Monoclonal cell for expressing HPV (human papilloma virus) 18 type E6 protein and application of monoclonal cell in construction of HPV tumor animal model

Abstract

The invention discloses a monoclonal cell for expressing HPV (human papilloma virus) 18 type E6 protein and application of the monoclonal cell in construction of an HPV tumor animal model, and relates to the technical field of HPV tumor animal models. A monoclonal cell which can stably express target protein and is good in tumor formation effect is obtained through a limited dilution method and single cell imaging sorting identification, and after an animal model is inoculated with the medicine or vaccine composition, the medicine or vaccine composition has an obvious inhibition effect on tumors; an animal model can be induced to generate high-level humoral immunity, and high-level specific CD4 + T cell and CD8 + T cell immune response can be generated. Compared with a TC-1 cell, the monoclonal cell provided by the invention has more remarkable tumorigenicity and can better mediate the growth of tumors in animals. The monoclonal cell obtained by screening has a good application prospect in screening a pharmaceutical composition or a vaccine composition for preventing and / or treating HPV, and can be used for evaluating a therapeutic vaccine for targeting HPV18.

Description

Technical Field

[0001] The present invention relates to the technical field of HPV tumor animal models, and in particular to a monoclonal cell expressing HPV18 type E6 protein and an application thereof in constructing an HPV tumor animal model. Background Art

[0002] Human papillomavirus (HPV) is the cause of a variety of gynecological and head and neck malignancies, including cervical, penile, vaginal, anal, vulvar, and oropharyngeal cancers. Unlike low-risk HPV types, high-risk HPV types, such as types 16 and 18, have a high carcinogenic potential and are often associated with invasive cervical cancer. After HPV16, HPV18 is the second most carcinogenic HPV type. Globally, HPV16 and 18 together cause nearly 70% of cervical cancer cases.

[0003] The most common histological type of cervical cancer is squamous cell carcinoma (SCC), which accounts for approximately 80-90% of cases. Adenocarcinoma (ADC) is a less common histological type of cervical cancer, accounting for approximately 10-20% of cases; however, cases of cervical adenocarcinoma have been increasing over the past two decades. Importantly, HPV18 causes approximately 12% of SCC and 37% of ADC cases. Therefore, HPV18 and its related cancers constitute a significant burden worldwide, and the development of treatments for HPV18-related diseases is necessary.

[0004] Prophylactic vaccines effectively prevent HPV infection in healthy patients, but they cannot clear existing HPV infection or HPV-related lesions. Unlike prophylactic vaccines, therapeutic vaccines enhance cell-mediated immune responses to target and kill infected cells. However, there is a lack of HPV18 tumor models that can be used to evaluate potential immunotherapies for HPV18-related malignancies. Therefore, it is of great significance to construct a tumor cell line related to a tumor model suitable for the development of HPV18 therapeutic vaccines.

[0005] In 2017, TC. Wu's team at Johns Hopkins School of Medicine established a polyclonal cell line targeting HPV18E6 for HPV18-targeted tumor models. It is worth noting that the use of polyclonal cell lines as tumor models often faces multiple challenges, including: 1) Inconsistent expression levels: Polyclonal cell lines are composed of multiple different cell clones, and the target gene integration positions and expression levels of these clones are different, resulting in inconsistent gene expression levels in the entire cell population.

[0006] 2) Inconsistent growth rate: In a polyclonal cell line, different clones may have different growth rates, which may cause some clones to gradually gain the upper hand during the culture process, thus affecting the stability of the cell population.

[0007] 3) Poor stability: Since polyclonal cell lines contain multiple clones, the genetic backgrounds and biological characteristics of these clones may be different, which may lead to decreased stability of the cell line during long-term culture.

[0008] 4) Poor reproducibility of experimental results: Due to their inherent heterogeneity, polyclonal cell lines may result in experimental results with poor reproducibility compared to monoclonal cell lines.

[0009] 5) Difficulty in conducting accurate gene function studies: When conducting gene function studies, the mixed characteristics of different clones in polyclonal cell lines may make it difficult to accurately interpret the research results.

[0010] In summary, the development of cell lines for HPV18-related tumor models and the construction and screening of monoclonal cell lines with more stable properties are of great value for preclinical research on tumor treatment targeting HPV18.

