Xylanase mutant and application thereof

Abstract

The invention belongs to the technical field of gene engineering and enzyme engineering, and particularly relates to a xylanase mutant and application thereof. According to the invention, methods of Consensus, virtual saturated mutation, disulfide bond introduction and the like are adopted to predict thermal stability related sites of a xylanase XynASP cord region, and a site-directed mutagenesis technology is utilized to obtain the combined mutant DSM4 with significantly improved thermal stability through three rounds of iterative mutation. Compared with wild type xylanase XynASP, the half-life period (t1 / 2) of the combined mutant DSM4 at 50 DEG C is improved by 130.9 times, and the catalytic efficiency (kcat / Km) is improved by 9.3 times. Under a high-temperature condition, the mutant has relatively high thermal stability and catalytic efficiency, and has a good industrial application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of gene engineering and enzyme engineering, and particularly relates to a xylanase mutant and application thereof. Background Art

[0002] Xylanases (EC 3.2.1.8) are a type of glycoside hydrolases (GH) that can endocleave the β-1,4-glycosidic bonds of xylan and hydrolyze it into functional xylose oligosaccharides such as xylose, xylobiose and xylotriose. Glycoside hydrolases (GH) are divided into 58 families, and xylanases are mainly distributed in the GH10 and GH11 families. The structure of GH11 family xylanases is mainly composed of two β-pleated sheets and an α-helix, which is similar to a partially closed right-hand structure. Among them, β chains A and B correspond to "fingers" and "palms", β chains B8 and B7 correspond to "thumbs"; the random coil connecting β chains B6 and B9 is called "Cord" ( Figure 1 GH11 xylanase has strict substrate specificity, low molecular weight, and a wide range of pH and temperature, and is often used as an ideal enzyme preparation for industrial production.

[0003] Xylanase is also used as an important industrial enzyme preparation, and has high application value in industries such as chemical industry, feed processing, papermaking and food processing. In order to adapt to applications in extreme industrial environments, such as extreme temperatures, higher requirements are placed on the enzymatic properties of xylanase. The ideal condition is that the enzyme can maintain good activity and stability under these environments. Among them, the thermal stability of the enzyme is an important indicator for industrial applications. Under high temperature conditions, the enzyme has high catalytic efficiency and short reaction cycle, which can effectively improve the time-space yield, save costs, and is easy to operate, and is also conducive to avoiding contamination by other microorganisms during the reaction process.

[0004] Protein engineering technology provides an effective means to improve the thermal stability and pH stability of enzymes and to increase enzyme activity. Through protein engineering technology, enzymes that meet industrial needs can be obtained quickly and targeted. Directed evolution and rational / semi-rational design are the main technical means for enzyme molecular modification and are also hot topics in the current enzyme engineering field. At present, site-directed mutagenesis technology has become a commonly used method in enzyme molecular modification, which has greatly accelerated the evolution of proteins. The molecular modification of the thermostability of xylanases is mainly focused on secondary structural elements, such as β-folds and α-helices, while there are few reports on the thermostability of the Cord region (K. Xiong, J. Hou, Y. Jiang, X. Li, C. Teng, Q. Li, Fan, G. R Yang, C. Zhang, BMC Biotechnol, 2019, 19, 1, 51; Y. Li, C. Li, H. Huang, S. Rao, Q. Zhang, J. Zhou, J. Li, G. Du, S. Liu, J. Agric. Food Chem. 2022, 70, 15, 4620-4630). Therefore, the present invention takes the GH11 family xylanase XynASP derived from Aspergillus saccharolyticus JOP 1030-1 as the research object, and rationally designs from the Cord perspective to improve the thermostability of the enzyme. Summary of the invention

[0005] The purpose of the present invention is to provide a rationally designed scheme, using consensus, virtual saturation mutation, introduction of disulfide bonds and other strategies to predict amino acid sites related to thermal stability in the Cord region of xylanase XynASP (SEQ ID NO.2) from Aspergillus saccharolyticus JOP 1030-1, and to perform molecular modification, and use site-directed mutagenesis technology to perform single-point mutation and combined mutation, so as to obtain mutants with improved thermal stability.

