Application of phyllostachys pubescens PheXTH3 protein and coding gene thereof in regulation and control of plant stem cell wall thickness under shading condition

Abstract

The invention relates to the technical field of plant molecular biology, in particular to application of phyllostachys heterocycla PheXTH3 protein and a coding gene thereof to regulation and control of plant stem cell wall thickness under a shading condition. A PheXTH3 gene expression vector is transferred into wild type arabidopsis thaliana through an agrobacterium-mediated method, and the result shows that the thickness of inter-bundle fiber cell walls of an arabidopsis thaliana plant over-expressing the PheXTH3 gene under a low R / FR ratio is reduced, which indicates that the gene can respond to shading conditions to regulate and control the change of the cell walls. Therefore, the phyllostachys pubescens PheXTH3 protein and the coding gene thereof can be used as a potential molecular breeding tool, are used for improving the property of plant stalks, provide a new view angle for cultivating bamboo wall materials with different thicknesses, and have a good application prospect.

Description

Technical Field

[0001] The invention relates to the technical field of plant molecular biology, and in particular to application of a bamboo PheXTH3 protein and a coding gene thereof in regulating the thickness of plant stem cell walls under shading conditions. Background Art

[0002] Plants cannot migrate long distances like animals. In the face of continuous environmental changes and survival challenges, they must have keen perception and make appropriate responses to protect themselves. Under natural conditions, plants of the same height are highly competitive for light. They perceive the increase in far-red light to determine the presence of competitors, and thus respond at a low red-to-far-red ratio (R / FR). This survival strategy triggers changes in plant morphology, such as stem elongation, increased petiole length, reduced cotyledon size, and slower cell wall thickening. This adaptive response is collectively referred to as the shade avoidance response (SAR).

[0003] At present, some studies have explored the problem of light signal pathways and cell wall regulation mechanisms. For example, some studies have found that the PhyB-PIF4-MYC2 / MYC4 module regulates the thickening of the cell wall or inhibits the thickening of the cell wall in red light signals, while the NST1-MYC2 / 4 module can regulate the thickening of the secondary wall in blue light. The bamboo forest is tall and has a dense canopy. The bamboo shoots are often in a shaded environment during the rapid growth period. In this case, how the bamboo shoot cell wall adapts to the shaded environment (low R / FR ratio) is still unknown.

[0004] Therefore, discovering bamboo genes that can respond to shade conditions (low R / FR) and regulate cell wall changes has become a technical challenge that needs to be urgently solved in this field. Summary of the invention

[0005] In order to solve the above technical problems, the present invention first provides a bamboo PheXTH3 protein that can respond to shading conditions (low R / FR ratio) and regulate cell wall changes, and its amino acid sequence is shown in SEQ ID NO.1.

[0006] The gene encoding the PheXTH3 protein in bamboo belongs to the XYLOGLUCAN ENDOTRANSGLUCOSYLASE / HYDROLASE (XTH) gene family. Not all genes in this gene family can respond to shade conditions (low R / FR ratio). After a large number of screening and verification, the present invention found that PheXTH3 Genes that regulate cell wall changes in response to shade conditions (low R / FR ratio).

[0007] Furthermore, the present invention provides a nucleic acid encoding the bamboo PheXTH3 protein.

[0008] In some embodiments, the nucleotide sequence of the nucleic acid is shown as SEQ ID NO.2.

[0009] Furthermore, the present invention provides a biomaterial containing the bamboo PheXTH3 protein or the nucleic acid; the biomaterial is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria or non-renewable plant cells or tissues.

[0010] Furthermore, the present invention provides the use of the moso bamboo PheXTH3 protein, the nucleic acid, or the biological material in regulating the thickness of plant stem cell walls under shading conditions.

[0011] In some embodiments, the shading condition is a ratio of red light to far-red light of 0.4 or less.

[0012] Preferably, the shading condition is that the ratio of red light to far-red light is less than 0.06.

[0013] The present invention finds that under shading conditions, the expression level or activity of the bamboo PheXTH3 protein or its encoding gene is reduced, thereby reducing the thickness of the plant stem cell wall.

[0014] Preferably, the plant stem cell walls include the cell walls of the posterior vessels and the cell walls of the interfascicular fibers.

[0015] Furthermore, the present invention provides the use of the bamboo PheXTH3 protein, the nucleic acid, or the biological material in preparing transgenic plants that respond to shading conditions.