[0011] In view of this, the present invention is proposed. Summary of the invention

[0012] The purpose of the present invention is to provide a monoclonal cell expressing HPV18 type E6 protein and its application in constructing an HPV tumor animal model to solve the above technical problems.

[0013] The present invention is achieved in that: In a first aspect, the present invention provides a monoclonal cell expressing HPV18 E6 protein, which is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO: C2024395.

[0014] In a second aspect, the present invention provides the use of monoclonal cells expressing HPV18 type E6 protein in constructing an HPV tumor animal model.

[0015] In a third aspect, the present invention provides a method for establishing an HPV tumor animal model, which comprises the following steps: administering the above-mentioned monoclonal cells expressing HPV18 type E6 protein to a non-human mammal.

[0016] In a fourth aspect, the present invention provides the use of monoclonal cells expressing HPV18 type E6 protein or an HPV tumor animal model established by the above-mentioned HPV tumor animal model establishment method in screening pharmaceutical compositions or vaccine compositions for the prevention and / or treatment of HPV.

[0017] The present invention has the following beneficial effects: The present invention identifies monoclonal cells by limiting dilution method and single cell imaging sorting, and combines target gene sequencing to find that monoclonal cells have successfully integrated the target gene, and RT-PCR verifies that the target gene is successfully transcribed in the cell. After the monoclonal cells are administered to animals, the volume of the tumor shows a stable growth trend, and after the drug or vaccine composition is inoculated into the animal model, it has a significant inhibitory effect on the tumor, and can induce the animal model to produce a high level of humoral immunity, a high level of specific CD4+T cell and CD8+T cell immune response. Therefore, the monoclonal cells obtained by the present invention have good application prospects for screening pharmaceutical compositions or vaccine compositions for the prevention and / or treatment of HPV, and can be used for the evaluation of therapeutic vaccines targeting HPV18. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0019] Figure 1 This is a comparison chart of the sequencing results of HPV18E6 positive monoclonal and the original sequence; Figure 2 This is a fluorescence microscope observation of TC1 cells initially infected with lentivirus; Figure 3 This is a fluorescence microscope observation of TC1 cells infected with lentivirus after pressure screening; Figure 4 These are photographic records of monoclonal cells TC1 HPV18E6 (P5G9), TC1 HPV18E6 (P6E3), TC1 HPV18E6 (P15G11), and TC1 HPV18E6 (P6H8); Figure 5 These are photographic records of monoclonal cells TC1 HPV18E6 (P6C7) and TC1 HPV18E6 (P6G9); Figure 6 This is a comparison chart of TC1 HPV18E6 monoclonal sequencing results and original results; Figure 7 This is the RT-PCR validation result of TC1 HPV18E6 (P5G9); Figure 8The figure shows the RT-PCR verification result of TC1 HPV18E6 monoclonal (lane 1 is TC1, lane 2 is TC1 HPV18E6 (P6E3); lane 3 is TC1 HPV18E6 (P15G11), lane 4 is TC1 HPV18E6 (P6H8), lane 5 is TC1 HPV18E6 (P6C7), and lane 6 is TC1 HPV18E6 (P6G9); Fig. 9 This is the observation picture of TC1 HPV18E6 monoclonal under fluorescence microscope (the upper and lower pictures correspond to observation under white light and observation under excitation light conditions respectively); Fig.10 Tumor growth curves mediated by different TC1-HPV18E6 monoclonal cell lines; Fig.11 This is the tumor growth curve of tumor-bearing mice (the "arrow" indicates the vaccine immunization time); Fig.12 This is a graph showing the tumor inhibition curve of the recombinant protein vaccine on tumor-bearing mice. DETAILED DESCRIPTION

[0020] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0021] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc.); Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0022] The present invention selects the coding sequence of the E6 protein derived from wild-type HPV18 (taxon: 333761) (as shown in SEQ ID NO: 1) as a target in the tumor cell line. Since HPV18 E6 is conserved among different strains, the monoclonal cells constructed by the present invention can be used as a tumor cell model with universal HPV18 as the target.

[0023] The present invention constructs the E6 sequence of wild-type HPV18 (taxon: 333761) and the transfer plasmid plenti-CMV of the lentivirus into a recombinant plasmid plenti-CMV-HPV18E6, thereby enhancing the specificity of monoclonal cells for the HPV18-E6 antigen. When constructing the recombinant plasmid plenti-CMV-HPV18E6, an eGFP expression element is connected to the end of the HPV18E6 sequence, so that the monoclonal cells that are successfully constructed and fully expressed subsequently have a fluorescent phenotype, which is convenient for evaluating the transfection efficiency and screening of monoclonal cells. Through the strategy of lentiviral infection, the target gene is effectively and stably integrated into the genome of the host cell (TC-1 cell) to achieve long-term gene expression.

