Infectious bursal disease virus VP3 phosphorylated deletion virus as well as construction method and application thereof

Abstract

The invention relates to an infectious bursal disease virus VP3 phosphorylated deletion virus as well as a construction method and application thereof. Specifically, the invention provides the infectious bursal disease virus VP3 phosphorylation deletion virus, the infectious bursal disease virus VP3 phosphorylation deletion virus comprises a mutant plasmid and a rescue vector loaded with the mutant plasmid, and mutation points of the mutant plasmid are as follows: 130th serine of VP3 protein is mutated into alanine and 163rd serine is mutated into alanine. The infectious bursal disease virus VP3 phosphorylation deletion virus provided by the invention can be used as a powerful tool for researching an infectious bursal disease virus VP3 phosphorylation mechanism.

Description

Technical Field

[0001] The present application relates to the fields of molecular biology and biomedicine, and specifically to an infectious bursal disease virus VP3 phosphorylation-deficient virus, a construction method and an application thereof. Background Art

[0002] Infectious Bursal Disease (IBD) is a highly acute, contact-transmitted avian infectious disease caused by infection with the infectious bursal disease virus (IBDV). VP3 protein is the main inner shell protein of IBDV. Studies have found that phosphorylation modification of VP3 protein plays an important regulatory role in its function. For example, studies have shown that IBDV infection induces upregulation of Cdc7 expression, which subsequently causes phosphorylation of Serine 13 (S13) residues on the VP3 protein, a modification that is essential for the effective replication of the virus in host cells. The significance of studying VP3 phosphorylation modification is also to provide potential antiviral targets, which may effectively inhibit the replication of IBDV by interfering with the VP3 phosphorylation pathway. For example, the development of inhibitors targeting specific phosphorylation sites of VP3 may block the effective replication of the virus and reduce the pathogenicity of the virus, thereby providing new ideas for the development of drugs against IBDV infection. At present, in the study of the effect of VP3 protein phosphorylation modification on the replication of infectious bursal disease virus, there are problems such as unclear VP3 phosphorylation sites and lack of effective research tools. Summary of the invention

[0003] The purpose of the present application is to provide an infectious bursal disease virus VP3 phosphorylation-deficient virus, a construction method and its application, aiming to solve the problems of unclear VP3 phosphorylation sites and lack of effective research tools in the prior art.

[0004] In order to achieve the above application purpose, the technical solution adopted in this application is as follows: In the first aspect, the infectious bursal disease virus VP3 phosphorylation-deficient virus provided by the present application includes a mutant plasmid and a rescue vector carrying the mutant plasmid, and the mutation points of the mutant plasmid are: the serine at position 130 of the VP3 protein mutates to alanine and / or the serine at position 163 mutates to alanine.

[0005] The infectious bursal disease virus VP3 phosphorylation-deficient virus provided in the first aspect of the present application can be used as a powerful tool for studying the phosphorylation mechanism of infectious bursal disease virus VP3, because the rescue vector carries a mutant plasmid in which the serine at position 130 of the VP3 protein is mutated to alanine and / or the serine at position 163 is mutated to alanine, thereby providing a basis for studying infectious bursal disease virus vaccines.

[0006] In a second aspect, the present application provides an infectious bursal disease virus VP3 phosphorylation-deficient virus, in which the serine at position 130 of the VP3 protein is mutated to alanine and / or the serine at position 163 is mutated to alanine.

[0007] The second aspect of the present application provides an infectious bursal disease virus VP3 phosphorylation-deficient virus, which has a VP3 protein phosphorylation site deletion in the infectious bursal disease virus plasmid due to the mutation of serine at position 130 of the VP3 protein to alanine and serine at position 163 of the VP3 protein to alanine, thereby providing a strategy for subsequent studies on the effect of VP3 protein phosphorylation modification on the replication of infectious bursal disease virus.

[0008] In a third aspect, the present application provides a method for constructing an infectious bursal disease virus VP3 phosphorylation-deficient virus, comprising the following steps: Step S20, mutating the serine at position 130 of the VP3 protein to alanine and / or mutating the serine at position 163 to alanine to obtain a mutant plasmid; Step S30: transfect the mutant plasmid into the rescue vector using a first transfection reagent to obtain an infectious bursal disease virus VP3 phosphorylation-deficient virus.

[0009] The third aspect of the present application provides a method for constructing an infectious bursal disease virus VP3 phosphorylation-deficient virus, which mutates the serine at position 130 of the VP3 protein to alanine, and the serine at position 163 of the VP3 protein to alanine, thereby constructing an infectious bursal disease virus with a missing VP3 protein phosphorylation site.

[0010] In a fourth aspect, the present application provides an application of the infectious bursal disease virus VP3 phosphorylation-deficient virus or the infectious bursal disease virus VP3 phosphorylation-deficient virus prepared by the construction method described above in the preparation of vaccines, drugs and diagnostic reagents.

[0011] It is precisely because the infectious bursal disease virus VP3 phosphorylation-deficient virus in this application has undergone dual phosphorylation site mutations at S130 and S163, which leads to enhanced IBDV virus replication ability, enhanced dsRNA binding ability, and enhanced auxiliary polymerase activity, that it can be used as an IBDV candidate vaccine strain. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present application. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0013] Figure 1 The Phospho net3.1 online tool predicts the VP3 phosphorylation modification site map and the specific distribution map of high-scoring sites in VP3; Figure 2A This is the immunoprecipitation staining diagram of VP3 phosphorylation modification sites; Figure 2B The mass spectrometry prediction map of the VP3 phosphorylation modification site of S130A; Figure 2C The mass spectrometry prediction map of the VP3 phosphorylation modification site of S163A; Figure 3 Western blot validation diagram for predicted phosphorylation site mutations; Figure 4 This is a Western blot verification diagram of VP3 phosphorylation modification sites; Figure 5A This is a graph showing the enhanced replication ability of viruses with VP3 phosphorylation site mutations; Figure 5B It is a statistical chart of TCID50 determination results; Figure 6 This is a diagram showing the enhancement of the interaction ability between VP3 phosphorylation site mutation and dsRNA; Figure 7 Diagram showing that VP3 phosphorylation site mutations enhance VP1 polymerase activity. DETAILED DESCRIPTION

[0014] In order to make the technical problems, technical solutions and beneficial effects to be solved by the present application more clearly understood, the present application is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present application and are not used to limit the present application.

[0015] In a first aspect, an embodiment of the present application provides an infectious bursal disease virus VP3 phosphorylation-deficient virus, including a mutant plasmid, wherein the mutation points of the mutant plasmid are: the serine at position 130 of the VP3 protein mutates to alanine and / or the serine at position 163 mutates to alanine.

[0016] The infectious bursal disease virus VP3 phosphorylation-deficient virus provided in the embodiments of the present application can be used as a powerful tool for studying the phosphorylation mechanism of infectious bursal disease virus VP3, since the rescue vector carries a mutant plasmid in which the serine at position 130 of the VP3 protein is mutated to alanine and / or the serine at position 163 is mutated to alanine, and provides a basis for studying infectious bursal disease virus vaccines.

[0017] In some embodiments, the mutant plasmid includes a first mutant plasmid or a second mutant plasmid. Specifically, the first mutant plasmid includes Myc-VP3-S130A, Myc-VP3-S163A and Myc-VP3-SSAA; the sequence of Myc-VP3-S130A is shown in SEQ ID NO: 1, the sequence of Myc-VP3-S163A is shown in SEQ ID NO: 2, and the sequence of Myc-VP3-SSAA is shown in SEQ ID NO: 3. The second mutant plasmid includes T7-A VP3S130A 、T7-A VP3S163A and T7-A VP3SSAA ;T7-A VP3S130A The sequence of T7-A is shown in SEQ ID NO:4. VP3S163A The sequence of T7-A is shown in SEQ ID NO:5. VP3SSAA The sequence is shown in SEQ ID NO:6.

[0018] In a second aspect of an embodiment of the present application, an infectious bursal disease virus VP3 phosphorylation-deficient virus is provided, wherein the serine at position 130 of the VP3 protein is mutated to alanine and / or the serine at position 163 is mutated to alanine.

[0019] The infectious bursal disease virus VP3 phosphorylation-deficient virus provided in the embodiments of the present application has a VP3 protein phosphorylation-deficient site in the infectious bursal disease virus plasmid due to the mutation of serine at position 130 of the VP3 protein to alanine and the mutation of serine at position 163 of the VP3 protein to alanine, thereby causing the deletion of the VP3 protein phosphorylation site in the infectious bursal disease virus plasmid, providing a strategy for subsequent studies on the effect of VP3 protein phosphorylation modification on the replication of infectious bursal disease virus.

[0020] The third aspect of the present application provides a method for constructing an infectious bursal disease virus VP3 phosphorylation-deficient virus, comprising the following steps: Step S20, mutating the serine at position 130 of the VP3 protein to alanine and / or mutating the serine at position 163 to alanine to obtain a mutant plasmid; Step S30: transfect the mutant plasmid into the rescue vector using a first transfection reagent to obtain an infectious bursal disease virus VP3 phosphorylation-deficient virus.

[0021] In some embodiments, to determine the phosphorylation modification site of VP3, step S10 is further included before step S20: Step S11, using Netphospho3.1 online tool to predict the potential phosphorylation sites of VP3 protein on IBDV JX strain for the first time, and obtaining the first prediction result; Step S12, using the A segment VP3 gene sequence of IBDV JX strain as a template to construct a recombinant plasmid; Step S13: Use immunoprecipitation and mass spectrometry methods to perform a second prediction of potential phosphorylation sites of VP3 protein on the recombinant plasmid to obtain a second prediction result.

[0022] In the examples of the present application, the results of the identification using immunoprecipitation and mass spectrometry methods can more accurately and conveniently find the phosphorylation modification sites of the VP3 protein.

