A fine parabacteroides pt517 and its use in preparing anti-inflammatory or bacteriostatic products

By isolating and purifying Clostridium parasiticum Pt517 from the feces of healthy individuals and preparing it as a bacterial agent or fermentation product, the problems of drug resistance and inflammation in Salmonella infection have been solved. This has achieved the inhibition of pathogenic bacteria and the relief of inflammation, and has broad application value.

CN119752719BActive Publication Date: 2025-12-16ICDC CHINA CDC
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411967273.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-30
Publication Date
2025-12-16
Estimated Expiration
2044-12-30

AI Technical Summary

Technical Problem

Increased drug resistance in Salmonella infections makes treatment more difficult, and antibiotic use leads to gut microbiota imbalance and inflammation. Existing Clostridium paracetamol has not shown antibacterial efficacy.

Method used

Clostridium parasiticum Pt517 was isolated and purified from the feces of healthy individuals, and its safety and antibacterial effect were verified. It was then prepared as a bacterial agent or fermentation product for use in inhibiting the growth of pathogenic bacteria and alleviating inflammation caused by Salmonella infection.

Benefits of technology

Clostridium parasiticum Pt517 can inhibit a variety of pathogenic bacteria in vitro, reduce Salmonella load, alleviate colitis and spleen damage, and reduce inflammatory factor levels, showing anti-inflammatory and antibacterial effects with good safety.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119752719B_ABST
    Figure CN119752719B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of microorganism, and particularly relates to a Clostridium subsp. Pt517 and application of the Clostridium subsp. Pt517 in preparation of anti-inflammatory or bacteriostatic products. The preservation number of the Clostridium subsp. Pt517 is CGMCC No. 31232. The bacteriostasis includes inhibition of Escherichia coli, Salmonella typhimurium, Listeria monocytogenes or Staphylococcus aureus. The present application screens a Clostridium subsp. with bacteriostasis and anti-inflammatory capacity, the Clostridium subsp. has high safety for animals, has the efficacy of relieving Salmonella typhimurium infection symptoms, provides a new strategy for prevention and treatment of Salmonella typhimurium, and has potential clinical application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of microbial technology, and in particular to a Clostridium parasiticum Pt517 and its application in the preparation of anti-inflammatory or antibacterial products. Background Technology

[0002] Infectious gastrointestinal diseases are usually caused by the ingestion of water or food contaminated with intestinal pathogens. Salmonella is the most common pathogen causing foodborne illnesses and a major cause of diarrhea. Salmonella is a common zoonotic foodborne pathogen with a wide host range, multiple serotypes, and persistently high morbidity and mortality rates, posing a serious threat to human health and public health security.

[0003] Based on different surface antigens, Salmonella can be divided into more than 2,600 serotypes, among which the most common serotype is Salmonella Typhimurium (Salmonella typhimurium). Salmonella typhimurium It is highly adaptable to its environment and widely present in nature. It can infect humans and various animals, causing symptoms such as gastrointestinal inflammation, vomiting, diarrhea, abdominal pain, and fever. Patients with weakened immune function may develop severe systemic infections via the bloodstream, leading to damage to tissues and organs or even death.

[0004] Antibiotics are the first-line treatment for Salmonella infections. However, due to the excessive, prolonged, and unscientific use of antibiotics, Salmonella resistance to antibiotics is becoming increasingly serious. The emergence and development of resistance increases the difficulty of treating Salmonella infections, leading to a higher risk of death for patients. It also increases medical costs and economic burden, makes controlling large-scale Salmonella outbreaks more difficult, and poses a significant threat to public health. Furthermore, antibiotics can disrupt the balance of the host's gut microbiota, leading to intestinal dysfunction and resulting in antibiotic-associated diarrhea and inflammation.

[0005] Clostridium parasiticum ( Paraclostridium tenue Original name: Fiber Eubacterium ( Eubacterium tenue ), later classified under the genus *Paracosporium* ( Paraclostridium Currently reported strains of *Clostridium parasiticum* are mostly isolated from dairy products and fermented foods, with some strains also isolated from infant fecal samples or tissue samples from human mummies. No *Clostridium parasiticum* strains with antibacterial effects have been reported to date. Summary of the Invention

[0006] To address the problems existing in the prior art, the present invention provides a Clostridium parasiticum Pt517 and its application in the preparation of anti-inflammatory or antibacterial products.

