24 h.

[0111] According to the method for the expression of inflammatory factors and genes related to the HIF-1 pathway in the mouse colon tissue in Example 6, cDNA was obtained for fluorescence quantitative PCR experiments. The primer sequences are shown in Table 9. Using β-actin as an internal standard, the 2 -△△CT method was used to measure the expression level of the gene.

[0112] Figure 10 The results showed that the expression of prolyl hydroxylase 3 factor increased in the lipopolysaccharide model group, while the expression of prolyl hydroxylase 3 gene was downregulated after treatment with phellandrene, α-terpineol, and (+)-limonene.

[0113] Under different extraction processes and conditions, the components and contents of the volatile oil are different, and the inhibitory effects on murine colitis are also different. Experiments showed that the DAI scores of mice in the low-dose and high-dose volatile oil groups of Chimonanthus nitens Oliv. leaves were significantly better than those in the water extract group of Chimonanthus nitens Oliv. leaves. The volatile oil of Chimonanthus nitens Oliv. leaves significantly improved the symptoms of colitis and alleviated the colon shortening caused by colitis, while the water extract group of Chimonanthus nitens Oliv. leaves had no significant effect on the colon shortening of mice. In the present invention, the components of the volatile oil are mainly phellandrene, α-terpineol, and (+)-limonene, and the main components of the water extract volatile oil are flavonoid compounds. Different components of the volatile oil have different effects on murine colitis. The active components of the volatile oil extracted by the process of the present invention can inhibit the occurrence of inflammation by inhibiting the prolyl hydroxylase 3 factor of the HIF-1 pathway, reducing the pro-inflammatory factors interleukin 6 (IL-6), interleukin 1β (IL-1β), and tumor necrosis factor α (TNF-α) in the serum of mice, increasing the anti-inflammatory factor interleukin 10 (IL-10), and increasing the expression of the tight junction protein ZO-1.

[0114] As can be seen from the above embodiments, the volatile oil of Chimonanthus salicifolius leaves has a significant effect on improving ulcerative colitis. The above description is only the preferred embodiment of the present invention. It should be noted that for those of ordinary skill in the art, without departing from the principle of the present invention, several improvements and refinements can be made. It is not necessary and impossible to list all the embodiments here. The obvious improvements and refinements derived therefrom should also be regarded as the protection scope of the present invention.

Claims

1. The application of volatile oil from Chimonanthus chinensis leaves in the preparation of a drug for treating ulcerative colitis, characterized in that: The preparation method of the volatile oil from Chimonanthus chinensis leaves is as follows: after drying the Chimonanthus chinensis leaves in the shade, ultrasonic-assisted steam distillation is used for extraction, specifically comprising breaking the leaves to a particle size greater than 20 meshes, ultrasonically treating for 2 hours at a solid-liquid ratio of 1:15, a temperature of 40°C, and an ultrasonic frequency of 30kHz, then soaking for 3 hours, steam distilling for 7 hours, and the extraction temperature being 110°C. After the distillation is completed, water and oil are separated to obtain the volatile oil from the Chimonanthus chinensis leaves.

2. The use according to claim 1, characterized in that: The volatile oil from the leaves of Chimonanthus willowii contains phellandrene, α-terpineol and (+)-limonene, and the total mass of phellandrene, α-terpineol and (+)-limonene is greater than 50% of the total mass of the volatile oil.

3. The use according to claim 1 or 2, characterized in that: The active ingredient of the medicine is volatile oil from Chimonanthus chinensis leaves or the volatile oil from Chimonanthus chinensis leaves is mixed with other pharmaceutically acceptable excipients.

Images