[0023] In some embodiments, in step S11, the site with a prediction score greater than 0.9 in the first prediction result is taken as the first VP3 protein potential phosphorylation site. In some specific embodiments, the amino acid sequence of VP3 is obtained according to the VP3 gene sequence of IBDV JX strain (GenBank: OR743230 and OR743231), and the potential phosphorylation sites of VP3 protein are predicted using the Netphospho3.1 online tool. The sites with a prediction score greater than 0.9 are: T92 (0.983), S105 (0.997), S130 (0.995), Y150 (0.973), S163 (0.992), and S253 (0.997).

[0024] In some embodiments, in step S12, the method for constructing a recombinant plasmid comprises the following steps: The VP3 gene sequence of the A segment of IBDV JX strain was used as a template and amplified (PCR) using the VP3-F and VP3-R primer pairs to obtain a B amplification product. The sequence of VP3-F is shown in SEQ ID NO:7, and the sequence of VP3-R is shown in SEQ ID NO:8. The gene sequences of the primer pairs are as follows: VP3-F: 5'-ATGGCATCAGAGTTCAAAGAGACCC-3'; VP3-R: 5' -TTACTCAAGGTCCTCATCAGAGACG -3'.

[0025] Extract the DNA solution from the amplified product B, and use the enzyme digestion system to double-digest the DNA solution and the pCMV-Myc-N empty vector to obtain the digested DNA fragment and the digested vector, respectively. Use T4 DNA ligase to connect the digested DNA fragment and the digested vector to obtain a ligation product; The ligation product was transformed into DH5α competent cells, cultured, and the plasmid was extracted to obtain the recombinant plasmid.

[0026] In some embodiments, in step S13, the method of performing co-immunoprecipitation and mass spectrometry comprises the following steps: The recombinant plasmid and the Flag-MARK1 plasmid were co-transfected into 293T cells using the Exfect transfection reagent. The protein was collected for co-immunoprecipitation. The precipitated sample was subjected to SDS-PAGE electrophoresis and Coomassie Brilliant Blue staining. The VP3-specific band was cut for mass spectrometry identification. In some specific embodiments, in step S13, it can be basically confirmed that the VP3 phosphorylation modification sites are S130A and S163A.

[0027] In some embodiments, to further determine the reliability of the VP3 phosphorylation modification sites S130A and S163A, step S10 further includes the step of verifying the second prediction result: Step S14, designing a third mutation primer according to the first prediction result and constructing a third mutation plasmid using the Myc-VP3 plasmid as a template, wherein the sequence of the Myc-VP3 plasmid is shown in SEQ ID NO: 33; Step S15, transfecting the third mutant plasmid into HEK-293T cells using a second transfection agent; Step S16: Based on the first prediction result, HEK-293T cells carrying the third mutant plasmid are subjected to Western blot verification to verify the second prediction result.

[0028] In the examples of the present application, the phosphorylation modification sites were verified by gene site-directed mutagenesis and Western blot methods, which have the advantages of simple operation, low technical threshold and short cycle.

[0029] In some embodiments, in step S14, the third mutation primer includes a third forward primer and a third reverse primer, the sequence of the third forward primer is at least one of SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, and SEQ ID NO:31, and the sequence of the third reverse primer is at least one of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, and SEQ ID NO:32.

[0030] In some embodiments, in step S15, the third mutant plasmid is transfected into HEK-293T cells using a second transfection agent, and the second transfection agent is an Exfect transfection reagent.

[0031] In some embodiments, step S16, based on the first prediction result, Western blot verification is performed on HEK-293T cells carrying the third mutant plasmid to verify the second prediction result to verify whether the second prediction result is accurate.

[0032] The present application embodiment provides a method for constructing a recombinant plasmid of infectious bursal disease virus, which verifies the phosphorylation modification site by gene site-directed mutagenesis and Western blot method, and has the advantages of simple operation, low technical threshold and short cycle. Then, the VP3 phosphorylation modification deletion of the recombinant strain is achieved by mutating the phosphorylation modification site of the VP3 fragment on the rescue plasmid, which has the characteristics of convenient operation. In a specific embodiment, in step S16, it can be further confirmed that the VP3 phosphorylation modification site is S130A and S163A.

[0033] In some embodiments, a first mutant plasmid is obtained according to the second prediction result. Specifically, the first mutant plasmid is directly screened out from the third mutant plasmid based on the VP3 phosphorylation modification sites of S130A and S163A, and the first mutant plasmid includes Myc-VP3-S130A, Myc-VP3-S163A and Myc-VP3-SSAA; the sequence of Myc-VP3-S130A is shown in SEQ ID NO: 1, the sequence of Myc-VP3-S163A is shown in SEQ ID NO: 2, and the sequence of Myc-VP3-SSAA is shown in SEQ ID NO: 3.

[0034] In another embodiment, based on the VP3 phosphorylation modification sites of S130A and S163A, the Myc-VP3 plasmid is used as a template, wherein the sequence of the Myc-VP3 plasmid is as shown in SEQ ID NO: 33, and a first mutant primer is used to perform a first reverse amplification to obtain a first mutant plasmid, wherein the first mutant primer includes a first forward primer and a first reverse primer, the sequence of the first forward primer is at least one of SEQ ID NO: 9, SEQ ID NO: 11, SEQ ID NO: 13, and SEQ ID NO: 15, and the sequence of the first reverse primer is at least one of SEQ ID NO: 10, SEQ ID NO: 12, SEQ ID NO: 14, and SEQ ID NO: 16.

[0035] Based on the above-mentioned VP3 phosphorylation modification sites of S130A and S163A, a second mutant plasmid was obtained, which specifically includes the following steps: Step S40, mutating the serine at position 130 of the VP3 protein encoded in the T7-A plasmid to alanine and / or mutating the serine at position 163 to alanine to obtain a second mutant plasmid; Step S50: transfect the second mutant plasmid and the T7-B plasmid into BSRT7 cells using a third transfection reagent to obtain an infectious bursal disease virus VP3 phosphorylation-deficient virus.

[0036] The IBDV rescue system provided in the embodiment of the present application is an IBDV rescue system based on a polymerase II type promoter, namely, a T7 promoter, including two plasmids, T7-A and T7-B (T7-A is an expression plasmid in which IBDV Segment A is cloned downstream of the T7 promoter; T7-B is an expression plasmid in which IBDV Segment B is cloned downstream of the T7 promoter). Infectious IBDV can be rescued by cooperating with BSRT7 cells (BHK-21 stable cell line that can stably express T7 polymerase), and infectious bursal disease virus VP3 phosphorylation-deficient virus can be obtained. The IBDV two-plasmid rescue system based on the T7 promoter has the advantages of high rescue efficiency and high success rate.

[0037] In some embodiments, in step S40, a T7-A plasmid is used as a template, and the sequence of the T7-A plasmid is shown in SEQ ID NO:34. A second reverse amplification is performed using a second mutation primer to obtain a second mutation plasmid, wherein the second mutation primer includes a second forward primer and a second reverse primer, and the sequence of the second forward primer is at least one of SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, and SEQ ID NO:15, and the sequence of the second reverse primer is at least one of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:16; In some embodiments, in step S50, the second mutant plasmid and the T7-B plasmid are transfected into BSRT7 cells using a third transfection reagent to obtain an infectious bursal disease virus VP3 phosphorylation-deficient virus.

[0038] The third aspect of the embodiments of the present application provides an infectious bursal disease virus VP3 phosphorylation-deficient virus or an infectious bursal disease virus VP3 phosphorylation-deficient virus prepared by a construction method, and its use in the preparation of vaccines, drugs and diagnostic reagents.

[0039] It is precisely because the infectious bursal disease virus VP3 phosphorylation-deficient virus in this application has undergone dual phosphorylation site mutations at S130 and S163, which leads to enhanced IBDV virus replication ability, enhanced dsRNA binding ability, and enhanced auxiliary polymerase activity. Therefore, it can be used as an IBDV candidate vaccine strain and can be used as a powerful research tool in the development of drugs and diagnostic reagents.

[0040] The following describes the invention in conjunction with specific embodiments.

[0041] The following examples are provided for a better understanding of the present invention, but are not intended to limit the present invention. The experimental methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples are purchased from conventional biochemical reagent stores unless otherwise specified. The quantitative tests in the following examples were repeated three times, and the results were averaged.

[0042] <Cell Culture and Viruses> HEK293T cells were purchased from CCTCC, DMEM medium used for culture was purchased from Gibco, and fetal bovine serum was purchased from ExCellBio; DF-1 cells and MEM medium and fetal bovine serum used for culture were purchased from Xiamen Yimo Biotechnology Co., Ltd.

[0043] All cell lines were cultured at 37°C in an environment containing 5% CO2. The virus IBDV JX strain (GenBank: OR743230 and OR743231) used was isolated and preserved in our laboratory. WT IBDV was a live virus rescued by transfecting T7-A plasmid and T7-B plasmid into BSRT7 cells. SSAA IBDV was a live virus rescued by transfecting T7-A plasmid and T7-B plasmid into BSRT7 cells. AVP3SSAA Plasmid and T7-B plasmid were transfected into BSRT7 cells to rescue live viruses. WT-VP3 protein sample is the protein sample obtained by Myc-VP3. Tissue half infectious dose (TCID50) was tested in chicken embryo fibroblast (DF-1) cells.

[0044] <Antibodies> Mouse monoclonal antibodies against Flag protein, mouse monoclonal antibodies against Myc protein, and β-actin antibody were purchased from Protein tech. Anti-Flag protein agarose was purchased from Abmart. Polyclonal antibodies against VP1, VP2, and VP3 proteins were homemade in our laboratory. Goat anti-rabbit secondary antibody was purchased from KPL. NP-40 lysis buffer (containing 50 mM Tris [pH 7.4], 150 mM NaCl, 1% NP-40) was purchased from Beyotime Biotechnology Co., Ltd. Protein loading buffer was purchased from Beijing Solebao Technology Co., Ltd.