[0007] This invention discloses a strain of *Clostridium parasiticum* isolated and purified from the feces of healthy individuals. Experiments have demonstrated that this strain exhibits good safety, high self-aggregation ability, and hydrophobic surface properties. Furthermore, in vitro and animal experiments have verified its ability to inhibit the growth of pathogenic bacteria. This strain can inhibit the growth of pathogenic bacteria such as *Salmonella typhimurium*, *Escherichia coli*, *Staphylococcus aureus*, and *Listeria monocytogenes* in vitro. Animal experiments have verified that this strain can reduce the *Salmonella typhimurium* load in the liver and spleen of mice infected with *Salmonella typhimurium*, alleviate colitis and spleen damage caused by *Salmonella typhimurium* infection, and reduce inflammatory factor levels. It is suitable as a probiotic preparation for the prevention and treatment of *Salmonella typhimurium* infection.

[0008] In the first aspect, this invention has biopreserved *Clostridium parasiticum* Pt517, which was deposited on July 3, 2024, at the China General Microbiological Culture Collection Center (CGMCC, address: No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, 100101, China), and classified as follows: Paraclostridium tenue The accession number is CGMCC No.31232.

[0009] Secondly, the present invention provides a microbial agent comprising the aforementioned Clostridium parasiticum Pt517 or its fermentation product.

[0010] Further, the bacterial agent is a solid bacterial agent, a liquid bacterial agent, or a microbial bacterial agent, wherein the total viable count of *Clostridium parasiticum* Pt517 in the bacterial agent is 1 × 10⁻⁶. 7-10 CFU / mL.

[0011] Thirdly, the present invention provides a method for preparing the aforementioned microbial agent, comprising: inoculating Clostridium parasiticum Pt517 into a culture medium for fermentation culture.

[0012] Furthermore, the culture medium is BHI medium, and the fermentation culture conditions include: culturing under anaerobic conditions at 35-40 ℃.

[0013] The bacterial culture of Clostridium parasiticum Pt517 obtained through cultivation can be prepared as a liquid bacterial agent directly or with the addition of excipients permitted in the field of microbial preparations. Alternatively, the bacterial cells in the bacterial culture can be collected, mixed with excipients permitted in the field of microbial preparations such as freeze-drying protectants, and then freeze-dried under vacuum to prepare a dry powder bacterial agent.

[0014] Fourthly, the present invention provides a product comprising the aforementioned Clostridium parasiticum Pt517, or the aforementioned bacterial agent, or prepared by the aforementioned preparation method; the product is preferably an antibacterial agent or a drug.

[0015] Fifthly, the present invention provides the application of the aforementioned Clostridium parasiticum Pt517, or the aforementioned bacterial agent, in inhibiting microorganisms; the microorganisms include: Escherichia coli, Salmonella, Listeria monocytogenes, or Staphylococcus aureus.

[0016] The present invention further provides the use of the aforementioned Clostridium parasiticum Pt517, or the aforementioned inoculum, in the preparation of products for any of the following applications:

[0017] i) Inhibit Salmonella infection,

[0018] ii) Anti-inflammatory,

[0019] iii) Resisting intestinal damage,

[0020] iv) Resist spleen damage.

[0021] Furthermore, the intestinal injury includes: colonic shortening or intestinal mucosal damage; and / or,

[0022] The spleen injury includes: reduced dilation of the spleen's medullary sinuses, and reduced hemorrhage and congestion.

[0023] Furthermore, the inhibition of Salmonella infection includes: inhibiting weight loss, reducing Salmonella load, reducing inflammatory factor levels, or increasing anti-inflammatory factor levels.

[0024] Furthermore, the reduction of inflammatory factors refers to reducing the inflammatory factors in the serum of Salmonella-infected mice and DSS-induced colitis mice, and the inflammatory factors include: tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and interleukin-6 (IL-6).

[0025] Furthermore, the anti-inflammatory factor includes interleukin-10 (IL-10).