[0024] A monoclonal cell that can stably express the target protein and has a good tumorigenic effect was obtained through limiting dilution method and single cell imaging sorting and identification. After the drug or vaccine composition was inoculated into the animal model, it had a significant inhibitory effect on the tumor, and could induce the animal model to produce a high level of humoral immunity, a high level of specific CD4+T cell and CD8+T cell immune response. The monoclonal cells provided by the present invention have more significant tumorigenicity than TC-1 cells and can better mediate the growth of tumors in animals. Compared with other positive monoclonal cells, the monoclonal cells screened by the present invention can mediate the growth of tumors in animals faster and more stably. In the HPV tumor animal model after the vaccine was administered, the monoclonal cells provided by the present invention can induce mice to produce a high level of specific CD4+T cell and CD8+T cell immune response. Therefore, the monoclonal cells obtained by the screening of the present invention have good application prospects for screening pharmaceutical compositions or vaccine compositions for the prevention and / or treatment of HPV, and can be used for the evaluation of therapeutic vaccines targeting HPV18.

[0025] In a first aspect, the present invention provides a monoclonal cell expressing HPV18 type E6 protein, which is deposited in China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: C2024395.

[0026] The deposit date is January 15, 2025. The characteristics of the culture submitted for deposit are: mouse lung epithelial cells TC1HPV18E6 (P6E3) Mus musculus. The identification result is survival. The deposit address is Wuhan University, Wuhan, China.

[0027] The monoclonal cells specifically expressing HPV18 E6 protein constructed by the present invention can be applied to the study of the pharmacodynamic action mechanism between independent antigens (HPV18 E6 protein), and can be used to construct an animal model expressing HPV18 E6 protein alone.

[0028] In a second aspect, the present invention provides the use of monoclonal cells expressing HPV18 type E6 protein in constructing an HPV tumor animal model.

[0029] In a preferred embodiment of the application of the present invention, the application includes: administering monoclonal cells expressing HPV18 type E6 protein to non-human mammals to obtain an HPV tumor animal model that forms a solid tumor.

[0030] Administration may also be referred to as vaccination, including but not limited to intravenous injection, subcutaneous injection, intramuscular injection and the like.

[0031] In a preferred embodiment of the present invention, the non-human mammal is selected from mice, rats, rabbits, dogs, cats, macaques, pigs, cattle, sheep or horses, but is not limited thereto, and any non-human mammal is feasible as long as it is a mammal.

[0032] In a third aspect, the present invention provides a method for establishing an HPV tumor animal model, which comprises the following steps: administering the above-mentioned monoclonal cells expressing HPV18 type E6 protein to a non-human mammal.

[0033] In a preferred embodiment of the present invention, the non-human mammal is selected from mice, rats, rabbits, dogs, cats, macaques, pigs, cattle, sheep or horses, but is not limited thereto, and any non-human mammal is acceptable as long as it is a mammal.

[0034] In a preferred embodiment of the present invention, the monoclonal cells are injected into non-human mammals at a dose of 1×10 5 -1×10 10 / Kg animal.

[0035] The administration interval is selected from: a) only once; b) once a week; c) twice a week; d) three times a week; more preferably, the monoclonal cell administration time is selected from: a) at least 1 week; b) at least 2 weeks; c) at least 3 weeks; d) at least 4 weeks.

[0036] Before the monoclonal cells are injected, the monoclonal cells are digested and then dispersed. The digestion treatment is, for example, treatment with trypsin.

[0037] In a fourth aspect, the present invention provides the use of monoclonal cells expressing HPV18 type E6 protein or an HPV tumor animal model established by the above-mentioned HPV tumor animal model establishment method in screening pharmaceutical compositions or vaccine compositions for the prevention and / or treatment of HPV.

[0038] In a preferred embodiment of the present invention, the above application includes the following application modes: After a solid tumor is formed in the HPV tumor animal model, the drug composition or vaccine composition to be tested is administered, and the therapeutic and / or preventive effect of the drug composition or vaccine composition is determined based on the tumor inhibition effect.

