Application of cytosolic 5'-nucleotidase TaNT5C2 in wheat resistance to scab

By screening and overexpressing the TaNT5C2 gene through genetic engineering, the problem of scarce resources for the control of wheat scab was solved, the resistance of wheat to scab was significantly improved, and a breeding and improvement program for disease-resistant varieties was provided.

CN119752841BActive Publication Date: 2025-12-30NANJING AGRICULTURAL UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202411955262.3
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-27
Publication Date
2025-12-30
Estimated Expiration
2044-12-27

AI Technical Summary

Technical Problem

Existing technologies have limited control strategies for wheat scab, and there is a lack of disease-resistant resources. Furthermore, research on the regulation of cytoplasmic 5′-nucleotidase TaNT5C2 in wheat resistance to scab is insufficient. There is an urgent need to explore efficient disease resistance mechanisms and material breeding methods.

Method used

Through genetic engineering screening and genetic methods, the TaNT5C2 protein and gene related to wheat disease resistance were screened out, a recombinant vector was constructed, and the TaNT5C2 gene was overexpressed in host cells to improve wheat resistance to Fusarium head blight.

Benefits of technology

It significantly enhances wheat's resistance to Fusarium head blight, reduces the rate of diseased ears, provides a breeding and improvement program for disease-resistant varieties, and offers a scientific basis for the screening and identification of highly resistant wheat varieties.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005215632760000011
    Figure HDA0005215632760000011
  • Figure HDA0005215632760000012
    Figure HDA0005215632760000012
  • Figure HDA0005215632760000021
    Figure HDA0005215632760000021
Patent Text Reader

Abstract

The application relates to the field of biological genetic engineering technology and discloses application of cytoplasm 5'-nucleotidase in prevention and treatment of wheat scab. TaNT5C2 The gene can reduce the infection degree of wheat scab and significantly improve the resistance of wheat scab after overexpression in the wheat. The application provides a gene resource and a technical idea for breeding improvement of the wheat against the scab.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the application of cytoplasmic 5′-nucleotidase TaNT5C2 in wheat resistance to Fusarium head blight. Background Technology

[0002] Fusarium head blight (FHB) is a devastating fungal disease caused by Fusarium graminearum, which is prevalent worldwide. This disease not only severely damages the yield and quality of cereal crops such as wheat, causing significant economic losses, but also produces mycotoxins such as deoxynivalenol (DON), posing a serious threat to human and animal safety and health (Xu, M., Wang, Q., Wang, G. et al. Combatting Fusarium head blight: advances in molecular interactions between Fusarium graminearum and wheat. Phytopathol Res 4, 37 (2022).). With global warming, the promotion of wheat-corn (rice) rotation systems and straw return technology, FHB continues to spread and break out globally, causing severe yield reductions and leading to serious DON contamination in flour and feed. Currently, the yield reduction and grain contamination caused by FHB are seriously hindering the development of my country's wheat industry.

[0003] Breeding and planting wheat varieties resistant to Fusarium head blight is one of the most economical and effective ways to control this disease. However, the availability of Fusarium head blight-resistant resources in wheat production is scarce. Although hundreds of resistance QTLs have been identified, only a few, such as Fhb1, have shown stable effects (Su, Z., Bernardo, A., Tian, ​​B. et al. A deletion mutation in TaHRC confers Fhb1 resistance to Fusarium head blight in wheat. Nat Genet 51, 1099–1105 (2019).). Therefore, exploring and applying more efficient strategies to control the spread of Fusarium head blight is particularly urgent. In the process of resisting pathogen invasion, plants have evolved a series of complex defense systems to activate their innate immune responses, providing the first line of defense against diseases. Studies have found that microorganisms induce plant immunity by releasing various immune elicitors. For example, 2'-deoxyguanosine (2-dG) from endophytic fungi has been shown to directly activate the salicylic acid and ethylene resistance signaling pathways in plants. This process involves upregulating the expression of immune-related marker genes activated by plant pathogen-associated molecular recognition patterns (PAMPs), thereby enhancing plant immune activity (Lu C, Wang Q, Jiang Y, et al. Discovery of a novel nucleoside immunesignaling molecule 2′-deoxyguanosine in microbes and plants. J Adv Res. 2023; 46: 1-15.).