[0045] <Plasmid construction> The synthesis of primers (the first mutant primer, the second mutant primer, the third mutant primer) was completed by Beijing Tsingke Biotechnology Co., Ltd. 2×Taq Master Mix, nucleic acid agarose, nucleic acid maker, and DH5α competent cells were purchased from Beijing Tsingke Biotechnology Co., Ltd. The DNA gel recovery kit, PCR product purification kit, agarose, sodium chloride, yeast powder, and tryptone were purchased from Beijing Solarbio Science & Technology Co., Ltd. All restriction endonucleases (DpnⅠ enzyme, RNaseA) were purchased from Takara. The T4 ligase was purchased from Beyotime Biotechnology Co., Ltd. The plasmid extraction kit was purchased from Tiangen. The Exfect transfection reagent was purchased from Novoprotein. The protein prestained maker and PBS buffer were purchased from Sevier. The empty vector plasmids pCMV-Flag-N and pCMV-Myc-N were purchased from Wuhan Miaoling Biotechnology Co., Ltd.

[0046] <SDS-PAGE and Western blot> Sodium dodecyl sulfate (SDS), electrophoresis buffer Tris8.8, and electrophoresis buffer Tris6.8 were purchased from Beijing Solarbio Science & Technology Co., Ltd. 40% acrylamide was purchased from Sangon Biotech (Shanghai) Co., Ltd. Coomassie brilliant blue staining solution, ammonium persulfate substitute (APS), and TEMED were purchased from Beyotime Biotechnology Co., Ltd. The nitrocellulose membrane (NC membrane) for immunoblotting (Western blot) was purchased from Merck; the filter paper was purchased from Bio-Rad. PBST is a combination of phosphate buffer (PBS) and Tween-20.

[0047] In the results of immunoblotting (Western blot), at the light chain with a molecular weight below 25 kDa and the heavy chain with a molecular weight of 40 - 5525 kDa, p-VP3 indicates the phosphorylation of VP3. Flag-MARK1 or MARK1 is the gene / protein name.

[0048] <Other reagents> Buffer P1 is a buffer whose main components include 50 mM Tris-HCl (pH 8.0), 10 mM EDTA, and 100 μg / ml RNase A. Buffer P2 is a lysis buffer for purifying plasmid DNA. The main components are 0.2 mol / L NaOH and 1% SDS. Buffer P3 is a buffer. Wash buffer. Elution buffer (EB, Elution Buffer). Phanta Max Master Mix is a high-fidelity DNA polymerase purchased from Novoprotein Nanjing Co., Ltd. Double-distilled water (ddH2O).

[0049] Example 1

[0050] Rescue of Recombinant Virus with Deletion of Phosphorylation Modification of IBDV VP3 <Prediction of Potential Phosphorylation Sites of VP3 Protein> The amino acid sequence of VP3 was obtained according to the VP3 gene sequence of IBDV JX strain (GenBank: OR743230 and OR743231). The online tool Netphospho3.1 was used to predict the potential phosphorylation sites of VP3 protein. As Figure 1 shown, the sites with a prediction score greater than 0.9 are: T92(0.983), S105(0.997), S130(0.995), Y150(0.973), S163(0.992), S253(0.997).

[0051] <Construction of Recombinant Plasmid of VP3 Protein> 1) Primer design: According to the VP3 gene sequence of the A fragment of IBDV JX strain, primers for constructing eukaryotic expression vectors were designed. The primer sequences are as follows: VP3-F: 5' -ATGGCATCAGAGTTCAAAGAGACCC -3' (nucleotide sequence shown in SEQ IDNO:7); VP3-R: 5' -TTACTCAAGGTCCTCATCAGAGACG -3' (nucleotide sequence shown in SEQ IDNO:8).

[0052] 2) PCR amplification: Using the VP3 gene sequence of the A fragment of IBDV JX strain as a template, PCR was performed with VP3-F and VP3-R primer pairs to obtain amplification product B (VP3 fragment). The template DNA was selected from the VP3 gene sequence of the A fragment of IBDV JX strain, and the template DNA was stored in our laboratory. The PCR amplification reaction system is as follows: 2×Taq Master Mix 25μL Template DNA 1μg VP3-F 2μL VP3-R 2μL The system was adjusted to 50μL with ddH2O.

[0053] The reaction conditions were: pre-denaturation at 95℃ for 5 min, and the cycling process was denaturation at 95℃ for 30 s, annealing at 56℃ for 30 s, extension at 72℃ for 1 min, for a total of 35 cycles, and a final extension at 72℃ for 10 min.

[0054] After the PCR amplification reaction is completed, 1% agarose gel electrophoresis is used to observe the VP3 band with the same size as the target fragment. Then the gel is cut and the gel is recovered using a gel extraction kit. The specific steps are as follows: (A) After 1% agarose gel electrophoresis, the gel was cut under UV light, and the cut gel pieces were put into a 2.0 mL centrifuge tube for collection; (B) The gel pieces were weighed, and 200 μL Buffer A was added for every 0.1 g of gel pieces, and the gel pieces were placed in a 55°C water bath for 20 min until the gel pieces were completely melted. (C) Buffer B was added to the melted gel solution in an equal volume as the gel solution, and mixed thoroughly. (D) The mixed solution in step (C) was transferred to a centrifugal binding column equipped with a cannula, and centrifuged at 10,000 r / min at room temperature for 30 s, the substrate waste liquid was discarded, and centrifuged 2-3 times until all the mixed solution was bound to the centrifugal column. (E) Add 500 μL Wash Buffer A to the centrifuge tube of the binding column, centrifuge at 10,000 r / min at room temperature for 30 s, and discard the substrate waste liquid; (F) Add 500 μL Wash Buffer B to the centrifuge tube of the binding column, centrifuge at 10,000 r / min at room temperature for 30 s, and discard the substrate waste liquid. (G) Centrifuge the centrifuge column in step (F) at 10,000 r / min for 2 min, and leave it open for 2 min. (H) Place the centrifuge column in a 1.5 mL sterile centrifuge tube, add 50 μL elution buffer to the centrifuge column, and centrifuge at 10,000 r / min at room temperature for 1 min to obtain the purified DNA solution.

[0055] 3) Enzyme digestion of target fragment and vector: Use the enzyme digestion system to double-digest the DNA solution and the pCMV-Flag-N and pCMV-Myc-N empty vector plasmids to obtain the digested DNA fragments and digested vectors, respectively.

[0056] The target fragment DNA solution and the pCMV-Flag / Myc-N empty vector solution were double-digested respectively, and the enzyme digestion system was as follows: 10*Buffer 10μL EcoR 3μL Xho 3μL DNA / vector 5μg ddH2O to100μL Reaction conditions: 37℃ water bath for 2h. Then clean and recycle, the specific steps are as follows: (A) Centrifuge the digested product to remove the liquid on the tube wall, add 400 μL of binding solution, and gently blow to mix. (B) Transfer the mixed solution from the previous step to a centrifugal binding column equipped with a sleeve, centrifuge at 12000 r / min at room temperature for 30 s, and discard the waste liquid. (C) Add 500 μL Wash Buffer to the centrifuge tube of the binding column, centrifuge at 12000 r / min at room temperature for 30 s, and discard the waste liquid. (D) Repeat step C. (E) Centrifuge the centrifuge tube at 12000 r / min for 2 min, and leave it open for 2 min. (F) Place the centrifuge column in a 1.5 mL sterile centrifuge tube, add 50 μL of heated elution solution to the centrifuge column, let it stand for 2 min, and centrifuge at 12000 r / min for 2 min to obtain the digested DNA fragments and vector.

[0057] 4) Ligation: Use T4 DNA ligase to connect the digested DNA fragment and the digested vector to obtain a ligation product. The reaction system (10 μL) is as follows: 10×T4 DNA ligase buffer 1μL T4 DNA ligase 0.5 μL Enzyme digestion recovery vector (50 ng / μL) 1μL Enzyme digested target fragment (100 ng / μL) 2μL ddH2O 5.5μL Reaction conditions: 4°C overnight ligation; 5) Transformation: Take out the DH5α competent cells from the -80℃ refrigerator and thaw them on ice. Transform the ligation product into the DH5α competent cells and mix thoroughly. Place the mixture on ice for 10 min. Heat shock the mixture in a 42℃ water bath for 90 s. Take out the mixture and quickly place it on ice for 5 min. Add 1 mL of LB medium without antibiotics to the mixture and place it on a shaking shaker at 37℃ for 45 min. Centrifuge the mixture in the centrifuge tube at low speed (3000 r / min) for 10 min. Centrifuge all the competent cells to the bottom of the tube. Discard the upper LB medium and keep about 100 μL. Use a pipette to resuspend the competent cells at the bottom of the tube and add them to the prepared ampicillin solid LB medium plate. Let it stand for 10 min. Place the plate upside down in a 37℃ incubator overnight. Pick a single colony for shaking culture and send it to General Biotech Co., Ltd. for first-generation sequencing. Sequencing uses CMV-F primer forward detection.