[0016] Specifically, the present invention provides a method for preparing a transgenic plant that responds to shading conditions, comprising: using genetic engineering means to allow the plant to express or overexpress the bamboo PheXTH3 protein or its encoding gene.

[0017] In some embodiments, the plant comprises Arabidopsis thaliana or bamboo.

[0018] In some embodiments, the method of expressing or overexpressing comprises: (1) By introducing bamboo PheXTH3 Plasmids containing genes; (2) By increasing the number of plant chromosomes on bamboo PheXTH3 The copy number of the gene; (3) By changing the chromosomes of bamboo PheXTH3 The promoter sequence of the gene; (4) By combining a strong promoter with bamboo PheXTH3The genes are operably linked; (5) By introducing enhancers.

[0019] Preferably, the method for preparing the transgenic plant comprises: according to PheXTH3 Cloning primers were designed based on the CDS sequence of the gene. The cDNA obtained by reverse transcription of total RNA from bamboo stems was used as a template for PCR amplification. The cloned product was connected to the Pmd19-T cloning vector and transformed into Escherichia coli (DH5α) for sequencing. The overexpression vector pCAMBIA-2300-PheXTH3-eGFP was constructed with the sequence correctly sequenced, and transformed by Agrobacterium-mediated method to obtain transgenic plants.

[0020] Compared with the prior art, the present invention has the following beneficial effects: The present invention uses Agrobacterium-mediated method to PheXTH3 The gene expression vector was transferred into wild-type Arabidopsis, and it was found that the gene was overexpressed at a low R / FR ratio. PheXTH3 The thickness of the interfascicular fiber cell wall of Arabidopsis plants with the gene was reduced, indicating that the gene can respond to shading conditions and regulate cell wall changes. Therefore, the bamboo PheXTH3 protein and its encoding gene can be used as a potential molecular breeding tool to improve plant stem material properties, providing a new perspective for the cultivation of bamboo wall materials with different thicknesses, and has good application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Overexpression in Arabidopsis PheXTH3 The positive plant detection results of the gene; M: DNA Marker; WT: wild-type Arabidopsis (Col-0), negative control; P: pCAMBIA-2300-eGFP Plasmid, negative control; 3#: PheXTH3 ; H2O: negative control.

[0022] Figure 2 Overexpression in Arabidopsis PheXTH3 Photos of stem cell wall thickness after gene expression; WT is wild-type Arabidopsis (Col-0), PheXTH3 is overexpressed PheXTH3 Plant.

[0023] Figure 3 Overexpression in Arabidopsis PheXTH3 Results of cell wall thickness detection of stems after gene expression; different lowercase letters indicate statistical differences, WT is wild-type Arabidopsis (Col-0), OE-PheXTH3 is overexpressed PheXTH3 Plant.

[0024] Figure 4 Overexpression in Arabidopsis PheXTH3Semi-quantitative analysis results of genes; M: DNA Marker; WT: wild-type Arabidopsis (Col-0), negative control; PheXTH3: overexpression PheXTH3 Plant; Actin : internal reference gene; XTH3 : PheXTH3 Gene. DETAILED DESCRIPTION

[0025] In order to make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme in the present invention will be described clearly and completely below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. In the embodiments provided in this specification, if no specific technology or conditions are indicated, the technology or conditions described in the literature in the field, such as Molecular Cloning Laboratory Manual (Sambrook J & Russell ld W, Molecular Cloning: a Laboratory Manual, 2001) or the product instructions are used. The reagents or instruments used without indicating the manufacturer are all conventional products that can be purchased through regular channels.

[0026] 1. Bamboo PheXTH3 Gene cloning and vector construction 1. The bamboo stems were collected from Guangde City, Anhui Province (N30°52′33″8, E119°25′22″4). The materials were transported to the laboratory on dry ice and stored in a -80°C ultra-low temperature refrigerator for subsequent experiments.

[0027] 2. RNA Extraction The specific operations are as follows: (1) Take about 2-3 g of bamboo stem material, place it in a mortar pre-cooled with liquid nitrogen, quickly grind it into powder in liquid nitrogen, and quickly transfer it to a 2 mL RNase-free centrifuge tube pre-cooled with liquid nitrogen; (2) Add 1 mL of Trizol to each tube and quickly invert to mix; (3) Add 200 μL of chloroform to each tube, vortex and mix for 1 min, and place on ice for 15 min. (4) Centrifugation at 12,000 rpm, 10 min, 4°C; (5) Pipette 600 μL of supernatant into a 1.5 mL RNase-free centrifuge tube, add an equal volume of isopropanol, and place on ice for 15 min. (6) Centrifuge at 12,000 rpm for 10 min, discard the supernatant, and wash the precipitate twice with 70% ethanol (prepared with nuclease-free water); (7) After drying at room temperature, dissolve the precipitate in 50-100 μL of nuclease-free water.