[0026] The present invention has the following beneficial effects:

[0027] This invention screened and obtained a strain of *Clostridium parasiticum*, *Pt517*, which can inhibit the growth of pathogenic bacteria such as *Salmonella typhimurium*, *Escherichia coli*, *Staphylococcus aureus*, and *Listeria monocytogenes* in vitro. Animal experiments verified that this strain can reduce the *Salmonella typhimurium* load in the liver and spleen of mice infected with *Salmonella typhimurium*, alleviate symptoms such as colitis and spleen damage caused by *Salmonella typhimurium* infection, and reduce the level of inflammatory factors. Furthermore, it has no significant toxic side effects on experimental animals, providing a new strategy for the prevention and treatment of *Salmonella typhimurium*. It has broad application value in pharmaceuticals, food, and various forms of probiotic products, and has potential clinical application prospects. Attached Figure Description

[0028] To more clearly illustrate the technical solutions in this invention or the prior art, the drawings used in the description of the embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of this invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0029] Figure 1 The evolutionary tree of Clostridium parasiticum Pt517 and Clostridium bacteria provided in Embodiment 1 of the present invention.

[0030] Figure 2 The effect of Clostridium parasiticum Pt517 provided in Example 3 of the present invention on the body weight of mice infected with Salmonella typhimurium.

[0031] Figure 3 The effect of Clostridium parasiticum Pt517 provided in Example 3 of the present invention on the Salmonella typhimurium load in the organs of mice infected with Salmonella typhimurium.

[0032] Figure 4 The effect of Clostridium parasiticus Pt517 provided in Example 3 of this invention on spleen weight and spleen index in mice infected with Salmonella typhimurium; where NC represents the normal control group, PBS represents the Salmonella typhimurium infection model group, and Pt517 represents the Clostridium parasiticus Pt517 intervention group; the results are presented as x±SEM; N=6; *: P<0.05; **: P<0.01; ***: P<0.001.

[0033] Figure 5 The effect of Clostridium parasiticus Pt517 provided in Example 3 of the present invention on the pathological results of spleen tissue of mice infected with Salmonella typhimurium.

[0034] Figure 6 The effect of Clostridium parasiticus Pt517 provided in Example 3 of this invention on colonic phenotype and colonic length in mice infected with Salmonella typhimurium; wherein, NC represents the normal control group, PBS represents the Salmonella typhimurium infection model group, and Pt517 represents the Clostridium parasiticus Pt517 intervention group; the results are presented as x±SEM; N=6; *: P<0.05; ***: P<0.001.

[0035] Figure 7 The effect of Clostridium parasiticus Pt517 provided in Example 3 of the present invention on the pathological results of colon tissue of mice infected with Salmonella typhimurium.

[0036] Figure 8The effect of Clostridium parasiticus Pt517 provided in Example 3 of this invention on the levels of inflammatory cytokines in the serum and ileum of mice infected with Salmonella typhimurium; wherein, NC represents the normal control group, PBS represents the Salmonella typhimurium infection model group, and Pt517 represents the Clostridium parasiticus Pt517 intervention group; the results are presented as x±SEM; N=6; *: P<0.05; **: P<0.01; ***: P<0.001. Detailed Implementation

[0037] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions of this invention will be clearly and completely described below with reference to the accompanying drawings. Obviously, the described embodiments are only some, not all, of the embodiments of this invention. All other embodiments obtained by those skilled in the art based on the embodiments of this invention without creative effort are within the scope of protection of this invention.

[0038] Unless otherwise specified, the experimental methods involved in the following embodiments are conventional methods in the art. For example, you can refer to the experimental manual in the art or follow the conditions recommended in the manufacturer's instructions.

[0039] Unless otherwise specified, all experimental materials and reagents used in the following examples are commercially available.

[0040] Example 1: Isolation and Identification of Clostridium parasiticum Pt517

[0041] 1. Strains Isolation

[0042] (1) Prepare brain and heart infusion agar medium, autoclave at 121 ℃ for 15 min, cool to 50 ℃, gently shake, add 5% defibrinated blood, mix well and pour into a culture dish;

[0043] (2) Take an appropriate amount of healthy human fecal samples frozen in a -80 ℃ freezer and place them on ice to thaw slowly. After serial dilution with PBS, transfer 100 μL of the sample suspension at different dilutions to BHI+5% (v / v) defibrinated sheep blood medium and spread it evenly.

[0044] (3) Cultured at 37 ℃ under anaerobic conditions for 48 h;

[0045] (4) Remove the culture dish, use a sterile inoculation loop to pick up a single white, translucent colony and transfer it to a new solid culture medium for subculturing and purification. Repeat the subculturing three times. Name the isolated and purified anaerobic bacterium Pt517. The purified strain can be used for experiments or cryopreservation.