[0039] The test of tumor inhibition effect includes but is not limited to: tumor inhibition rate assessment, tumor volume calculation, animal survival rate, tumor recurrence rate, humoral immunity level and cellular immunity level. If a certain drug composition or vaccine composition has a slight or significant tumor inhibition effect after being applied to an HPV tumor animal model, it indicates that the drug composition or vaccine composition has a certain therapeutic and / or preventive effect.

[0040] In a preferred embodiment of the present invention, the vaccine composition is a protein vaccine, an RNA vaccine or a DNA vaccine.

[0041] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0042] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0043] 1. The technical route of the present invention is as follows: 1. Construction of lentiviral assembly vector The present invention selects a three-plasmid lentiviral packaging system, which contains three functional plasmids, namely ① transfer plasmid (plenti-CMV): containing the target gene sequence and the long terminal repeat sequence (LTRs) for integrating the gene into the host genome. In the present invention, the plasmid also contains an eGFP expression element, which makes the subsequent successfully constructed monoclonal clones show fluorescence, thereby simplifying the screening workload and improving the screening efficiency of positive monoclonal clones; ② packaging plasmid (PMD2.G): encoding the necessary proteins required for lentivirus, such as reverse transcriptase and integrase, but lacking packaging signals and additional pathogenic gene sequences to ensure the safety of the virus; ③ envelope plasmid (psPAX2): expressing VSV-G protein, giving viral particles the ability to enter a variety of cell types. It is worth noting that the present invention innovatively adds an eGFP expression element to the plenti-CMV vector, thereby improving the positive rate of screening based on the fluorescence effect.

[0044] The present invention submits the selected HPV18 E6 gene to GENEWIZ for gene synthesis, and then constructs it into plenti-CMV based on the strategy of homologous recombination to obtain the plasmid plenti-CMV-HPV18E6.

[0045] The plasmids plenti-CMV-HPV18E6, plenti-CMV, psPAX2 and PMD2.G required for this study were prepared using an endotoxin-free plasmid extraction kit.

[0046] 2. Virus Packaging and Collection The expression vector (plenti-CMV-HPV18E6) and auxiliary plasmids (psPAX2 and PMD2.G) were co-transfected into 293T cells, and the viral supernatant containing the target gene HPV18E6 was collected. Then, the lentiviral particles were collected and preserved by filtration for subsequent infection experiments.

[0047] 3. Virus infection The virus suspension prepared by the present invention is used to infect TC-1 cells, and the successfully infected cells are enriched by the puromycin pressure screening method until the eGFP positive rate of the reference control group is greater than 50%.

[0048] 4. Screening of Monoclonal Cells The limiting dilution method was used for monoclonal cell screening, and monoclonal analysis was performed by continuous photography using a monoclonal camera.

[0049] 5. Verification of Monoclonality The target gene sequencing, target gene RT-PCR analysis, tumorigenicity experiment and other methods were used to verify the gene characteristics and application potential of the monoclonal clone, and to evaluate the applicable TC1 monoclonal cell line carrying the target gene HPV18 E6 obtained by the screening of the present invention.

[0050] 6. Application of Monoclonal Cell Lines The monoclonal cell line constructed by the present invention was applied to the efficacy evaluation of recombinant protein vaccine and mRNA vaccine targeting HPV18. Compared with the negative control group, the experimental group was able to effectively stimulate tumor regression.

[0051] 2. Experimental Materials: 1. Key gene information: 1) pGPG-Lenti CMV -EGFP-Puro; 2) pMD2.G; 3) psPAX2; 4) HPV18E6; 5) HPV18 E7. 2. Cell information: 1) TC-1; 2) 293T. Derived from our company's cell bank. 3. Key reagents: 1) NEBBuilder @HIFI DNA Assembly Master Mix Manufacturer: NEB Catalog No.: M5520AA Batch: 10173992; 2) DH5α Manufacturer: Qingke Biotechnology Catalog No.: TSC-1; 3) Q5 High-Fidelity 2×master Mix Manufacturer: NEB Catalog No.: M0492S Batch: 10151233; 4) Plasmid extraction kit Manufacturer: Qiagen Catalog No.: 12362 Batch: 172027473; 5) Puromycin Manufacturer: Bioengineering Catalog No.: E607054-0001 Batch: E607054-0001; 6) Lipo3000 Manufacturer: Invitrogen Catalog No.: L3000-001 Batch: 2398585; 7) Polybrene Manufacturer: MCE Item number: HY-112735 Batch: 80106; 8) FBS Manufacturer: gibco Item number: 10099-141C Batch: A2767774CP; 9) DMEM Manufacturer: gibco Item number: 10569-010 Batch: 2645318; 10) KOD oneTMPCR Master Manufacturer: TOYOBO Item number: KMM-101 Batch: 231600; 11) RNA extraction kit Manufacturer: Kangwei Century Item number: CW0584S Batch: 27723; 12) PrimescriptTM High Fidelity RT-PCR Kit Manufacturer: Baosheng Bio Item number: R022A Batch: AM32191A.