[0028] 3. Convert total RNA into cDNA through reverse transcription (1) Perform cDNA first-strand reverse transcription using the PrimeScript RT reagent Kit with gDNA Eraser (TaKaRa): (a) Reaction for removal of genomic DNA The reaction mixture was prepared on ice according to the ingredients in Table 1. The PCR reaction program was: 42°C, 2 min.

[0029] Table 1 Reaction system for removing genomic DNA

[0030] (b) Reverse transcription reaction The reverse transcription PCR reaction program was: 37°C, 15 min; 85°C, 5 s; 4°C low temperature storage. The reverse transcription reaction system is shown in Table 2.

[0031] Table 2 Reverse transcription reaction system

[0032] 4. Gene cloning (1) Primer sequence PheXTH3-F: ATGGCTCGCATGGCGGTTT (SEQ ID NO.3) PheXTH3-R: CTACATGGAGCACTCGGCGG (SEQ ID NO.4) (2) PCR amplification Using bamboo cDNA as template, PCR amplification was performed with corresponding primers, and the reaction program was: 94°C, 1 min; 95°C, 10 s; 60°C, 30 s; 72°C, 1 min; 30 cycles; 72°C, 10 min. 20 μL of amplification system was prepared on ice as shown in Table 3 below.

[0033] Table 3 PCR reaction system

[0034] (3) Use 1% agarose gel electrophoresis to check whether the band size is as expected, and proceed to the next step of gel recovery and purification for the band of the expected size.

[0035] (4) Gel recovery and purification: Gel recovery and purification were performed according to the instructions of the M5 gel extraction kit (Zhejumei, Beijing).

[0036] 5. Connect the cloned product to the vector (1) In a microcentrifuge tube, add 100 ng of PCR product, 1 μL of Pmd19-T vector (TaKaRa), 5 μL of 2× ligation buffer (TaKaRa), and an appropriate amount of ddH2O to a total volume of 10 μL. Gently mix all ingredients and ligate at 16°C for 30 min.

[0037] (2) Transform the ligated product into competent bacteria (DH5α), cool on ice for 30 min, heat shock at 42°C for 30-60 s, and then quickly cool on ice for 3 min. Add 600 μL LB liquid culture medium to the product and resume culture at 37°C for 30 min. Spread the mixture onto an agarose plate containing appropriate antibiotics.

[0038] (3) After culturing overnight on the culture plate, select well-grown colonies for PCR testing to confirm whether they contain the target gene. The positive bacterial solution that has been identified correctly will be sent to Suzhou Anshengda Company for sequencing.

[0039] PheXTH3 The nucleotide sequence of the gene is shown in SEQ ID NO.2, and the amino acid sequence of the encoded protein is shown in SEQ ID NO.1.

[0040] 6. Construction of expression vector (1) After sequencing is correct PheXTH3 The homology arms of the pCAMBIA-2300-eGFP vector were added to the plasmid by PCR, and then the vector and the target gene were connected according to the instructions of M5superFastseamless (Polymer).

[0041] (2) Transform the ligation product into competent E. coli (DH5α) using the heat shock method, and then spread the bacteria onto LB agar plates containing appropriate selective antibiotics.

[0042] (3) Culture the bacteria on the plate until visible colonies are formed. Select a single colony for colony PCR and sequence the positive clone. Correct sequencing indicates that the overexpression vector pCAMBIA-2300-PheXTH3-eGFP Build successful.

[0043] 7. Plant transformation (1) Grow robust Arabidopsis plants (approximately 5 weeks) under a long-day (14 h light, 10 h dark) environment.

[0044] (2) Cut off the first 1-5 cm long main inflorescence (to promote the growth of more lateral inflorescences). Perform infiltration transformation within one week after pruning (3-5 days). In addition, the plant needs to be fully watered 1 day before infiltration transformation so that the plant stomata can fully open during transformation.