[0006] In order to achieve the above object, the technical solution adopted by the present invention is:

[0007] A xylanase mutant is prepared by using the sequence shown in SEQ ID NO.2 as the starting sequence, and mutating the glutamic acid at position 119 to cysteine, thereby obtaining a single point mutant E119C, the amino acid sequence of which is shown in SEQ ID NO.4.

[0008] A xylanase combined mutant is provided, wherein the threonine at position 41 of the E119C mutant is mutated to tryptophan, thereby obtaining a combined mutant T41W / E119C, the amino acid sequence of which is shown in SEQ ID NO.6.

[0009] A xylanase combined mutant containing a disulfide bond is obtained by mutating the glycine at position 126 of the combined mutant T41W / E119C to cysteine ​​and the alanine at position 144 to cysteine, thereby obtaining a mutant DSM4, the amino acid sequence of which is shown in SEQ ID NO.8.

[0010] A coding gene, which is a coding gene of a single point mutant E119C, and whose nucleotide sequence is shown as SEQ ID No.3.

[0011] A coding gene, the coding gene is the coding gene of the combined mutant T41W / E119C, and its nucleotide sequence is shown as SEQ ID No.5.

[0012] A coding gene, which is the coding gene of mutant DSM4, and its nucleotide sequence is shown as SEQ ID No.7.

[0013] A recombinant expression vector comprises the coding gene.

[0014] A recombinant engineering bacterium comprises the encoding gene.

[0015] Application of a xylanase combination mutant containing disulfide bonds in beech wood xylan catalysis.

[0016] The specific mutant screening process is as follows:

[0017] The xylanase mutant is obtained by taking SEQ ID NO.2 as the starting sequence through three rounds of iterative mutation.

[0018] In the first round, the tyrosine at position 117 was mutated to tryptophan (the DNA sequence changed from TAT to TGG), the alanine at position 125 was mutated to glycine (the DNA sequence changed from GCT to GGC), the glutamic acid at position 119 was mutated to alanine (the DNA sequence changed from GAG to GCA), the glutamic acid at position 119 was mutated to cysteine ​​(the DNA sequence changed from GAG to TGT), the serine at position 124 was mutated to alanine (the DNA sequence changed from TCG to GCA), the serine at position 124 was mutated to leucine (the DNA sequence changed from TCG to CTC), the serine at position 124 was mutated to methionine (the DNA sequence changed from TCG to ATG), the serine at position 124 was mutated to tryptophan (the DNA sequence changed from TCG to TGG), and the glycine at position 126 was mutated to alanine (the DNA sequence changed from GGC to GCG). After thermal stability screening, the beneficial single point mutant E119C was obtained.

[0019] Second round: The threonine at position 41 was mutated to tryptophan, and the glutamic acid at position 119 was mutated to cysteine ​​to obtain the combined mutant T41W / E119C.

[0020] The third round: Using mutant T41W / E119C as the parent, four pairs of disulfide bond mutants were constructed. (1) DSM1: serine at position 90 mutated to cysteine ​​(DNA sequence changed from AGC to TGT), glycine at position 118 mutated to cysteine ​​(DNA sequence changed from GGC to TGT); (2) DSM2: serine at position 94 mutated to cysteine ​​(DNA sequence changed from AGC to TGT); (3) DSM3: asparagine at position 95 mutated to cysteine ​​(DNA sequence changed from AAC to TGT), tyrosine at position 120 mutated to cysteine ​​(DNA sequence changed from TAT to TGT); (4) DSM4: glycine at position 126 mutated to cysteine ​​(DNA sequence changed from GGC to GGC), alanine at position 144 mutated to cysteine ​​(DNA sequence changed from GCT to TGT). After screening, the mutant DSM4 with greatly improved thermal stability and catalytic activity was finally obtained.