[0004] TaNT5C2 is a highly conserved gene, encoding NT5C2, which is widely distributed in organisms. Cytoplasmic 5′-nucleotidase is a specialized phosphodiesterase that dephosphates 2′-deoxyguanosine-5′-triphosphate (dGTP) to 2-dG, thereby inducing plant immunity and enhancing wheat's resistance to Fusarium head blight. However, current research on the regulation of wheat resistance to Fusarium head blight by TaNT5C2 is relatively insufficient and requires further investigation. Summary of the Invention

[0005] To address the aforementioned problems, this invention provides an application of the cytoplasmic 5′-nucleotidase TaNT5C2 in wheat resistance to Fusarium head blight. This invention uses genetic engineering and genetic methods to screen for the TaNT5C2 gene, which is associated with wheat disease resistance. Functional analysis of the protein and gene reveals its disease resistance mechanism in the interaction between wheat and Fusarium head blight, providing a solution for breeding Fusarium head blight-resistant materials. This invention provides the following technical solution:

[0006] This invention first provides a wheat disease resistance-related TaNT5C2 protein and TaNT5C2 gene, derived from multiple wheat varieties such as Fielder, Ningmai 18, and Yangmai 38. The TaNT5C2 protein has the amino acid sequence shown in SEQ ID No. 2, and the TaNT5C2 gene contains the nucleotide sequence encoding the TaNT5C2 protein. The application of genes encoding similar domain proteins in other plants in the preparation of disease-resistant transgenic plants is also within the scope of this invention.

[0007] The present invention further provides an expression element containing the aforementioned gene, a recombinant vector, and a host cell.

[0008] The TaNT5C2 gene described above is also provided, along with its encoding gene and its application in enhancing plant disease resistance.

[0009] Preferably, the plant is a monocotyledonous plant, and more preferably, the plant is wheat; more preferably, the disease resistance refers to wheat scab caused by Fusarium.

[0010] This invention also provides the application of TaNT5C2, or its encoding gene, expression element, recombinant vector, and host cell in the preparation of transgenic plants with enhanced disease resistance.

[0011] Specifically, the plant is a monocotyledonous plant, preferably wheat; more preferably, the disease resistance refers to wheat scab caused by Fusarium.

[0012] The present invention provides a method for preparing transgenic plants with enhanced disease resistance, comprising the steps of overexpressing the TaNT5C2 gene in transgenic plants by transgenic methods, and screening to obtain transgenic plants with enhanced resistance to wheat scab.

[0013] Specifically, the plant is a monocotyledonous plant, preferably wheat; more preferably, the disease resistance refers to wheat scab caused by Fusarium.

[0014] This invention aims to apply the described method to the breeding and improvement of disease-resistant wheat varieties. Furthermore, this invention provides a method for improving wheat varieties using the wheat disease-resistant protein TaNT5C2. This method is of great significance for breeding wheat varieties with stronger disease resistance and provides a scientific basis for subsequent screening and identification of highly resistant wheat varieties. For example, this invention can successfully breed wheat plants overexpressing the TaNT5C2 gene, which lays a solid foundation for further research and application. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the accompanying drawings used in the embodiments will be briefly introduced below.

[0016] Figure 1 A schematic diagram of the pUbiGW vector with the Ubiquitin promoter;

[0017] Figure 2 The relative expression level of TaNT5C2 in overexpressing wheat lines;

[0018] Figure 3 Representative images of wheat ears 14 days after infection with Fusarium graminearum (TaNT5C2-OE) in wild-type and TaNT5C2-OE species;

[0019] Figure 4 This study aimed to quantitatively analyze the number of diseased spikelets in wheat on days 9, 14, and 19 after infection with Fusarium graminearum in wild-type (Fielder) and TaNT5C2-OE plants under greenhouse conditions. Detailed Implementation

[0020] This invention provides the application of overexpression of the TaNT5C2 gene in the positive regulation of wheat scab resistance.

[0021] The present invention will be described below through specific embodiments to provide a better understanding of it, but these embodiments do not constitute a limitation thereof. The specific details are as follows:

[0022] Example 1: Discovery and functional analysis of the wheat disease resistance-related gene TaNT5C2

[0023] This invention utilizes genetic engineering techniques to screen key target proteins involved in the interaction between the Fusarium head blight pathogen and wheat. Through genetic identification of multiple wheat varieties, the pathogenic factor target protein TaNT5C2 was discovered. The CDS nucleotide sequence of the TaNT5C2 gene is shown in SEQ ID No. 1, and the amino acid sequence of the protein encoded by the TaNT5C2 gene is shown in SEQ ID No. 2. Functional analysis of the protein and gene, and the construction of transgenic materials, were used to verify their resistance to Fusarium head blight in wheat, revealing the disease resistance mechanism in the interaction between wheat and Fusarium head blight.

[0024] Example 2: Construction of transgenic wheat overexpressing TaNT5C2

[0025] (1) The amplified full-length TaNT5C2CDS fragment was inserted into the pUbiGW vector with the Ubiquitin promoter via the BamH I site using In-Fusion cloning technology (Clontech, catalog number 638910).

[0026] (2) The ligation vector obtained in step (1) is transformed into Escherichia coli DH5α, and the plasmid is extracted after sequencing;

[0027] (3) The plasmid obtained in step (2) is transformed with Agrobacterium EHA105 to obtain the transformed bacteria;

[0028] (4) The transforming bacteria obtained in step (3) are transformed into the Fielder wheat variety through genetic manipulation to obtain multiple transformed offspring. After genotyping by quantitative qRT-PCR, wheat overexpressing the TaNT5C2 gene is obtained.