[0046] 2. Preservation of microbial strains

[0047] In our laboratory, BHI medium containing 20% ​​glycerol was used as the preservation solution for cryopreservation of bacterial strains, as follows:

[0048] (1) Add 1.5 mL of sterile preservation solution to a 2 mL preservation tube and autoclave it at 121 °C for 15 min for use;

[0049] (2) Pt517 was transferred three times consecutively on BHI + 5% (v / v) defibrinated sheep blood solid culture medium;

[0050] (3) Use a sterile inoculation loop to scrape colonies into the preservation tube and fully integrate them into the preservation solution. After mixing, freeze at -80 °C.

[0051] 3. Observation of colony appearance and cell morphology

[0052] Pt517 grows well under anaerobic conditions, forming round, irregularly edged, raised-center, smooth, translucent colonies on BHI + 5% (v / v) defibrinated sheep blood medium. It does not grow under aerobic conditions. Under a microscope, *Clostridium slenderum* appears as a rod-shaped bacterium and is Gram-positive.

[0053] 4. Extraction of total bacterial DNA

[0054] Single Pt517 colonies were inoculated onto solid medium containing BHI + 5% (v / v) defibrinated sheep blood and cultured anaerobically overnight at 37 °C. DNA was extracted according to the instructions of the bacterial genomic DNA extraction kit (Promega).

[0055] 5. Taxonomic identification of bacteria

[0056] Genomic DNA was extracted from Pt517, and the 16S rRNA gene of Pt517 was amplified using universal primers for the 16S rRNA gene (27F: AGAGTTTGATCCTGGCTCA; 1492R: AAGTCGTAACAAGGTAGCCGT). The PCR amplification products were sequenced, and the obtained gene sequences were aligned to the NCBI online database using BLAST. The PCR reaction conditions and the composition of the PCR system (30 μL) are as follows:

[0057] PCR reaction system (30 μL): Premix Taq, 15 μL; ddH2O, 12 μL; forward and reverse primers, 1 μL each; genomic DNA, 1 μL.

[0058] PCR amplification conditions: 94 ℃ pre-denaturation, 5 min; 94 ℃ denaturation, 0.5 min, 55 ℃ annealing, 0.5 min, 72 ℃ extension, 0.5 min, 30 cycles; 72 ℃ final extension, 1 min.

[0059]

[0060] The 16S rRNA sequencing results of Pt517 were compared with BLAST on NCBI. The results showed that the strain with the highest homology with Pt517 was the Clostridium parasiticum type strain. Paraclostridium tenue strain ATCC 25553 (99.03%) and the Clostridium parasiticus model strain Paraclostridium tenue strain DSM 20695 (98.90%) had sequence identity exceeding the interspecific threshold of 98.75%.

[0061] 16S rRNA gene sequences of highly homologous *Clostridium* species (similarity > 96%) were selected. Using *Clostridium butyricum* JCM 1391 as the outgroup, a phylogenetic tree was constructed using MEGA7 software and the Neighbor-Joining (NJ) algorithm, with 1000 sampling iterations, to determine the specific taxonomic position of Pt517. The results are as follows: Figure 1 As shown, Pt517 and Paraclostridium tenue strain ATCC 25553 is the most closely related in evolution. Therefore, Pt517 is identified as *Clostridium slenderum*.

[0062] Clostridium parasiticum Pt517 was deposited at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC No. 31232 on July 3, 2024. The recommended strain name is... Paraclostridium tenue The depository is the China General Microbiological Culture Collection Center, located at the Institute of Microbiology, Chinese Academy of Sciences, Datun Road, Chaoyang District, Beijing, 100101, China.

[0063] Example 2: In vitro characterization of Clostridium parasiticum Pt517

[0064] 1. Hemolytic activity of Clostridium parasiticum Pt517

[0065] A suspension of *Clostridium parasiticus* Pt517 was inoculated onto the surface of BHI + 5% (v / v) defibrinated sheep blood medium and anaerobically cultured at 37 °C for 24 h. The presence of a hemolytic zone around the colonies was then observed. A positive hemolysis test was indicated by the appearance of a hemolytic zone, while a negative test was indicated by the absence of a hemolytic zone. *Staphylococcus aureus* ATCC 25923 was used as a positive control, and LGG was used as a negative control.

[0066] The results showed that the positive control strain *Staphylococcus aureus* 25923 exhibited a clear hemolytic zone, indicating hemolytic activity; however, no hemolytic zone was observed around *Clostridium parasiticum* Pt517 and the negative control strain LGG, indicating no hemolytic activity. This suggests that *Clostridium parasiticum* Pt517 has good safety.