[0058] 6) Plasmid extraction: Sequencing alignment was performed on the sequencing results returned by the sequencing company. The correct clones were those that matched the VP3 template sequence. The plasmid was extracted using the bacterial solution of the correct clones to obtain the recombinant plasmid. The specific steps were as follows: (A) Pipette 100 μL of the original bacteria into a 100 mL sterilized conical flask, and add 20 mL of ampicillin liquid LB medium to the conical flask for overnight culture. (B) Take 10 mL of the bacterial solution and transfer it to a 15 mL centrifuge tube. Centrifuge at 1000 r / min at room temperature for 5 min to centrifuge all the bacterial solution to the bottom of the tube, and discard the supernatant waste liquid. (C) Add 500 μL of Buffer P1 containing RNaseA to the centrifuge tube, resuspend the bacteria on both sides充分, and let it stand for 5 min; (D) Add 500 μL of Buffer P2 to the centrifuge tube, gently invert the centrifuge tube 5 - 8 times until the liquid becomes clear and relatively transparent, and let it stand at room temperature for 5 min. (E) Add 700 μL of Buffer P3 to the centrifuge tube, gently invert the centrifuge tube 5 - 8 times until white flocculates appear, let it stand at room temperature for 5 min, and then centrifuge at 12000 r / min at high speed for 10 min at room temperature until all the flocculates precipitate to the bottom of the tube. (F) Take the supernatant in (E) and transfer it to an adsorption column with a bottom tube. Centrifuge at 12000 r / min at high speed for 30 s at room temperature, and repeat 2 - 3 times until all the supernatant passes through the adsorption column. (G) Add 500 μL of Wash buffer to the adsorption column, centrifuge at 12000 r / min at high speed for 30 s at room temperature, discard the waste liquid, and repeat the washing once. (H) Centrifuge the adsorption column at 12000 r / min at high speed for 1 min at room temperature, open the lid and let it stand at room temperature for 1 min. (I) Put the adsorption column into a new 1.5 mL sterile centrifuge tube, add 100 μL of EB (Elution Buffer), and let it stand at room temperature for 1 min. (J) Centrifuge the adsorption column at 12000 r / min at high speed for 1 min at room temperature to elute the recombinant plasmids (Flag-VP3 and Myc-VP3) on the adsorption column. After measuring the concentration, store it at -20°C for later use.

[0059] <Mass spectrometry identification of potential phosphorylation sites of VP3 protein> 1) Transfection: Use Exfect transfection reagent to transfect the recombinant plasmid into HEK-293T cells. Specific operation steps are as follows: (A) HEK-293T cells are cultured in a six-well cell culture plate. When the density grows to about 80%, transfection can be performed. (B) Set up the experimental group and the control group, prepare two sterile EP tubes, add 100 μL of serum-free DMEM medium to each, add 10 μL of Exfect transfection reagent to the two A tubes and mix gently, add 2μg of Flag-VP3 plasmid to the B tube of the control group, add 2μg of Flag-VP3 plasmid and Flag-MARK1 plasmid to the B tube of the experimental group and mix gently, and let it stand for 5 min. (C) Add 10 μL of Exfect transfection reagent in one A tube to the B tube of the experimental group and mix evenly, and add 10 μL of Exfect transfection reagent in another A tube to the B tube of the control group and mix evenly, and let it stand for 15 min. (D) The mixed solution in tube B of the experimental group and the mixed solution in tube B of the control group were added dropwise into a 6-well plate and gently shaken. After 6 hours, the culture medium was changed to DMEM medium containing 2% serum and cultured for a further 48 hours to obtain transfected cells.

[0060] 2) Co-immunoprecipitation (Co-IP): The transfected experimental group cells and culture medium, and the control group cells and culture medium were collected into different EP tubes, centrifuged at 3000r / min for 5min, and the supernatant was discarded and 200 μL NP-40 lysis buffer was added, mixed by pipetting, placed on lysis ice for 10 min, and centrifuged at 12000r / min for 10 min. The supernatant was taken, 5 μL anti-Flag agarose was added, mixed gently, placed on a shaker at 4℃ for 3 h, centrifuged at 1000r / min for 3 min at 4℃, and the supernatant was discarded. NP-40 lysis buffer was added to wash the agarose, and the washing was repeated 3 times. An appropriate amount of NP-40 lysis buffer and protein loading buffer were added, and the sample was boiled at 95℃ for 10 min to obtain the target protein of the experimental group and the target protein of the control group, respectively.

[0061] 3) SDS-PAGE and Coomassie Brilliant Blue Staining: (A) Prepare polyacrylamide gel, including 8% separation gel and 5% stacking gel, the formula is shown in Table 1 below: Table 1 Name of each component 5% concentrated gel 8% separation gel <![CDATA[H2O]]> 1.21 mL 2.6 mL 40% Acrylamide 250 μL 1 mL Tris8.8 0 μL 1.25 Tris6.8 0.5 mL 0 μL 10% SDS 20 μL 50 μL 10%APS 20 μL 50 μL TEMED 2 μL 2 μL Prepare the lower-layer gel according to the above formula. First, pour the lower-layer separating gel well, add isopropanol to the upper layer for pressure line, let it stand at room temperature until the lower-layer gel solidifies, then discard the upper-layer isopropanol and wash it three times with double-distilled water. Prepare the upper-layer stacking gel and pour it. Quickly insert the sample comb, let it stand at room temperature for 1 h until the upper-layer gel solidifies, then gently take out the comb for the subsequent sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDA-PAGE) experiment; (B) Loading: Add 2 μL of protein prestained marker to the first lane; add the control group (Flag-VP3) sample to the second lane; add the experimental group (Flag-VP3 + Flag-MARK1) sample to the third lane. (C) Electrophoresis: The electrophoresis equipment uses a Bio-Rad mini vertical electrophoresis system. First, perform electrophoresis at a low voltage (80 V) for about 30 min. After the bromophenol blue enters the separating gel, increase the voltage to 120 V and continue electrophoresis until the bromophenol blue indicator reaches the bottom of the glass plate to stop electrophoresis. (D) Staining: After electrophoresis, disassemble the gel plate, cut off the excess part of the gel, put the main part into the Coomassie brilliant blue staining solution, and stain it on a shaker for 2 h. (E) Decolorization: Discard the staining solution, add an appropriate amount of protein decolorizing solution, decolorize it on a shaker, and change the decolorizing solution every 30 min until the blue color is completely removed. As Figure 2A shown, compared with the control group, the p-VP3 band (between 35 kDa and 40 kDa) in the experimental group is more obvious.

[0062] 4) Mass spectrometry identification: Cut the VP3 band together with the p-VP3 (VP3 phosphorylation) band and send it to Nanjing Kangxuhe Biotechnology Co., Ltd. for mass spectrometry identification. The whole set of systems used for identification is the timsTOF Pro2 mass spectrometer (Bruker Daltonics) of the UltiMate 3000 system (Thermo Fisher Scientific, MA, USA) in tandem. The mass spectrometer operates in the DDAPASEF mode, and the mass spectrometry parameters are set as follows: Do 10 PASEF scans per cycle, with an accumulation time of 100 ms. The scanning range is from 100 to 1700 m / z, and the ion mobility (1 / K0) range is set to 0.6 - 1.6. The scanning charge number is set to 0 - 5, the target value is set to 10,000, and the dynamic exclusion time is 0.4 min. When m / z < 700, the isolation window width is set to 2 Th, and when m / z > 700, the isolation window width is set to 3 Th. The results Figure 2B and Figure 2C shown, the mass spectrometry results show that the S130A site and the S163A site have obvious mass spectrometry effects, and the information of the VP3 phosphorylation modification sites can be basically determined as the S130A site and the S163A site.

[0063] <Construction of VP3 phosphorylation site mutant plasmid> 1) Primer design: In order to further verify the accuracy of mass spectrometry for measuring VP3 phosphorylation modification sites, the third mutation primers were designed using the Netphospho3.1 online tool based on the first prediction results of T92 (0.983), S105 (0.997), S130 (0.995), Y150 (0.973), S163 (0.992), and S253 (0.997). The primer sequences are shown in Table 2 below: Table 2 Serial number Primer name Primer sequence SEQ ID NO:9 S130A-F <![CDATA[GCACCGAGGGCCA GCC CCGGCCAGCTAAAG]]> SEQ ID NO:10 S130A-R <![CDATA[CTTTAGCTGGCCGGG GGC TGGCCCTCGGTGC]]> SEQ ID NO:11 S130E-F <![CDATA[GCACCGAGGGCCA GAG CCGGCCAGCTAAAG]]> SEQ ID NO:12 S130E-R <![CDATA[CTTTAGCTGGCCGGG CTC TGGCCCTCGGTGC]]> SEQ ID NO:13 S163A-F <![CDATA[AGAAGAGCCGGTTGGCA GCA GAAGAACAAATC]]> SEQ ID NO:14 S163A-R <![CDATA[GATTTGTTCTT CTG CTGCCAACCGGCTCTTCT]]> SEQ ID NO:15 S163E-F <![CDATA[AGAAGAGCCGGTTGGCA GAG GAAGAACAAATC]]> SEQ ID NO:16 S163E-R <![CDATA[GATTTGTTCTT CCT CTGCCAACCGGCTCTTCT]]> SEQ ID NO:17 T92A-F <![CDATA[GGAGGCTCGGGGCCCC GCA CCAGAGGAAGC]]> SEQ ID NO:18 T92A-R <![CDATA[GCTTCCTCTGG TGC GGGGCCCCGAGCCTCC]]> SEQ ID NO:19 T92E-F <![CDATA[GGAGGCTCGGGGCCCC GAA CCAGAGGAAGC]]> SEQ ID NO:20 T92E-R <![CDATA[GCTTCCTCTGG TTC GGGGCCCCGAGCCTCC]]> SEQ ID NO:21 S105A-F <![CDATA[GACACACGGATC GCA AAGAAGATGGAGACC]]> SEQ ID NO:22 S105A-R <![CDATA[GGTCTCCATCTTCTT TGC GATCCGTGTGTC]]> SEQ ID NO:23 S105E-F <![CDATA[GACACACGGATC GAA AAGAAGATGGAGACC]]> SEQ ID NO:24 S105E-R <![CDATA[GGTCTCCATCTTCTT TTC GATCCGTGTGTC]]> SEQ ID NO:25 Y150A-F <![CDATA[GACCCAAACGAGGAC GCT CTAGACTACGTG]]> SEQ ID NO:26 Y150A-R <![CDATA[CACGTAGTCTAG AGC GTCCTCGTTTGGGTC]]> SEQ ID NO:27 Y150E-F <![CDATA[GACCCAAACGAGGAC GAA CTAGACTACGTG]]> SEQ ID NO:28 Y150E-R <![CDATA[CACGTAGTCTAG TTC GTCCTCGTTTGGGTC]]> SEQ ID NO:29 S253A-F <![CDATA[GATCAGGACCGTC GCT GATGAGGACCTTGAG]]> SEQ ID NO:30 S253A-R <![CDATA[CTCAAGGTCCTCATC AGC GACGGTCCTGATC]]> SEQ ID NO:31 S253E-F <![CDATA[GATCAGGACCGTC GAA GATGAGGACCTTGAG]]> SEQ ID NO:32 S253E-R <![CDATA[CTCAAGGTCCTCATC TTC GACGGTCCTGATC]]> 2) Reverse PCR: Using the Myc-VP3 plasmid as a template, the sequence of the Myc-VP3 plasmid is shown in SEQ ID NO:33: ATGGCATCAGAGTTCAAAGAGACCCCCGAACTCGAGAGTGCCGTCAGAGCAATGGAAGCAGCAGCCAACGTGGACCCACTATTCCAATCTGCACTCAGTGTGTTCATGTGGCTGGAAGAGAATGGGATTGTGACTGACATGGCCAACTTCGCACTCAGCGACCCGAACGCCCATCGGATGCGAAATTTTCTTGCAAACGCACCACAAGCAGGCAGCAAGTCGCAAAGGGCCAAGTACGGGACAGCAGGCTACGGAGTGGAGGCTCGGGGCCCCACACCAGAGGAAGCACAGAGGGAAAAAGACACACGGATCTCAAAGAAGATGGAGACCATGGGCATCTACTTTGCAACACCAGAATGGGTAGCACTCAATGGGCACCGAGGGCCAAGCCCCGGCCAGCTAAAGTACTGGCAGAACACACGAGAAATACCGGACCCAAACGAGGACTATCTAGACTACGTGCATGCAGAGAAGAGCCGGTTGGCATCAGAAGAACAAATCCTAAGGGCAGCTACGTCGATCTACGGGGCTCCAGGACAGGCAGAGCCACCCCAAGCTTTCATAGACGAAGTTGCCAAAGTCTATGAAATCAACCATGGACGTGGCCCAAACCAAGAACAGATGAAAGATCTGCTCTTGACTGCGATGGAGATGAAGCATCGCAATCCCAGGCGGGCTCTACCAAAGCCCAAGCCAAAACCCAATGCTCCAACACAGAGACCCCCTGGTCGGCTGGGCCGCTGGATCAGGACCGTCTCTGATGAGGACCTTGAGTAA。Reverse PCR is performed with the third mutation primer to obtain an A amplification product (mutant plasmid), wherein the third mutation primer includes a third forward primer and a third reverse primer, the sequence of the third forward primer is at least one of SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, and SEQ ID NO:31, and the sequence of the third reverse primer is at least one of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, and SEQ ID NO:32.