[0045] (3) Transform GV3101 Agrobacterium with pCAMBIA-2300-PheXTH3-eGFP, identify positive monoclonal colonies by PCR, add the positive monoclonal colonies to 1 mL of LB medium containing antibiotics, culture at 28°C for 16 h, then take 150 μL of the bacterial solution and add it to 150 mL of fresh liquid LB medium, and culture at 28°C with shaking until OD 600 >0.8.

[0046] (4) Centrifuge the bacterial solution at 4000g for 20 min, then resuspend the bacteria in 120 mL of infiltration solution (10% sucrose + 400 μL / L silwet-77, mix thoroughly before dipping, OD 600 =0.8-1.0). At the same time, cut off the fruit pods and fully opened flowers on the plants.

[0047] (5) Immerse the inflorescence of the plant in the bacterial solution for 45 seconds and shake it gently.

[0048] (6) Place the infected plants in a dark incubator for 48 to 72 hours, then place them in normal light conditions and continue to infect them several times at regular intervals.

[0049] (7) Continue to culture until the plants mature, collect the seeds, place them in a dry environment for about one week, and select the transformants.

[0050] (8) The CTAB method was used to extract Arabidopsis genomic DNA and PCR was performed to screen positive plants ( Figure 1 ).

[0051] 8. Observation and detection of stem cell wall thickness The positive transgenic Arabidopsis plants that had been genetically screened were selected as the experimental group, and the wild-type Arabidopsis plants that had not been transformed (Col-0) were selected as the control group. All plants were cultured under the same growth conditions to maintain consistency. When the height of the inflorescence axis of the control group was about 10 cm, it was treated in an incubator with a low R / FR ratio (0.06) for 15 days. Then, the inflorescence axis was cut into thin slices 2 cm from the base by hand sectioning, stained with intercalated trisphenol, and the cell wall was observed under an optical microscope (Olympus). After taking pictures, the thickness of the vessel and interfascicular fiber cell walls was counted, and statistical analysis and mapping were performed.

[0052] Figure 2 and Figure 3Shows overexpression at low R / FR ratios PheXTH3 Differences between Arabidopsis and wild-type Arabidopsis in cell wall, overexpression PheXTH3 The cell wall thickness of the posterior ducts was reduced, and the cell wall thickness of the interfascicular fibers was also reduced. The results of this study suggest that a low R / FR ratio inhibits PheXTH3 expression, thereby reducing cell wall thickening.

[0053] 9. Gene semi-quantitative analysis Arabidopsis thaliana Actin As the internal reference (control group), the expression pattern of the target gene was analyzed. PheXTH3 Gene, followed by agarose gel electrophoresis, showed that compared with the control group, overexpression PheXTH3 The gene expression level was significantly increased in the plants ( Figure 4 ).

[0054] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A bamboo PheXTH3 protein, characterized in that: Its amino acid sequence is shown in SEQ ID NO.

1.

2. A nucleic acid encoding the bamboo PheXTH3 protein according to claim 1.

3. The nucleic acid according to claim 2, characterized in that Its nucleotide sequence is shown in SEQ ID NO.

2.

4. A biomaterial, characterized in that: It contains the bamboo PheXTH3 protein described in claim 1, or the nucleic acid described in claim 2 or 3; the biological material is recombinant DNA, expression cassette, transposon, plasmid vector, viral vector, engineered bacteria or non-renewable plant cells or tissues.

5. Use of the bamboo PheXTH3 protein according to claim 1, the nucleic acid according to claim 2 or 3, or the biomaterial according to claim 4 in regulating the thickness of plant stem cell walls under shading conditions.

6. The use according to claim 5, characterized in that: The shading condition is that the ratio of red light to far-red light is less than 0.

4.

7. The use according to claim 5, characterized in that: The plant includes Arabidopsis thaliana or bamboo.

8. The use according to claim 5, characterized in that: Under shading conditions, the expression level or activity of the bamboo PheXTH3 protein or its encoding gene is reduced, thereby reducing the thickness of the cell wall of the plant stem.

9. Use of the bamboo PheXTH3 protein according to claim 1, the nucleic acid according to claim 2 or 3, or the biological material according to claim 4 in preparing a transgenic plant that responds to shade conditions.

10. A method for preparing a transgenic plant that responds to shading conditions, characterized in that: include: Genetic engineering is used to make plants express or overexpress the bamboo PheXTH3 protein or its encoding gene.

Images