[0067] 2. Antibiotic susceptibility of Clostridium parasiticum Pt517

[0068] The experiment employed the antibiotic concentration gradient method (E-test method). Based on the Clinical and Laboratory Standards Institute (CLSI) M100 standard, recommended antibiotics for anaerobic bacteria were selected, namely penicillin, ampicillin, amoxicillin, imipenem, meropenem, clindamycin, ceftriaxone sodium, moxifloxacin, tetracycline, and metronidazole, to test the antibiotic susceptibility of *Clostridium parasiticum* Pt517. *Bacteroides fragilis* ATCC 25285 was selected as the quality control strain (QC). A suspension of *Clostridium parasiticum* Pt517 with a McFarland turbidity of 0.5 was mixed with *Bacteroides fragilis* (…). Bacteroides fragilis ATCC 25285 bacterial suspension was evenly spread on the surface of BM+5% (v / v) defibrinated sheep blood medium, and E-test strips were placed on the surface of the medium. After anaerobic incubation at 37 ℃ for 24 h, the minimum inhibitory concentration (MIC) value was read and its drug resistance was judged by comparison with the standard.

[0069] The results are shown in Table 1, where S represents sensitive and R represents resistant. The Pt517 strain was sensitive to all 10 antibiotics selected in the experiment, namely penicillin, ampicillin, amoxicillin, imipenem, meropenem, clindamycin, ceftriaxone sodium, moxifloxacin, tetracycline and metronidazole, and had a high safety profile.

[0070] Table 1. Antibiotic susceptibility results of Clostridium parasiticum Pt517

[0071]

[0072] Note: S represents sensitive, R represents resistant, and QC represents quality control strain (Bacteroides fragilis ATCC 25285).

[0073] 3. Hydrophobicity and self-aggregation ability of Clostridium parasiticum Pt517

[0074] Hydrophobicity test: The McFarland turbidity of the *Clostridium parasiticus* Pt517 and LGG (control strain) bacterial suspensions was adjusted to 1.0 using PBS, recorded as OD0. 2 mL of xylene was added to 2 mL of the bacterial suspension, and the mixture was thoroughly shaken and incubated in an anaerobic incubator at 37 ℃ for 1 h. The McFarland turbidity of the supernatant was measured and recorded as OD1. The bacterial surface hydrophobicity was calculated as: Hydrophobicity = (OD0 - OD1) / OD0 × 100%. Three experimental results were taken and the average value was calculated.

[0075] Self-aggregation ability evaluation: The McFarland turbidity of the Clostridium parasiticus Pt517 and LGG (control strain) bacterial suspensions was adjusted to 1.0 with PBS, recorded as OD0. After static incubation in anaerobic conditions at 37 ℃ for 24 h, the McFarland turbidity was measured again, recorded as OD1. Self-aggregation ability was calculated as: Self-aggregation ability = (OD0 - OD1) / OD0 × 100%, and the average value of three experimental results was calculated.

[0076] The results are shown in Table 2. The hydrophobicity and self-aggregation ability of Clostridium parasiticum Pt517 are comparable to those of the positive control LGG, indicating that this strain has a certain intestinal colonization ability.

[0077] Table 2. Hydrophobicity and self-aggregation ability of Clostridium parasiticum Pt517

[0078]

[0079] 4. In vitro inhibitory effect of Clostridium parasiticum Pt517 on pathogenic bacteria.

[0080] In vitro antibacterial assays were performed on *Clostridium parasiticus* Pt517 using the agar stacking method. Colony counts were performed on *Clostridium parasiticus* Pt517 and pathogenic bacteria (*Escherichia coli* EDL933, *Salmonella typhimurium* SL1344, *Listeria monocytogenes* ATCC BAA-679, and *Staphylococcus aureus* ATCC 25923). The bacterial concentration of *Clostridium parasiticus* Pt517 was adjusted to 1×10⁻⁶ using PBS. 8 CFU / mL, 30 μl of bacterial suspension was inoculated onto the surface of BHI+5% (v / v) defibrinated sheep blood medium and incubated in an anaerobic incubator at 37 ℃ for 24 h. LB medium containing 0.6% agar was prepared and autoclaved.