[0064] The amplification system is: 2×Phanta Max Master Mix 10 μL, Template DNA 100 ng 1 μL each of forward and reverse primers, The system was made up to 20 μL with ddH2O.

[0065] The reaction conditions were as follows: pre-denaturation at 95°C for 5 min, followed by 20 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 2 min, with a total extension at 72°C for 10 min. After the reaction, 1% agarose gel electrophoresis was used to verify successful amplification.

[0066] 3) Enzyme digestion: The PCR product obtained in the previous step is digested with DpnⅠ enzyme to remove the template plasmid and obtain DpnⅠ enzyme digestion product. The reaction system is: 10*Buffer 1 μL DpnⅠ 0.5 μL PCR product 8.5 μL Reaction conditions: 37°C water bath for 1h; 4) Transformation: Take out the DH5α competent cells from the -80℃ refrigerator and thaw them on ice. Transform the digestion product in the previous step into the DH5α competent cells and mix them thoroughly. Place the mixture on ice for 10 min. Heat shock the mixture in a 42℃ water bath for 90 s. Take out the mixture and quickly place it on ice for 5 min. Add 1 mL of LB medium without antibiotics to the mixture and place it on a shaking shaker at 37℃ for 45 min. Centrifuge the mixture in the centrifuge tube at low speed (3000 r / min) for 10 min. Centrifuge all the DH5α competent cells to the bottom of the tube. Discard the upper LB medium and keep about 100 μL. Use a pipette to resuspend the DH5α competent cells at the bottom of the tube and add them to the prepared ampicillin solid LB medium plate. Let it stand for 10 min. Place the plate upside down in a 37℃ incubator overnight. Pick a single colony for shaking culture and send it to General Biotech Co., Ltd. for first-generation sequencing. Sequencing uses CMV-F primer forward detection.

[0067] 5) Plasmid extraction: Sequence comparison of the sequencing results returned by the sequencing company. The correct single clone is the one that successfully mutated at the mutation site. Select the cloned bacterial solution with correct sequencing and perform plasmid extraction. The specific steps are as follows: (A) Pipette 100 μL of the original bacteria into a 100 mL sterile conical flask, add 20 mL of ampicillin liquid LB medium to the conical flask for overnight culture. (B) Take 10 mL of bacterial solution into a 15 mL centrifuge tube, centrifuge at 1000 r / min at room temperature for 5 min, centrifuge all the bacterial solution to the bottom of the tube, and discard the supernatant waste liquid. (C) Add 500 μL of Buffer P1 containing RNaseA to the centrifuge tube, fully resuspend the left and right bacterial cells, and let it stand for 5 minutes. (D) Add 500 μL of Buffer P2 to the centrifuge tube, gently invert the centrifuge tube 5-8 times until the liquid becomes clear and transparent, and let it stand at room temperature for 5 minutes. (E) Add 700 μL Buffer P3 to the centrifuge tube, gently invert the centrifuge tube up and down 5-8 times until white flocs appear, let it stand at room temperature for 5 min, and then centrifuge it at 12000 r / min at room temperature for 10 min until all the flocs are precipitated to the bottom of the tube. (F) Take the supernatant in (E) to the adsorption column with the bottom tube, centrifuge it at 12000 r / min at room temperature for 30 s, repeat 2-3 times until all the supernatant passes through the adsorption column. (G) Add 500 μL Washbuffer to the adsorption column, centrifuge it at 12000 r / min at room temperature for 30 s, discard the waste liquid, and repeat the wash once. (H) Centrifuge the adsorption column at 12000 r / min at room temperature for 1 min, open the lid and let it stand at room temperature for 1 min. (I) Put the adsorption column into a new 1.5 mL sterile centrifuge tube, add 100 μL EB (Elution Buffer), and let it stand at room temperature for 1 min. (J) The adsorption column was centrifuged at 12000 r / min for 1 min at room temperature to elute the plasmid on the adsorption column. After measuring the concentration, it was stored at -20°C for later use. The mutant plasmids Myc-VP3-T92A, Myc-VP3-T92E, Myc-VP3-S105A, Myc-VP3-S105E, Myc-VP3-T30A, Myc-VP3-130E, Myc-VP3-Y150A, Myc-VP3-Y150E, Myc-VP3-S253A, Myc-VP3-S253E, Myc-VP3-S163A, Myc-VP3-S163E and Myc-VP3-SSAA were obtained.

[0068] The sequence of Myc-VP3-S130A is shown in SEQ ID NO: 1: ATGGCATCAGAGTTCAAAGAGACCCCCGAACTCGAGAGTGCCGTCAGAGCAATGGAAGCAGCAGCCAACGTGGACCCACTATTCCAATCTGCACTCAGTGTGTTCATGTGGCTGGAAGAGAATGGGATTGTGACTGACATGGCCAACTTCGCACTCAGCGACCCGAACGCCCATCGGATGCGAAATTTTCTTGCAAACGCACCACAAGCAGGCAGCAAGTCGCAAAGGGCCAAGTACGGGACAGCAGGCTACGGAGTGGAGGCTCGGGGCCCCACACCAGAGGAAGCACAGAGGGAAAAAGACACACGGATCTCAAAGAAGATGGAGACCATGGGCATCTACTTTGCAACACCAGAATGGGTAGCACTCAATGGGCACCGAGGGCCA GCC CCCGGCCAGCTAAAGTACTGGCAGAACACACGAGAAATACCGGACCCAAACGAGGACTATCTAGACTACGTGCATGCAGAGAAGAGCCGGTTGGCATCAGAAGAACAAATCCTAAGGGCAGCTACGTCGATCTACGGGGCTCCAGGACAGGCAGAGCCACCCCAAGCTTTCATAGACGAAGTTGCCAAAGTCTATGAAATCAACCATGGACGTGGCCCAAACCAAGAACAGATGAAAGATCTGCTCTTGACTGCGATGGAGATGAAGCATCGCAATCCCAGGCGGGCTCTACCAAAGCCCAAGCCAAAACCCAATGCTCCAACACAGAGACCCCCTGGTCGGCTGGGCCGCTGGATCAGGACCGTCTCTGATGAGGACCTTGAGTAA。