[0052] 4. Key equipment: 1) Gradient PCR instrument, manufacturer: Mona Biotechnology Co., Ltd., model: Tar2an96; 2) Monoclonal imager, manufacturer: MD model: CloneSelect Imager; 3) Inverted fluorescence microscope, manufacturer: Oaks model: CKX53; 4) Inverted microscope, manufacturer: Leica model: DMIL.

[0053] Example 1 This example provides a method for screening monoclonal cells expressing HPV18 E6 protein.

[0054] 1. Construct a vector plasmid containing the HPV 18 E6 gene.

[0055] According to the principle of homologous recombination, the vector after enzyme digestion is assembled with the target gene containing homologous arms obtained by PCR amplification. After transformation, the obtained recombinant plasmid is selected for single clone, amplified and sequenced, and the single clone sample with the correct sequence is selected for amplification and plasmid extraction for standby use. The specific implementation steps are as follows: (1) pGPG-Lenti CMV-EGFP-Puro was used as a plasmid vector and linearized using restriction endonucleases; (2) PCR amplification of HPV 18 E6 gene and HPV 18 E7 gene fragments as target gene fragments, and gel cutting to recover the target fragment bands; (3) Use the kit NEB Builder @HIFI DNA Assembly Master Mix to connect the linearized vector plasmid and the target gene; (4) Select single clones from competent transformation plates for sequencing; the sequencing results of HPV18E6 positive single clones are compared with the original sequence. Figure 1 As shown; (5) Select the single clone with correct sequencing for amplification; (6) Extract the plasmid for later use.

[0056] Results: Through the above experiments, the lentiviral plasmid pLenti-CMV-HPV18 E6-eGFP containing the target gene was constructed, and the plasmid was amplified for later use.

[0057] 2. Lentivirus packaging The three plasmids of the lentivirus were transfected into 293T cells to prepare a lentiviral suspension containing the target gene. Specific implementation steps: (1) Resuscitation and culture of 293T cells; (2) Inoculate 293T cells at an appropriate density and culture overnight in a 37°C, 5% CO2 incubator; (3) Prepare a liposome-plasmid mixture consisting of lipo3000 and lentiviral three-plasmid, and add it dropwise to the 293T cell culture dish cultured overnight; place the treated 293T cells back into the carbon dioxide incubator for culture; (4) Collect the supernatant of 293T cells cultured for 48 hours after transfection, centrifuge and filter, and place in a -80°C refrigerator for later use after packaging; add DMEM culture medium containing 10% serum to the 293T cell culture dish from which the supernatant has been removed; (5) Collect the supernatant of 293T cells cultured for 48 hours after transfection, centrifuge and filter, and place in a -80℃ refrigerator for later use after packaging; the treated 293T cells are treated as medical waste.

[0058] Results: The supernatant prepared through the above experiments was an unconcentrated virus suspension including Lenti-eGFP and Lenti-HPV18 E6-eGFP.

[0059] 3. Infect TC-1 cells with lentivirus.

[0060] TC1 cells were infected with lentiviral suspension, and after the introduction of antibiotic puromycin for screening, the initial infected cells (polyclonal cell line) were cultured. Specific implementation steps: (1) Resuscitation and culture of TC-1 cells; (2) Inoculate TC-1 cells at an appropriate density and culture overnight in a 37°C, 5% CO2 incubator; (3) Mix DMEM medium containing 10% serum and virus suspension in a ratio of 7:3 to obtain an infection suspension; discard the original culture supernatant of TC1 cells, add 2 ml of infection suspension, and then add appropriate concentration of polybrene to the culture medium; place the treated TC1 cells in a carbon dioxide incubator and culture overnight; (4) Repeat infection after 24 hours; (5) Discard the original culture supernatant in the 6-well plate where TC1 was cultured, and add 2 ml of DMEM medium containing 10% serum and an appropriate concentration of puromycin; (6) Screening of infected cells: Continue to observe the status of cultured cells. When the cells in the blank control group are completely apoptotic, the cells in the experimental group are transferred to T25 cell culture flasks for expansion culture after the cells cover the bottom of the well.