[0081] The bacterial concentration of the above-mentioned pathogens was adjusted to 1×10⁻⁶ using PBS. 8CFU / mL, 10 μL of bacterial suspension was added to 10 mL of sterilized LB medium and mixed well. The LB medium containing pathogenic bacteria was then placed on top of BHI + 5% (v / v) defibrinated sheep blood medium containing *Clostridium parasiticum* Pt517 colonies. After incubation at 37 ℃ for 4 h, the diameter of the inhibition zone was measured. The results of three experiments were taken and the average value was calculated. The in vitro antibacterial results of *Clostridium parasiticum* Pt517 are shown in Table 3. The results indicate that *Clostridium parasiticum* Pt517 has a certain inhibitory effect on the four common human pathogens selected in the experiment.

[0082] Table 3. Results of in vitro antibacterial experiments with Clostridium parasiticum Pt517

[0083]

[0084] Example 3: Anti-Salmonella Typhimurium Pt517 activity against Salmonella Typhimurium infection

[0085] 1. Establishment, grouping, and treatment of a mouse model of Salmonella typhimurium infection.

[0086] Eighteen female BALB / c mice weighing (16 ± 1) g were acclimatized for 3 days and then randomly divided into three groups: normal control group (NC group), Salmonella typhimurium infection model group (PBS group), and Clostridium parasiticus Pt517 intervention group (Pt517 group), with 6 mice in each group. From day -7 to day 5, each mouse in the NC group and PBS group was administered 0.2 mL of PBS by gavage daily, while each mouse in the Pt517 group was administered 0.2 mL of Clostridium parasiticus Pt517 bacterial suspension (approximately 10 μg / mL) by gavage daily. 8 CFU / 0.2 mL was administered via gavage for 13 consecutive days. On day 0, each mouse in the PBS group and Pt517 group was given 0.1 mL of Salmonella Typhimurium SL1344 bacterial suspension (approximately 10 CFU / mL). 8 (CFU / 0.2 mL). Observe the health status of the mice daily, weigh and record their weight.

[0087] On day 6, mice were euthanized and blood was collected from their eyes. The liver and spleen of the mice were dissected, weighed and recorded. 0.1 g of liver and spleen were weighed and placed in sterile centrifuge tubes for later use. A portion of spleen tissue was then cut and fixed in 4% paraformaldehyde. The ileum was separated and collected for later use. The colon was separated, the colon phenotype was observed, the colon length was measured and recorded, and colon images were taken and saved. The colon tissue was then fixed in 4% paraformaldehyde.

[0088] Mouse spleen and colon tissues, which were immersed in 4% paraformaldehyde fixative, were dehydrated, embedded in paraffin, sectioned, and stained with hematoxylin-eosin (HE). The pathological morphological changes of the spleen and colon tissues were observed under 20x, 50x, and 200x optical microscopes.

[0089] After collecting mouse blood and allowing it to stand for 3 hours, centrifuge at 3000 r / min for 15 min, and collect the serum for detecting inflammatory cytokines. Ileal tissue was washed with pre-cooled PBS, minced, and thoroughly homogenized on ice to prepare a tissue homogenate. The homogenate was centrifuged at 5000 r / min for 5-10 min, and the supernatant was collected for detecting inflammatory cytokines. The concentrations of inflammatory cytokines TNF-α, IL-1β, IL-6, and IL-10 in serum and ileal tissue were detected using an ELISA kit.

[0090] 1 mL of PBS and 3 mm steel balls were added to sterile centrifuge tubes containing 0.1 g of liver and spleen, respectively. The liver and spleen were ground into tissue homogenates. The tissue homogenates were serially diluted and dropped onto Salmonella selective medium containing streptomycin (50 μg / mL) to count the colonies of Salmonella typhimurium in mouse liver and spleen.

[0091] 2. In vivo safety of Clostridium parasiticus Pt517

[0092] Before establishing the Salmonella typhimurium infection model (i.e., from day -7 to day 0), mice in the NC and PBS groups were administered PBS by gavage daily, while mice in the Pt517 group were administered Clostridium parasiticus Pt517 bacterial suspension by gavage daily. The changes in body weight of mice infected with Salmonella typhimurium are shown in Table 4. Figure 2 As shown, the results indicated that the daily body weight of mice in each group increased steadily. The average body weight gain in the NC group, PBS group, and Pt517 group were (0.39±0.24) g, (0.21±0.18) g, and (0.23±0.12) g, respectively, with no statistically significant difference in body weight among the three groups (P>0.05). The feces of mice in all groups were granular, their fur was shiny and smooth, and their activity and mental state were good. No abnormal conditions or deaths were observed. This indicates that *Clostridium parasiticum* Pt517 did not produce toxic effects on mice and had good safety.