[0069] The sequence of Myc-VP3-S163A is shown in SEQ ID NO:2: ATGGCATCAGAGTTCAAAGAGACCCCCGAACTCGAGAGTGCCGTCAGAGCAATGGAAGCAGCAGCCAACGTGGACCCACTATTCCAATCTGCACTCAGTGTGTTCATGTGGCTGGAAGAGAATGGGATTGTGACTGACATGGCCAACTTCGCACTCAGCGACCCGAACGCCCATCGGATGCGAAATTTTCTTGCAAACGCACCACAAGCAGGCAGCAAGTCGCAAAGGGCCAAGTACGGGACAGCAGGCTACGGAGTGGAGGCTCGGGGCCCCACACCAGAGGAAGCACAGAGGGAAAAAGACACACGGATCTCAAAGAAGATGGAGACCATGGGCATCTACTTTGCAACACCAGAATGGGTAGCACTCAATGGGCACCGAGGGCCAAGCCCCGGCCAGCTAAAGTACTGGCAGAACACACGAGAAATACCGGACCCAAACGAGGACTATCTAGACTACGTGCATGCAGAGAAGAGCCGGTTGGC AGC AGAAGAACAAATCCTAAGGGCAGCTACGTCGATCTACGGGGCTCCAGGACAGGCAGAGCCACCCCAAGCTTTCATAGACGAAGTTGCCAAAGTCTATGAAATCAACCATGGACGTGGCCCAAACCAAGAACAGATGAAAGATCTGCTCTTGACTGCGATGGAGATGAAGCATCGCAATCCCAGGCGGGCTCTACCAAAGCCCAAGCCAAAACCCAATGCTCCAACACAGAGACCCCCTGGTCGGCTGGGCCGCTGGATCAGGACCGTCTCTGATGAGGACCTTGAGTAA。

[0070] The sequence of Myc-VP3-SSAA is shown in SEQ ID NO:3; ATGGCATCAGAGTTCAAAGAGACCCCCGAACTCGAGAGTGCCGTCAGAGCAATGGAAGCAGCAGCCAACGTGGACCCACTATTCCAATCTGCACTCAGTGTGTTCATGTGGCTGGAAGAGAATGGGATTGTGACTGACATGGCCAACTTCGCACTCAGCGACCCGAACGCCCATCGGATGCGAAATTTTCTTGCAAACGCACCACAAGCAGGCAGCAAGTCGCAAAGGGCCAAGTACGGGACAGCAGGCTACGGAGTGGAGGCTCGGGGCCCCACACCAGAGGAAGCACAGAGGGAAAAAGACACACGGATCTCAAAGAAGATGGAGACCATGGGCATCTACTTTGCAACACCAGAATGGGTAGCACTCAATGGGCACCGAGGGCCA GCC CCCGGCCAGCTAAAGTACTGGCAGAACACACGAGAAATACCGGACCCAAACGAGGACTATCTAGACTACGTGCATGCAGAGAAGAGCCGGTTGGC AGC AGAAGAACAAATCCTAAGGGCAGCTACGTCGATCTACGGGGCTCCAGGACAGGCAGAGCCACCCCAAGCTTTCATAGACGAAGTTGCCAAAGTCTATGAAATCAACCATGGACGTGGCCCAAACCAAGAACAGATGAAAGATCTGCTCTTGACTGCGATGGAGATGAAGCATCGCAATCCCAGGCGGGCTCTACCAAAGCCCAAGCCAAAACCCAATGCTCCAACACAGAGACCCCCTGGTCGGCTGGGCCGCTGGATCAGGACCGTCTCTGATGAGGACCTTGAGTAA。

[0071] <Verification of the Phosphorylation Modification Site of VP3 by Immunoblotting (Western Blot)> 1) Transfection: Use Exfect transfection reagent to transfect the mutant plasmid (obtained in the above plasmid extraction) and Myc-VP3 plasmid into HEK-293T cells respectively. Specific operation steps are as follows: (A) HEK-293T cells are cultured in a 12-well cell culture plate. When the density grows to about 80%, transfection can be performed. (B) Prepare two sterile EP tubes for each group, add 50 μL serum-free DMEM medium, add 4 μL Exfect transfection reagent to tube A and mix gently, add 2μg of the corresponding mutant plasmid to tube B and mix gently, and let it stand for 5 min. (C) Add the mixed solution in tube A to tube B and mix gently, and let it stand for 15 min. (D) Add the mixed solution dropwise into the 12-well plate, shake gently, and change to DMEM medium containing 2% serum after 6 hours and continue to culture for 24 hours.

[0072] 2) Preparation of protein samples: Collect the culture medium and cells into EP tubes, collect the cells by low-speed centrifugation, discard the supernatant, add 100 μL NP-40 lysis buffer, lyse at 4 degrees for 20 min, centrifuge at high speed for 10 min, discard the precipitate and retain the supernatant, add 25 μL 5× protein loading buffer, mix thoroughly and boil in a 100°C metal bath for 10 min, and temporarily store the prepared protein sample in a 4°C refrigerator for subsequent Western blot detection to obtain the mutant VP3 protein. Similarly, prepare the control group WT-VP3 protein sample.

[0073] 3) Western blot detection: (A) Sample loading: Add 2 μL of protein prestained Marker to the first well, add the WT-VP3 protein sample to the second well, and then add the protein samples of different mutants (T92A, T92E, S105A, S105E, S130A, S130E, S163A, S163E, Y150A, Y150E, S253A, S253E) VP3 in sequence. (B) Electrophoresis: The electrophoresis equipment uses the Bio-Rad mini vertical electrophoresis system. First, perform electrophoresis at a low voltage (80 V) for about 30 min. After the bromophenol blue enters the separation gel, increase the voltage to 120 V and continue electrophoresis until the bromophenol blue indicator reaches the bottom of the glass plate to stop electrophoresis. (C) Blotting: After electrophoresis, cut off and remove the excess part of the gel, and soak the remaining gel in the transfer buffer. Prepare two thick transfer filter papers and a nitrocellulose membrane (NC membrane) that is close to the size of the membrane. Soak the NC membrane and the transfer filter papers in the transfer buffer for several minutes to fully moisten them. Stack the filter paper - NC membrane - gel - filter paper from bottom to top, place them neatly on the semi-dry blotting apparatus, gently press to remove the internal air, cover the lid of the blotting apparatus, limit the voltage to 25 V, keep the current constant at 0.2 mA, and transfer for 35 min. After the transfer is completed, take out the NC membrane. (D) Blocking: Soak the transferred NC membrane in the PBS buffer containing 5% skim milk, let it stand at room temperature for 20 min, and then wash it 3 - 5 times with the PBS buffer, 5 - 10 min each time. (E) Key step in primary antibody incubation: Detect the target protein by the binding of the mouse monoclonal antibody against Myc protein and β-actin antibody in the primary antibody reagent to the specific antigen: Dilute the mouse monoclonal antibody against Myc protein according to the instructions at a ratio of 1:3000 with the primary antibody diluent, and incubate the transferred NC membrane in it, shake and incubate overnight on a shaker at 4°C. (F) Secondary antibody incubation: The next day, wash the NC membrane 3 - 5 times with PBST by shaking, 5 min each time. Dilute the goat anti-rabbit secondary antibody at a ratio of 1:10000, incubate at room temperature by shaking for 1 h, and then wash it 3 - 5 times with PBST by shaking, 5 min each time. (G) Protein imaging and preservation: As Figure 3 shown, it can be seen that the phosphorylation levels of S130A and S163A are significantly decreased or absent compared with WT, while mutations at other sites have little effect, that is, other sites can be excluded, and two sites, S130 and S163, are locked as the VP3 phosphorylation sites; as Figure 4 shown, it can be seen that the phosphorylation levels of S130A, S163A and the SSAA double mutant samples are significantly decreased or absent compared with WT.

[0074] <Rescue and Identification of Recombinant Viruses with VP3 Phosphorylation Deletion> Construct the IBDV rescue plasmid with phosphorylation site deletion: 1) Construct T7-A VP3S130A and T7-A VP3S163Aand T7-A VP3SSAA Plasmid (i.e., corresponding mutations were made at the corresponding sites of the part encoding VP3 in the T7-A plasmid), and the plasmid was extracted. Among them, the sequence of T7-A VP3S130A is shown in SEQ ID NO:4: TGCATCAGAGTTCAAAGAGACCCCCGAACTCGAGAGTGCCGTCAGAGCAATGGAAGCAGCAGCCAACGTGGACCCACTATTCCAATCTGCACTCAGTGTGTTCATGTGGCTGGAAGAGAATGGGATTGTGACTGACATGGCCAACTTCGCACTCAGCGACCCGAACGCCCATCGGATGCGAAATTTTCTTGCAAACGCACCACAAGCAGGCAGCAAGTCGCAAAGGGCCAAGTACGGGACAGCAGGCTACGGAGTGGAGGCTCGGGGCCCCACACCAGAGGAAGCACAGAGGGAAAAAGACACACGGATCTCAAAGAAGATGGAGACCATGGGCATCTACTTTGCAACACCAGAATGGGTAGCACTCAATGGGCACCGAGGGCCA GCC CCCGGCCAGCTAAAGTACTGGCAGAACACACGAGAAATACCGGACCCAAACGAGGACTATCTAGACTACGTGCATGCAGAGAAGAGCCGGTTGGCA TCA GAAGAACAAATCCTAAGGGCAGCTACGTCGATCTACGGGGCTCCAGGACAGGCAGAGCCACCCCAAGCTTTCATAGACGAAGTTGCCAAAGTCTATGAAATCAACCATGGACGTGGCCCAAACCAAGAACAGATGAAAGATCTGCTCTTGACTGCGATGGAGATGAAGCATCGCAATCCCAGGCGGGCTCTACCAAAGCCCAAGCCAAAACCCAATGCTCCAACACAGAGACCCCCTGGTCGGCTGGGCCGCTGGATCAGGACCGTCTCTGATGAGGACCTTGAGTGA。