[0061] TC1 cells initially infected with lentivirus observed under fluorescence microscope Figure 2 As shown, the fluorescence microscope observation of TC1 cells infected with lentivirus after pressure screening is shown in Figure 2. Figure 3 As shown, the results show that the initial infected cells infected with the target gene and preliminarily screened were obtained, TC1-Lenti-eGFP, TC1-Lenti-HPV18E6-eGFP.

[0062] 4. Monoclonal cell screening The differences in the genome integration process of the initially infected cells result in each cell in the cell line having specific expression results, which will lead to instability in the expression and inheritance of the target gene. Therefore, it is necessary to perform monoclonal screening to select the optimal cell line. This protocol uses the limiting dilution method in conjunction with continuous photography of the monoclonal sorter to screen monoclonal cells. Specific implementation steps: Take the initially infected cells for culture; After cell counting, use a 96-well plate to perform gradient dilutions to ensure that the last three dilution ratios are less than 0.5 cells per well. Mark the numbers and place in a carbon dioxide incubator for 4 hours before taking the first photo. Take photos at 24h, 48h, and 6d respectively; Screen the monoclonal cell wells for numbering and amplification culture.

[0063] Results: Six monoclonal cell lines were obtained through screening. The information of the monoclonal cells is listed as follows:

[0064] Reference for single clone photography records Figure 4 and Figure 5 As shown, a. TC1 HPV18E6(P5G9); b. TC1 HPV18E6(P6E3); c. TC1 HPV18E6(P15G11); d. TC1 HPV18E6(P6H8); e. TC1 HPV18E6(P6C7); f. TC1HPV18E6(P6G9).

[0065] TC1 HPV18E6 (P6E3) was submitted to the deposit center for deposit, and the deposit number is CCTCC NO: C2024395. The deposit date is January 15, 2025. The culture characteristics submitted for deposit are: mouse lung epithelial cells TC1HPV18E6 (P6E3) Mus musculus, the identification result is survival, and the deposit address is Wuhan University, Wuhan, China.

[0066] 5. Monoclonal verification In the present invention, the eGFP green fluorescent protein is integrated into the tail of the target gene sequence at the beginning of the construction of the lentivirus plasmid, which is used to evaluate and observe the infection efficiency during the experiment, and the monoclonal cell verification is performed from multiple dimensions by combining the molecular biological detection method and the monoclonal camera equipment. It is worth noting that the target gene contains a complete stop codon sequence, so the non-eGFP fusion protein is expressed.

[0067] (1) The eGFP module is constructed at the end of the target gene sequence. Only when the target gene is integrated into the cell and expressed, the cell can be observed to have a fluorescent reaction under a fluorescence microscope; (2) Using monoclonal genomic target gene amplification sequencing, evaluate the correct integration of the target genes HPV18 E6 and HPV18 E7 into the TC1 genome; Gene sequencing results reference Figure 6As shown: the monoclonal cells obtained by the present invention are collected, and the target gene is obtained by PCR amplification by lysing the genome or extracting the genome. The corresponding amplified target gene is sequenced and verified, and the results show that all TC1 monoclonal cells presented by the present invention have successfully integrated the target gene, that is, the genetic modification is successful.

[0068] (3) RT-PCR was used to evaluate the transcriptional expression of the target gene HPV18 E6; RNA extraction kits were used to extract RNA from the monoclonal cells involved in the present invention, and cDNA was prepared using a cDNA synthesis kit. Then, RT-PCR verification was performed on the prepared cDNA samples.

[0069] Figure 7 This is the RT-PCR verification result of P5G9, where lane 1 and lane 2 correspond to primer 1 (F:CCTACAAGCTACCTGATCTGTG, R:atacctctgtaagttccaatactgtc) and primer 2 (F:ggaactgaacacttcactgc, R:gattcaacggtttctggcacc), respectively; lane 1 uses primer 1 to amplify the target fragment of 102 bp; lane 2 uses primer 2 to amplify the target fragment of 284 bp.