[0093] 3. Effects of Clostridium parasiticum Pt517 on growth and body weight in mice infected with Salmonella typhimurium

[0094] Mice in the NC group showed good growth, with glossy and smooth fur, normal food intake, good mental state, and no deaths. Mice in the PBS and Pt517 groups, however, exhibited typical symptoms of Salmonella typhimurium infection after infection, including lethargy, disheveled fur, arched backs, reduced activity, and decreased appetite.

[0095] As shown in Table 4 and Figure 2 As shown, the average body weight of mice in the PBS group began to decrease from day 1 after Salmonella typhimurium infection, while the average body weight of mice in the Pt517 group only began to decrease from day 3. Furthermore, from day 1 to day 6 after Salmonella typhimurium infection, the average body weight of mice in the PBS group was consistently lower than that of mice in the Pt517 group. Although there was no significant difference in body weight between the two groups, Clostridium parasiticum Pt517 could alleviate the weight loss caused by Salmonella typhimurium infection to some extent, thus providing a certain degree of protection for the mice.

[0096] Table 4. Daily body weight (g) of experimental mice

[0097]

[0098] Note: Compared with the PBS group, *, P<0.05; **, P<0.01.

[0099] 4. Effect of Clostridium parasiticum Pt517 on Salmonella Typhimurium load in the viscera of mice infected with Salmonella Typhimurium.

[0100] like Figure 3 As shown in Figures A and B, the Salmonella Typhimurium load in the liver and spleen of mice in the PBS group was significantly higher than that in the NC group (P<0.01), while the Salmonella Typhimurium load in the liver and spleen of mice in the Pt517 group was significantly lower than that in the PBS group (P<0.05). This indicates that Salmonella Typhimurium infection can translocate to organs such as the liver and spleen; Clostridium parasiticum Pt517 can reduce the Salmonella Typhimurium load in the internal organs of mice infected with Salmonella Typhimurium and reduce the translocation of Salmonella Typhimurium.

[0101] 5. Effects of Clostridium parasiticus Pt517 on the spleen of mice infected with Salmonella typhimurium

[0102] Spleen weight and spleen index of mice in each group are as follows: Figure 4 As shown in Figures A and B, the spleen weight and spleen index of mice in the PBS group were significantly higher than those in the NC group (P<0.001), while the spleen weight and spleen index of mice in the Pt517 group were significantly lower than those in the PBS group (P<0.05). This indicates that Clostridium parasiticum Pt517 helps alleviate spleen swelling and reduce spleen damage in mice infected with Salmonella typhimurium, thus providing a certain protective effect on the spleen.

[0103] Spleen HE staining results ( Figure 5The results showed that the spleen tissue structure in the NC group was clear, with occasional adhesions between white pulp cells (black arrows), and no obvious necrosis or other abnormalities in the red and white pulp. In the PBS group, spleen tissue showed necrosis of a large number of cells in the red pulp and a small number of cells in the white pulp (yellow arrows), with condensed and fragmented nuclei, unclear structure, and numerous granulocyte infiltrations (green arrows); numerous dilated medullary sinuses were observed (red arrows), and extensive hemorrhage and congestion of a small amount of white pulp were present in the red pulp (blue arrows); occasional adhesions between white pulp cells were also observed (black arrows). Compared with the PBS group, the spleen of mice in the Pt517 group showed milder pathological symptoms. The spleen tissue of the Pt517 group showed necrosis of a large number of cells in the red pulp and a small number of cells in the white pulp (yellow arrows), with condensed and fragmented nuclei, unclear structure, and a large number of granulocyte infiltrations (green arrows); less dilation of the medullary sinus (red arrows), and a small amount of hemorrhage and congestion in the red pulp (blue arrows); a small amount of white pulp adhered to each other (black arrows), indicating that Clostridium parasiticum Pt517 alleviated the spleen tissue damage caused by Salmonella typhimurium infection.

[0104] 6. Effects of Clostridium parasiticum Pt517 on the colon of mice infected with Salmonella typhimurium

[0105] The results are as follows Figure 6 As shown in A and B, the colon of mice in the NC group had better elasticity and the feces in the intestine were granular; the colon of mice in the PBS group had poorer elasticity and showed congestion or edema, the feces in the intestine were soft, and the colon length was significantly shorter than that of the NC group (P<0.001); the colon of mice in the Pt517 group had better elasticity, the feces in the intestine were granular and there was no obvious edema, and the length was significantly longer than that of the PBS group (P<0.05), indicating that Clostridium parasiticum Pt517 improved the colon phenotype and length of mice infected with Salmonella typhimurium to some extent.