[0021] Beneficial effects of the present invention: All the mutants mentioned above have greatly improved thermal stability compared with the wild type, and the mutant DSM4 finally obtained has significantly improved catalytic ability for beech wood xylan compared with the wild type. The mutant can be industrially produced at a higher temperature, which is beneficial to the flexibility of the production process and has good industrial application prospects. Specifically, the thermal stability of the obtained mutant DSM4 is greatly improved compared with the wild type. The optimum temperature of DSM4 is 20°C higher than that of the wild type XynASP. Compared with the wild type XynASP. The half-life (t 1 / 2 ) were increased by 130.9 times and 25.2 times respectively (Table 1). The catalytic ability of wild-type XynASP and mutant DSM4 on beechwood xylan was determined at their respective optimal temperatures. The specific activity of pure enzyme DSM4 was 282.0 U / mg, which was 5.5 times higher than that of wild-type XynASP (51.0 U / mg). The catalytic efficiency (k cat / K m ) is 596.0 mL·mg -1 s -1 , compared with wild-type XynASP (63.8 mL·mg -1 s -1 ) was increased by 9.3 times (Table 2). BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 Sequence alignment of xylanase XynASP with homologous xylanases.

[0023] Figure 2 Results of virtual saturation mutation at sites 119, 123, 124, and 126.

[0024] Figure 3 Results of thermal stability screening of key sites in the Cord region of xylanase XynASP.

[0025] Figure 4 Thermal stability results of single-point mutants; Notes: Figure A shows the optimal temperature of the wild type and the single-point mutants, Figure B shows the residual enzyme activity of the wild type and the single-point mutants after heat treatment at 40°C for 1 h, Figure C shows the residual enzyme activity of the wild type and the single-point mutants after heat treatment at 45°C for 1 h, and Figure D shows the residual enzyme activity of the wild type and the single-point mutants after heat treatment at 50°C for 1 h.

[0026] Figure 5 Thermal stability screening of disulfide bond mutants.

[0027] Figure 6 Thermal stability results of the combined mutants; Notes: Figure A represents the optimal temperature of the combined mutants, Figure B represents the residual enzyme activity of the combined mutants after heat treatment at 45°C and 50°C for 1 h, and Figure C represents the residual enzyme activity of the combined mutants after heat treatment at 55°C and 60°C for 1 h. DETAILED DESCRIPTION

[0028] Table 1 Thermostability characteristics of xylanase XynASP and its mutants.

[0029] Table 2 Kinetic parameters and specific enzyme activities of xylanase XynASP and its mutants.

[0030] Example 1

[0031] (1) Prediction of thermostability-related sites of xylanase XynASP: The gene sequence of xylanase XynASP (NCBI accession number: XM_025579666, amino acid sequence see SEQ ID NO.2) has been uploaded to the NCBI database. Consensus method predicts thermostability sites: The amino acid sequence of xylanase XynASP was compared with the amino acid sequences of 53 homologous xylanases obtained from the NCBI database using the PSI-BLAST program. The sequence similarity was 30%-60%. The sequence alignment software was ClustalX and the online website ESPript 3.0 (http: / / espript.ibcp.fr / ESPript / cgi-bin / ESPript.cgi). The comparison results showed that ( Figure 1), in the Cord region of the selected 53 homologous sequences, glycine (Gly), tyrosine (Tyr), proline (Pro) and threonine (Thr) residues are highly conserved in positions 118, 120, 122 and 127, which is consistent with the residues at the corresponding positions in XynASP. At position 117, tyrosine (Tyr) and tryptophan (Trp) account for the highest proportion, and at position 125, glycine (Gly) accounts for the highest proportion. In XynASP, the residues at positions 117 and 125 are tyrosine (Tyr) and alanine (Ala), respectively. Therefore, through Consensus sequence analysis, it is decided to replace the amino acid residues at positions 117 and 125 in XynASP with tryptophan (Trp) and glycine (Gly), which account for the highest proportion in homologous sequences, respectively, to construct mutants Y117W and A125G.

[0032] Prediction of virtual saturation mutations at sites in the Cord region: The amino acid sequence of xylanase XynASP was submitted to AlphaFold2 for homology modeling to obtain a three-dimensional model of xylanase XynASP. The three-dimensional model was then submitted to the Schrödinger software, and the Residue Scanning module was used to perform virtual mutations of all possible amino acids (20 in total) at the four less conserved sites in the Cord region (119, 123, 124, and 126). The stability of the XynASP mutant was evaluated based on the folding free energy (ΔΔG value). The lower the ΔΔG value, the greater the structural stability. Considering the ΔΔG value and mutation distribution, seven mutants are planned to be constructed: E119A, E119C, S124A, S124L, S124M, S124W, and G126A ( Figure 2 ).