[0075] T7-A VP3S163AThe sequence is shown in SEQ ID NO:5: TGCATCAGAGTTCAAAGAGACCCCCGAACTCGAGAGTGCCGTCAGAGCAATGGAAGCAGCAGCCAACGTGGACCCACTATTCCAATCTGCACTCAGTGTGTTCATGTGGCTGGAAGAGAATGGGATTGTGACTGACATGGCCAACTTCGCACTCAGCGACCCGAACGCCCATCGGATGCGAAATTTTCTTGCAAACGCACCACAAGCAGGCAGCAAGTCGCAAAGGGCCAAGTACGGGACAGCAGGCTACGGAGTGGAGGCTCGGGGCCCCACACCAGAGGAAGCACAGAGGGAAAAAGACACACGGATCTCAAAGAAGATGGAGACCATGGGCATCTACTTTGCAACACCAGAATGGGTAGCACTCAATGGGCACCGAGGGCCA AGC CCCGGCCAGCTAAAGTACTGGCAGAACACACGAGAAATACCGGACCCAAACGAGGACTATCTAGACTACGTGCATGCAGAGAAGAGCCGGTTGGCA GCA GAAGAACAAATCCTAAGGGCAGCTACGTCGATCTACGGGGCTCCAGGACAGGCAGAGCCACCCCAAGCTTTCATAGACGAAGTTGCCAAAGTCTATGAAATCAACCATGGACGTGGCCCAAACCAAGAACAGATGAAAGATCTGCTCTTGACTGCGATGGAGATGAAGCATCGCAATCCCAGGCGGGCTCTACCAAAGCCCAAGCCAAAACCCAATGCTCCAACACAGAGACCCCCTGGTCGGCTGGGCCGCTGGATCAGGACCGTCTCTGATGAGGACCTTGAGTGA。

[0076] T7-A VP3SSAAThe sequence is shown in SEQ ID NO:6: TGCATCAGAGTTCAAAGAGACCCCCGAACTCGAGAGTGCCGTCAGAGCAATGGAAGCAGCAGCCAACGTGGACCCACTATTCCAATCTGCACTCAGTGTGTTCATGTGGCTGGAAGAGAATGGGATTGTGACTGACATGGCCAACTTCGCACTCAGCGACCCGAACGCCCATCGGATGCGAAATTTTCTTGCAAACGCACCACAAGCAGGCAGCAAGTCGCAAAGGGCCAAGTACGGGACAGCAGGCTACGGAGTGGAGGCTCGGGGCCCCACACCAGAGGAAGCACAGAGGGAAAAAGACACACGGATCTCAAAGAAGATGGAGACCATGGGCATCTACTTTGCAACACCAGAATGGGTAGCACTCAATGGGCACCGAGGGCCA GCC CCCGGCCAGCTAAAGTACTGGCAGAACACACGAGAAATACCGGACCCAAACGAGGACTATCTAGACTACGTGCATGCAGAGAAGAGCCGGTTGGCA GCA GAAGAACAAATCCTAAGGGCAGCTACGTCGATCTACGGGGCTCCAGGACAGGCAGAGCCACCCCAAGCTTTCATAGACGAAGTTGCCAAAGTCTATGAAATCAACCATGGACGTGGCCCAAACCAAGAACAGATGAAAGATCTGCTCTTGACTGCGATGGAGATGAAGCATCGCAATCCCAGGCGGGCTCTACCAAAGCCCAAGCCAAAACCCAATGCTCCAACACAGAGACCCCCTGGTCGGCTGGGCCGCTGGATCAGGACCGTCTCTGATGAGGACCTTGAGTGA。

[0077] 2) Reverse PCR: Using T7-A plasmid as a template, the sequence of T7-A plasmid is shown in SEQ ID NO:34, and performing second reverse amplification with mutation primers to obtain a second mutant plasmid, wherein the second mutation primer includes a second forward primer and a second reverse primer, the sequence of the second forward primer is at least one of SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, and SEQ ID NO:15, and the sequence of the second reverse primer is at least one of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:16.

[0078] The amplification system is: 2×Phanta Max Master Mix 10 μL, Template DNA 100 ng 1 μL each of forward and reverse primers The system was made up to 20 μL with ddH2O.

[0079] The reaction conditions were as follows: pre-denaturation at 95°C for 5 min, followed by 20 cycles of denaturation at 95°C for 30 s, annealing at 56°C for 30 s, and extension at 72°C for 2 min, with a total extension at 72°C for 10 min. After the reaction, 1% agarose gel electrophoresis was used to verify successful amplification.

[0080] 3) Enzyme digestion: The PCR product obtained in the previous step is digested with DpnⅠ enzyme to remove the template plasmid and obtain DpnⅠ enzyme digestion product. The reaction system is: 10*Buffer 1 μL DpnⅠ 0.5 μL PCR product 8.5 μL Reaction conditions: 37°C water bath for 1h; 4) Transformation: Take out the DH5α competent cells from the -80℃ refrigerator and thaw them on ice. Transform the DpnⅠ enzyme digestion product in the previous step into the DH5α competent cells and mix thoroughly. Place the mixture on ice for 10 min. Heat shock the mixture in a 42℃ water bath for 90 s. Take out the mixture and quickly place it on ice for 5 min. Add 1 mL of anti-antibody LB medium to the mixture and place it on a 37℃ shaking shaker for 45 min. Centrifuge the mixture in the centrifuge tube at low speed (3000r / min) for 10 min. Centrifuge all the competent cells to the bottom of the tube. Discard the upper LB medium and keep about 100 μL. Use a pipette to resuspend the competent cells at the bottom of the tube and add them to the prepared ampicillin solid LB medium plate. Let it stand for 10 min. Place the plate upside down in a 37℃ incubator overnight. Pick a single colony for shaking culture and send it to General Biotech Co., Ltd. for first-generation sequencing. Sequencing uses CMV-F primer forward detection.

[0081] 5) Plasmid extraction: Sequence comparison of the sequencing results returned by the sequencing company. The correct single clone is the one that successfully mutated at the mutation site. Select the cloned bacterial solution with correct sequencing and perform plasmid extraction. The specific steps are as follows: (A) Pipette 100 μL of the original bacteria into a 100 mL sterile conical flask, add 20 mL of ampicillin liquid LB medium to the conical flask for overnight culture. (B) Take 10 mL of bacterial solution into a 15 mL centrifuge tube, centrifuge at 1000 r / min at room temperature for 5 min, centrifuge all the bacterial solution to the bottom of the tube, and discard the supernatant waste liquid. (C) Add 500 μL of Buffer P1 containing RNaseA to the centrifuge tube, fully resuspend the left and right bacterial cells, and let it stand for 5 minutes; (D) Add 500 μL of Buffer P2 to the centrifuge tube, gently turn the centrifuge tube upside down 5-8 times until the liquid becomes clear and transparent, and let it stand at room temperature for 5 minutes. (E) Add 700 μL Buffer P3 to the centrifuge tube, gently invert the centrifuge tube up and down 5-8 times until white flocs appear, let it stand at room temperature for 5 min, and then centrifuge it at 12000 r / min at room temperature for 10 min until all the flocs are precipitated to the bottom of the tube. (F) Take the supernatant in (E) to the adsorption column with the bottom tube, centrifuge it at 12000 r / min at room temperature for 30 s, repeat 2-3 times until all the supernatant passes through the adsorption column. (G) Add 500 μL Washbuffer to the adsorption column, centrifuge it at 12000 r / min at room temperature for 30 s, discard the waste liquid, and repeat the wash once. (H) Centrifuge the adsorption column at 12000 r / min at room temperature for 1 min, open the lid and let it stand at room temperature for 1 min. (I) Put the adsorption column into a new 1.5 mL sterile centrifuge tube, add 100 μL EB (Elution Buffer), and let it stand at room temperature for 1 min. (J) The adsorption column was centrifuged at room temperature at 12000 r / min for 1 min to elute the plasmid on the adsorption column. After measuring the concentration, it was stored at -20°C for future use to obtain T7-A. VP3S130A 、T7-A VP3S163A and T7-A VP3SSAA Plasmid, T7-A VP3S130A The sequence of T7-A is shown in SEQ ID NO:4. VP3S130A The sequence of T7-A is shown in SEQ ID NO: 5. VP3SSAA The sequence is shown in SEQ ID NO:6.

[0082] 6) Transfection (with IBDV VP3S130A For example): Use Exfect transfection reagent to transfect T7-A VP3S130AThe two plasmids, T7-A and T7-B, were transfected into BSRT7 cells. The specific operation steps are as follows: (A) BSRT7 cells were cultured in a 12-well cell culture plate. When the cell density reached about 80%, transfection could be carried out. (B) Prepare two sterile EP tubes and add 50 μL of serum-free DMEM medium to each. Add 4 μL of Exfect transfection reagent to tube A and mix gently. Add 1 μg of each of the T7-A VP3S130A and T7-B plasmids to tube B and mix gently. Let it stand for 5 min. (C) Add the mixture in tube A to tube B and mix gently. Let it stand for 15 min. (D) Drop the mixed solution into the 12-well plate respectively, shake gently. After 6 h, change to DMEM medium containing 2% serum and continue culturing.

[0083] 7) Subtransfer and blind passage: After 72 h, collect the medium and cells into an EP tube, freeze-thaw once and then centrifuge. Transfer the supernatant to DF-1 cells. After 2 h, discard the supernatant and change to MEM medium containing 2% serum. Repeat the above steps after 72 h and transfer to DF-1 cells again. When characteristic lesions are observed, the rescue is successful.

[0084] Example 2 Effect of VP3 phosphorylation modification-deficient recombinant virus on IBDV replication <Virus titer determination> 1) Virus inoculation: DF-1 cells were cultured in a 96-well cell culture plate. After being confluent, virus inoculation could be carried out. Dilute the virus solution in 2% MEM medium at ratios of 10-1, 10-2, 10-3, 10-4, 10-5, 10-6, 10-7, 10-8, 10-9, 10-10, 10-11, 10-12. The diluted virus-containing medium was used to culture DF-1 cells. Each group had 6 replicates and 3 parallel experiments were done. 2) Calculate the virus titer: After 72 h, observe the cytopathic effect, count the number of diseased wells, and calculate the TCID50.