[0106] Colon HE staining results ( Figure 7 The results showed that in the NC group, the colonic tissue had clear structures in all layers, with intact mucosal epithelium; abundant intestinal glands in the lamina propria, and goblet cells distributed between epithelial cells; no obvious necrosis or inflammatory cell infiltration was observed. In the PBS group, the colonic tissue had fewer folds, a thinner mucosal layer, local mucosal erosion, and unclear structures of the mucosal epithelium and intestinal glands in the lamina propria, with a small amount of connective tissue hyperplasia and replacement (red arrows), accompanied by a small amount of lymphocyte infiltration (yellow arrows). In the Pt517 group, no obvious abnormalities were observed in the colonic tissue structure, no obvious inflammatory changes were observed, and occasional necrosis and sloughing of mucosal epithelial cells were observed (black arrows); abundant intestinal glands in the lamina propria, and abundant goblet cells between epithelial cells. This indicates that *Clostridium parasiticum* Pt517 alleviated the symptoms of colitis caused by *Salmonella typhimurium* infection and had a certain protective effect on the colon of mice.

[0107] 7. Effects of Clostridium parasiticum Pt517 on serum and ileum inflammatory factors in mice infected with Salmonella typhimurium

[0108] The results are shown in Tables 5 and 6. Figure 8 As shown, compared with the NC group, the levels of inflammatory factors such as tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and interleukin-6 (IL-6) in the serum and ileum of mice in the PBS group were significantly increased (P<0.05); compared with the PBS group, the levels of tumor necrosis factor-α (TNF-α), serum interleukin-1β (IL-1β), and interleukin-6 (IL-6) in the serum and ileum of mice in the Pt517 group were significantly decreased (P<0.05); compared with the NC group, the level of the anti-inflammatory factor interleukin-10 (IL-10) in the ileum of mice in the PBS group was significantly decreased (P<0.001); compared with the PBS group, the level of interleukin-10 (IL-10) in the ileum of mice in the Pt517 group was significantly increased (P<0.001), while there was no statistically significant difference in the level of interleukin-10 (IL-10) in the serum of each group. The above results indicate that Clostridium parasiticum Pt517 can reduce the levels of inflammatory factors in serum and ileum and increase the levels of anti-inflammatory factors, meaning that Clostridium parasiticum Pt517 can improve the inflammatory response caused by Salmonella typhimurium and has a certain anti-inflammatory effect.

[0109] Table 5. Concentrations of inflammatory factors in mouse serum (pg / mL)

[0110]

[0111] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001.

[0112] Table 6. Concentrations of inflammatory factors in the mouse ileum (pg / mL)

[0113]

[0114] Note: Compared with the PBS group, *, P<0.05; **, P<0.01; ***, P<0.001.

[0115] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A type of slender Clostridium parasiticum ( Paraclostridium tenue Pt517, characterized in that, The preservation number of the Clostridium parasiticum Pt517 is: CGMCC No.31232.

2. A microbial agent, characterized in that, Includes Clostridium parasiticum Pt517 as described in claim 1.

3. The microbial agent according to claim 2, characterized in that, The bacterial agent is a solid or liquid bacterial agent, and the total viable count of *Clostridium parasiticum* Pt517 in the bacterial agent is 1 × 10⁻⁶. 7-10 CFU / mL.

4. The method for preparing the microbial agent according to claim 2 or 3, characterized in that, include: Clostridium parasiticum Pt517 was inoculated into the culture medium for fermentation culture.

5. The preparation method according to claim 4, characterized in that, The culture medium is BHI medium, and the fermentation culture conditions include: culture under anaerobic conditions at 35~40 ℃.

6. A product characterized in that, The product includes Clostridium parasiticum Pt517 as described in claim 1, or the bacterial agent as described in claim 2 or 3; the product is an antibacterial agent or a drug.

7. The use of the Clostridium parasiticus Pt517 of claim 1, or the bacterial agent of claim 2 or 3, in the preparation of a medicament for treating Salmonella infection.

Citation Information

Patent Citations

  • Bacterial extracellular vesicles

    CN111148531A

  • Double-fermentation paraclostridium B1251a and application thereof

    CN117286065A