[0070] according to Figure 7 Based on the experimental results, primers with an amplified fragment length of 102 bp were used for subsequent single clone verification.

[0071] RT-PCR test results of different monoclonal cells are referenced Figure 8 As shown, Figure 8 M in the figure is DNA marker, 1.TC1, 2.TC1 HPV18E6(P6E3), 3.TC1 HPV18E6(P15G11), 4.TC1 HPV18E6(P6H8), 5.TC1HPV18E6(P6C7), 6.TC1 HPV18E6(P6G9). β-actin is the internal reference (F:ctccatcctggcctcgctgt, R:gctgtcaccttcaccgttc), the target amplified fragment size is 268bp, HPV18 E6(RT) is the target gene verification experimental group, the target amplified fragment size is 102bp. According to the RT-PCR test results, ( Figure 7 and Figure 8 ), the monoclonal clones involved in the present invention are expressed normally at the transcription level.

[0072] (4) Use a monoclonal camera to take pictures at the early stage of cell division, screen out monoclonal wells, and observe and record the cell division process.

[0073] According to the observation under fluorescence microscope, the monoclonal clones selected by the present invention all have fluorescence characteristics (such as Fig. 9 ). This result indirectly proves that the target gene HPV18E6 is normally expressed in TC1 cells.

[0074] Example 2 The selected monoclonal cells were subjected to tumorigenicity and tumor inhibition experiments in C57 mice.

[0075] The in vivo animal experiment of the screened monoclonal cells to verify the growth characteristics of the solid tumors formed by the monoclonal cell lines in animals is called tumorigenicity experiment. The stable cell lines screened and inoculated into mice, after the formation of solid tumors of appropriate size, are inoculated with vaccines corresponding to the genes carried by the tumor cells, and the changes in tumor volume and the production of serum antibodies are observed, which is called tumor inhibition experiment.

[0076] 1. HPV type 18 E6 monoclonal cell tumorigenicity experiment and tumor inhibition experiment.

[0077] Tumorigenicity experiment: Experimental grouping: SPF C57 mice were randomly divided into 5 groups, 6 mice in each group, monoclonal numbers: TC1-HPV18 E6-P6-G9; TC1-HPV18 E6-P6-H8; TC1-HPV18 E6-P6-C7; TC1-HPV18 E6-P6-E3, one strain of TC1 was used as a positive control. The experimental groups are as follows:

[0078] Monoclonal cells that have been cultured for more than 3 passages were digested with 0.05% trypsin (manufacturer: gibco, item number: 25300-062) and then dispersed. The cells were washed twice with D-PBS to remove serum. After counting, the concentration of live cells was adjusted to 5E+6 / ml, 200 μl / mouse, and injected subcutaneously behind the neck. The long and short diameters of the tumors were measured with a vernier caliper on the 7th, 13th, and 20th days after injection to calculate the tumor volume. Tumor volume calculation formula: Tumor volume V = 4 / 3 × π × (long diameter / 2) × (short diameter / 2) 2 ×1000.

[0079] Results: On the 7th day after cell injection, solid tumors were observed at the injection site. The tumor volume change data of each group were plotted as a line graph ( Fig.10) It can be seen that the tumor volume of each group showed a stable growth trend, but the growth rate was different. After the injection of TC1-HPV18 E6-P6E3 cells, the solid tumor volume grew fastest. Two cell lines TC1-HPV18 E6-P6C7 and TC1-HPV18 E6-P6E3, whose growth curves were more consistent with the control TC-1, were selected for the next experiment.

[0080] Tumor regression assay Experimental groups: C57 mice were randomly divided into 4 groups, 9 mice / group, a total of 36 mice, as shown in the table below. Tumor cells (1E+6 / mouse) were inoculated on the first day, followed by immunization with vaccines on the 6th, 13th and 20th days.

[0081]

[0082] Blood and spleen were collected 8 days after the third immunization for serum antibody and cellular immunity detection.

[0083] The 703 (HPV18 type E67) protein sequence refers to the HPV antigen shown in SEQ ID NO: 3 in the PCT patent (publication number: WO2023124116A1).