[0029] The wheat conversion was carried out according to the previously described method (Goetz H., Cornelia M., and Jochen K. (2021). Agrobacterium-Mediated Transformation of Wheat Using Immature Embryos. Rom. Agric. Res. 38, 99-107 (2021)).

[0030] The gene identification was further confirmed by qRT-PCR to determine whether the NT5C2 gene was overexpressed in T0 generation wheat. Figure 2 As shown, the overexpression lines #1, #2, and #3 expressed 37.8, 45.2, and 14.6 times the wild type, respectively. Therefore, the overexpression lines #1, #2, and #3 were selected for subsequent Fusarium head blight phenotypic identification in this invention.

[0031] The qRT-PCR primers are:

[0032] qPCR-TaNT5C2-F (SEQ ID NO:3): GCCGTTAGCTCGCGGCTAC

[0033] qPCR-TaNT5C2-R (SEQ ID NO:4): AGGCTATGGCAGAGAGTGAG

[0034] Example 3: Phenotypic identification of Fusarium head blight resistance in transgenic wheat overexpressing the TaNT5C2 gene

[0035] In this invention, the wheat transgenic material overexpressing TaNT5C2 obtained in Example 1 was subjected to Fusarium head blight resistance phenotype identification. The specific steps are as follows:

[0036] (1) Inoculate Fusarium graminearum PH1 into wheat florets using the single-floret drip method during the mid-flowering stage. Specifically, inject 10 μl (approximately 1 × 10⁻⁶) of the prepared spore suspension into a small floret on a small spikelet slightly above the middle of the wheat ear using a micropipette. 5 Each strain should be inoculated with at least 30 spores and labeled with the inoculation date and number.

[0037] (2) Cover the inoculated wheat ears in step (1) with a bag to keep them moist for 2 days. After removing the plastic bag, spray water on the inoculated wheat ears regularly every day to keep them moist.

[0038] (3) The number of diseased spikelets in each inoculated wheat ear was investigated on the 9th, 14th and 19th day after inoculation of the wheat ears in step (1).

[0039] The phenotypic identification was performed using the Enviologix QuickStix Kit (Envirologix, catalog number AS013) to evaluate the genotype of the transgenic plants.

[0040] from Figure 3 The symptoms of wheat scab are clearly visible in the images, exhibiting typical signs of the disease: browning and withering of the affected parts, yellowing and withering of the spikelets, and whitening of the spikelets above the affected area. Identification revealed that under greenhouse conditions, at 9, 14, and 19 days post-inoculation, the average number of diseased spikes in TaNT5C2-OE plants was 3, 8.9, and 13.2, respectively, while the average number of diseased spikes in wild-type plants was 4.3, 11.8, and 17.4, respectively. Figure 4The transgenic lines showed a 3.8%, 13.1%, and 20.0% reduction in disease incidence compared to the wild type, significantly lower than the wild type. These experimental data fully demonstrate that the TaNT5C2-OE transgenic wheat variety has a significant effect on improving resistance to Fusarium head blight. Compared with the control variety Fielder, TaNT5C2-OE transgenic wheat exhibits a clear resistance advantage. Specifically, when the disease occurs, the severity of disease in the ears of TaNT5C2-OE transgenic wheat is significantly lower than that of the Fielder wild type. These findings not only verify the effectiveness of TaNT5C2-OE transgenic wheat in Fusarium head blight resistance but also provide valuable genetic resources for future wheat disease resistance breeding work.

Claims

1. Use of cytosolic 5'-nucleotidase or its encoding gene in improving disease resistance of plants; the amino acid sequence of the cytosolic 5'-nucleotidase is shown as SEQ ID No. 2; the plant is wheat; and the disease resistance refers to resistance to wheat scab caused by Fusarium.

2. Use according to claim 1, wherein the nucleotide sequence of the encoding gene is shown as SEQ ID NO:

1.

3. Use of cytosolic 5'-nucleotidase or its encoding gene, expression cassette containing the encoding gene, recombinant vector or host cell in preparing transgenic plants with improved disease resistance; the plant is wheat; and the disease resistance refers to resistance to wheat scab caused by Fusarium. the amino acid sequence of the cytosolic 5'-nucleotidase is shown as SEQ ID No.

2.

4. The use according to claim 3, wherein the compound is ###0002### the nucleotide sequence of the encoding gene is shown as SEQ ID NO:

1.

5. A method of making a transgenic wheat plant with enhanced disease resistance, comprising, It comprises the steps of overexpressing the encoding gene of cytosolic 5'-nucleotidase in transgenic plants by transgenic method, and screening transgenic wheat with enhanced resistance to wheat scab. the amino acid sequence of the cytosolic 5'-nucleotidase is shown as SEQ ID No.

2.

6. The method of claim 5, wherein, the nucleotide sequence of the encoding gene is shown as SEQ ID NO: 1.