[0085] <Western blot detection> 1) Virus inoculation: Inoculate with the virus amount of 1 MOI. Determine the inoculation amount according to the TCID50 of different viruses. After the DF-1 cells in the 12-well plate are confluent, inoculate at different time points. The inoculation times are 6 h, 12 h, and 18 h respectively. 2) Sample collection: Collect the medium and cells into an EP tube, centrifuge at low speed to collect the cells, discard the supernatant, add 60 μL of NP-40 lysis buffer, lyse at 4 °C for 20 min, then centrifuge at high speed for 10 min, discard the precipitate and retain the supernatant. Add 15 μL of 5× protein loading buffer, mix well and boil in a 100 °C metal bath for 10 min. The prepared protein samples are temporarily stored in a 4 °C refrigerator for subsequent WB detection. 3) Western blot identification: As Figure 5A shown, Western blot detection was performed according to the above method. The color development results showed that the viral protein bands of SSAA IBDV were thicker than those of WT IBDV at different virus inoculation times, indicating that the dephosphorylation modification of VP3 promoted the replication of IBDV.

[0086] <TCID50 Detection> 1) Virus inoculation: Inoculate with a virus amount of 0.1 MOI. Determine the inoculation amount according to the TCID50 of different viruses. After the DF-1 cells in the 12-well plate are confluent, inoculate at different time points. The inoculation times are 12 h, 24 h, and 48 h respectively; 2) Sample collection: Collect the culture medium and cells into an EP tube, freeze-thaw once, centrifuge at 12000 r / min for 10 min, and transfer the supernatant to a new EP tube; 3) TCID50 determination: Culture DF-1 cells in a 96-well cell culture plate. After the cells are confluent, dilute the virus solution obtained in the previous step at ratios of 10-1, 10-2, 10-3, 10-4, 10-5, 10-6, 10-7, 10-8, 10-9, 10-10, 10-11, 10-12 in 2% MEM medium. The diluted medium containing the virus is used to culture DF-1 cells. Observe the cytopathic effect 72 h later, count the number of diseased wells, with 6 replicates in each group, perform 3 parallel experiments, finally summarize the data, and calculate the TCID50. As Figure 5B shown, the TCID50 values of SSAA IBDV were higher than those of WT IBDV at different time points, indicating that the dephosphorylation modification of VP3 promoted the replication of IBDV.

[0087] Example 3 Effect of Recombinant Virus with Deletion of VP3 Phosphorylation Modification on Its Ability to Bind dsRNA and Ability to Assist Polymerase Activity <Enhanced Ability of Recombinant Virus with Deletion of VP3 Phosphorylation Modification to Bind dsRNA> First, purify IBDV dsRNA. Transfect Myc-VP3 and Myc-VP3SSAA plasmids into 293T cells. After 36 h, co-incubate dsRNA with NP-40 lysis buffer, and perform IP detection of the VP3-dsRNA interaction with a dsRNA antibody. As Figure 6 shown, it can be seen that the amount of VP3SSAA binding dsRNA increased significantly.

[0088] <Enhanced Ability of Recombinant Virus with Deletion of VP3 Phosphorylation Modification to Assist Polymerase Activity> First, the VP3SSAA polymerase activity detection plasmid was constructed and co-transfected into 293T cells. After 72 h, protein samples were collected and the expression of VP1 / VP2 / VP3 proteins was detected by Western blot. Figure 7 As shown, it can be seen that the expression of viral protein in the VP3SSAA group was significantly increased.

[0089] In summary, the present invention discloses a method for constructing a virus lacking the phosphorylation sites of the infectious bursal disease virus VP3 protein, uses immunoprecipitation technology to separate and purify the IBDV VP3 protein, and uses mass spectrometry to identify the VP3 phosphorylation sites as serine at position 130 and serine at position 163. The codon at position 130 is mutated from AGC to GCC, and the corresponding serine is mutated to alanine. At the same time, the codon at position 163 is mutated from AGU to GCC, and the corresponding serine is mutated to alanine. The recombinant virus with mutations in the dual phosphorylation sites of the VP3 protein is rescued by a virus rescue system. The advantages of the present invention are: bioinformatics prediction combined with immunoprecipitation-mass spectrometry identification and experimental verification of the specific phosphorylation sites of IBDV VP3, and the mutation of the dual phosphorylation sites of VP3 leads to enhanced IBDV virus replication ability, enhanced dsRNA binding ability, and enhanced auxiliary polymerase activity ability, and can be used as an IBDV candidate vaccine strain.

[0090] The above description is only a preferred embodiment of the present application and is not intended to limit the present application. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present application should be included in the protection scope of the present application.

Claims

1. An infectious bursal disease virus VP3 phosphorylation-deficient virus, characterized in that: The invention comprises a mutant plasmid and a rescue vector carrying the mutant plasmid. The mutation points of the mutant plasmid are: the 130th serine of the VP3 protein is mutated to alanine or / and the 163rd serine is mutated to alanine.

2. The infectious bursal disease virus VP3 phosphorylation-deficient virus according to claim 1, characterized in that: The mutant plasmid includes a first mutant plasmid or a second mutant plasmid; The first mutant plasmid includes Myc-VP3-S130A, Myc-VP3-S163A and Myc-VP3-SSAA; the sequence of the Myc-VP3-S130A is shown in SEQ ID NO: 1, the sequence of the Myc-VP3-S163A is shown in SEQ ID NO: 2, and the sequence of the Myc-VP3-SSAA is shown in SEQ ID NO: 3; The second mutant plasmid includes T7-A VP3S130A 、T7-A VP3S163A and T7-A VP3SSAA ; T7-A VP3S130A The sequence of T7-A is shown in SEQ ID NO:

4. VP3S163A The sequence of T7-A is shown in SEQ ID NO:

5. VP3SSAA The sequence is shown in SEQ ID NO:

6.

3. An infectious bursal disease virus VP3 phosphorylation-deficient virus, characterized in that: The serine at position 130 of the VP3 protein is mutated to alanine and / or the serine at position 163 is mutated to alanine.

4. A method for constructing an infectious bursal disease virus VP3 phosphorylation-deficient virus according to claim 1 or 2, characterized in that: The steps include: Step S20, mutating the serine at position 130 of the VP3 protein to alanine and / or mutating the serine at position 163 to alanine to obtain a mutant plasmid; Step S30, transfecting the mutant plasmid into a rescue vector using a first transfection reagent to obtain the infectious bursal disease virus VP3 phosphorylation-deficient virus.

5. The method for constructing the infectious bursal disease virus VP3 phosphorylation-deficient virus according to claim 4, characterized in that: The step S20 also includes the following step of determining the VP3 phosphorylation modification site: The first prediction result was obtained by using the Netphospho3.1 online tool to predict the potential phosphorylation sites of VP3 protein on IBDV JX strain. The recombinant plasmid was constructed using the VP3 gene sequence of the A segment of IBDV JX strain as a template; The recombinant plasmid is subjected to a second prediction of potential phosphorylation sites of the VP3 protein using immunoprecipitation and mass spectrometry methods to obtain a second prediction result.

6. The method for constructing the infectious bursal disease virus VP3 phosphorylation-deficient virus according to claim 5, characterized in that: The method for constructing a recombinant plasmid comprises the following steps: Using the VP3 gene sequence of the A segment of the IBDV JX strain as a template, amplification was performed using the VP3-F and VP3-R primer pairs to obtain a B amplification product, wherein the VP3-F sequence includes the nucleotide sequence shown in SEQ ID NO:7, and the VP3-R sequence includes the nucleotide sequence shown in SEQ ID NO:8; Extracting a DNA solution from the amplified product B, and performing double enzyme digestion on the DNA solution and an empty vector using an enzyme digestion system to obtain a DNA fragment after enzyme digestion and a vector after enzyme digestion, respectively; Using T4 DNA ligase to connect the digested DNA fragment and the digested vector to obtain a ligation product; The ligation product is transformed into DH5α competent cells, cultured, and the plasmid is extracted to obtain the recombinant plasmid.

7. The method for constructing the infectious bursal disease virus VP3 phosphorylation-deficient virus according to claim 5, characterized in that: The step of verifying the second prediction result is also included: Designing a third mutation primer according to the first prediction result and constructing a third mutation plasmid using the Myc-VP3 plasmid as a template, wherein the sequence of the Myc-VP3 plasmid is shown in SEQ ID NO: 33; Transfecting the third mutant plasmid into HEK-293T cells using a second transfection agent; Based on the first prediction result, Western blot was performed on HEK-293T cells carrying the third mutant plasmid to verify the second prediction result.

8. The method for constructing the infectious bursal disease virus VP3 phosphorylation-deficient virus according to claim 7, characterized in that: The third mutation primer includes a third forward primer and a third reverse primer, the sequence of the third forward primer is at least one of SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21, SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, and SEQ ID NO:31, and the sequence of the third reverse primer is at least one of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, and SEQ ID NO:

32.

9. The method for constructing the infectious bursal disease virus VP3 phosphorylation-deficient virus according to claim 7 or 8, characterized in that: Step S20 also includes: Designing the mutant plasmid according to the second prediction result, wherein the mutant plasmid includes the first mutant plasmid or the second mutant plasmid; Wherein, the step of designing the mutant plasmid according to the second prediction result comprises: using T7-A plasmid as a template, the sequence of the T7-A plasmid is as shown in SEQ ID NO:34, and performing a second reverse amplification with a second mutation primer to obtain a second mutant plasmid, wherein the second mutation primer comprises a second forward primer and a second reverse primer, the sequence of the second forward primer is as shown in at least one of SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, and SEQ ID NO:15, and the sequence of the second reverse primer is as shown in at least one of SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, and SEQ ID NO:16; The second mutant plasmid and the T7-B plasmid are transfected into the rescue vector using a third transfection agent. The sequence of the T7-B plasmid is shown in SEQ ID NO:

35.

10. Use of an infectious bursal disease virus VP3 phosphorylation-deficient virus obtained according to any one of claims 1 to 3 or the method for constructing an infectious bursal disease virus VP3 phosphorylation-deficient virus according to any one of claims 4 to 9 in the preparation of vaccines, drugs and diagnostic reagents.

Images