[0084] result: 1. Use a vernier caliper to measure the long and short diameters of the tumor at D15, D17, D20, D22, and D26 after tumor inoculation, and calculate the tumor volume and tumor inhibition rate. Tumor volume calculation formula: Tumor volume V = 4 / 3 × π × (long diameter / 2) × (short diameter / 2) 2 ×1000.

[0085] Tumor inhibition rate (%) = (average volume of transplanted tumors in the tumor control group - average volume of transplanted tumors in the experimental group) / average volume of transplanted tumors in the tumor control group × 100%.

[0086] Tumor growth curve of tumor-bearing mice Fig.11 As shown, the "arrow" indicates the vaccine immunization time. The results showed that the TC1-HPV18 E6-P6-E3 cell line had a faster tumor formation effect and had obvious tumor formation and tumor inhibition effects after vaccine immunization.

[0087] Vaccine 703 (HPV18E67) made with HPV18 E67 protein has inhibitory effects on monoclonal cells TC1-HPV18 E6-P6-C7 and TC1-HPV18 E6-P6-E3 ( Fig.12 ).

[0088] 2. Humoral immunity and cellular immunity The 703 (HPV18 type E67) protein antigen was used to coat the serum antibody titer. The test results are as follows:

[0089] Both groups of animals produced high titers of serum antibodies.

[0090] Flow cytometry was used to detect CD4+T and CD8+T in spleen cells. The results were as follows:

[0091] Both experimental groups induced mice to produce high levels of specific CD4+T cell and CD8+T cell immune responses, indicating that the administration of vaccine 703 (HPV18E67) can induce cells to produce higher humoral immunity and cellular immunity.

[0092] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

[0093] The sequence shown in SEQ ID NO: 1 is as follows: Atggcgcgctttgaggatccaacacggcgaccctacaagctacctgatctgtgcacggaactgaacacttcactgcaagacatagaaataacctgtgtatattgcaagacagtattgga acttacagaggtatttgaatttgcatttaaagatttatttgtggtgtatagagacagtataccccatgctgcatgccataaatgtatagatttttattctagaattagagaattaagaca ttattcagactctgtgtatggagacacattggaaaaactaactaacactgggttatacaatttattaaaggtgcctgcggtgccagaaaccgttgaatccagcagaaaaacttagac accttaatgaaaaacgacgatttcacaacatagctgggcactatagaggccagtgccattcgtgctgcaaccgagcacgacaggaacgactccaacgacgcagagaaacacaagtataa.

Claims

1. A monoclonal cell expressing HPV18 type E6 protein, characterized in that: It is deposited in China Center for Type Culture Collection with the deposit number CCTCC NO: C2024395.

2. Use of the monoclonal cell expressing HPV18 E6 protein as claimed in claim 1 in constructing an HPV tumor animal model.

3. The use according to claim 2, characterized in that: The application includes: administering the monoclonal cells expressing HPV18 type E6 protein to non-human mammals to obtain an HPV tumor animal model that forms a solid tumor.

4. The use according to claim 3, characterized in that: The non-human mammal is selected from mice, rats, rabbits, dogs, cats, macaques, pigs, cows, sheep or horses.

5. A method for establishing an HPV tumor animal model, characterized in that: The method comprises the following steps: administering the monoclonal cell expressing HPV18 type E6 protein according to claim 1 to a non-human mammal.

6. The method for establishing an HPV tumor animal model according to claim 5, characterized in that: The non-human mammal is selected from mice, rats, rabbits, dogs, cats, macaques, pigs, cows, sheep or horses.

7. The method for establishing an HPV tumor animal model according to claim 5, characterized in that: The monoclonal cells were injected into non-human mammals at a dose of 1×10 5 ~1×10 10 / Kg animal.

8. Use of the monoclonal cell expressing HPV18 type E6 protein as described in claim 1 or the HPV tumor animal model established by the method for establishing an HPV tumor animal model as described in any one of claims 5 to 7 in screening pharmaceutical compositions or vaccine compositions for preventing and / or treating HPV.

9. The use according to claim 8, characterized in that: The application includes the following application modes: After a solid tumor is formed in the HPV tumor animal model, the drug composition or vaccine composition to be tested is administered, and the therapeutic and / or preventive effect of the drug composition or vaccine composition is determined based on the tumor inhibition effect.

10. The use according to claim 8, characterized in that: The vaccine composition is a protein vaccine, an RNA vaccine or a DNA vaccine.

Images