[0033] (2) Mutant construction and thermal stability verification: Using site-directed mutagenesis technology, pET-28a-xynASP was used as a template to construct a single-point mutant plasmid. The present invention can also be based on the gene sequence after the codon preference of Escherichia coli is optimized as a template (the gene sequence is shown in SEQ ID NO.1, the amino acid sequence is unchanged and is shown in SEQ ID NO.2, the nucleotide sequence SEQ ID No.1 is the original coding gene, and the xylanase mutant E119C is constructed based on the nucleotide sequence SEQ ID No.1). In the application example, the optimized sequence SEQ ID NO.1 is used as a template to illustrate the specific scheme of the present invention.

[0034] The mutant plasmid was chemically transferred into Escherichia coli DH5α and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. After sequencing was correct, the plasmid was extracted and transferred into the expression strain Escherichia coli BL2 (DE3), and a single clone was selected for induction of protein expression. The bacteria were refrigerated centrifuged, and the cells were ultrasonically disrupted by adding citric acid-sodium hydrogen phosphate buffer (50mM, pH 6.0), refrigerated centrifuged, and an appropriate amount of supernatant crude enzyme solution was taken for protein purification. The wild type and mutants were purified by nickel affinity chromatography, and the xylanase was eluted with elution buffer (20mM Tris-HCl, pH8.0, 500mM sodium chloride and 300mM imidazole), and desalted using SuperdexG25 column in citric acid-sodium hydrogen phosphate buffer (50mM, pH 6.0). The protein purity was detected by polyacrylamide gel electrophoresis (SDS-PAGE), and the protein concentration was determined using the BCA protein assay kit (Sangon Biotech, Shanghai, China). The pure enzyme activity was determined by taking 5% beechwood xylan as substrate and reacting for 15 minutes. At the same time, another appropriate amount of pure enzyme was heat-treated at different temperatures for a certain period of time, and the residual activity was determined by the same method. The enzyme activity of the pure enzyme that has not been treated at high temperature was used as a reference to obtain the percentage of residual enzyme activity. For a detailed scheme, see Application Example 1.

[0035] Through the above-mentioned Consensus method and virtual saturation mutation prediction and screening, 9 mutants were constructed, namely Y117W, A125G, E119A, E119C, S124A, S124L, S124M, S124W and G126A, with the following characteristics:

[0036] Y117W: tyrosine at position 117 mutated to tryptophan (DNA sequence changed from TAT to TGG);

[0037] A125G: alanine at position 125 mutated to glycine (DNA sequence changed from GCT to GGC);

[0038] E119A: Glutamic acid at position 119 mutated to alanine (DNA sequence changed from GAG to GCA);

[0039] E119C: Glutamic acid at position 119 mutated to glutamic acid (DNA sequence changed from GAG to TGT);

[0040] S124A: serine at position 124 mutated to alanine (DNA sequence changed from TCG to GCA);

[0041] S124L: serine at position 124 mutated to leucine (DNA sequence changed from TCG to CTC);

[0042] S124M: serine at position 124 mutated to methionine (DNA sequence changed from TCG to ATG);

[0043] S124W: serine at position 124 mutated to tryptophanine (DNA sequence changed from TCG to TGG);

[0044] G126A: The glycine at position 126 mutates to alanine (the DNA sequence changes from GGC to GCG).

[0045] Among the above 9 mutants, only mutants E119A, E119C and S124A showed improved thermal stability compared with the wild type. After heat treatment at 40℃ for 30min, the crude enzyme solution of mutants E119A, E119C and S124 still retained more than 60% of the relative enzyme activity, while the relative enzyme activity of the wild type under the same treatment conditions was 46.9% ( Figure 3 ).

[0046] The wild-type XynASP and three mutants (E119A, E119C, S124A) were expressed and the thermal stability of the pure enzymes was determined as follows ( Figure 4 ): Compared with the wild type, the thermal stability of mutants E119A, E119C and S124A is significantly improved. The optimum temperature of wild-type XynASP is 45°C, while the optimum temperature of mutants E119A, E119C and S124A is 50°C. The thermal stability of the enzyme was determined by heat treatment at 40°C-50°C for 1h and evaluating the change in residual activity over time. The half-life (t 1 / 2 ) were 40.3min, 213min and 49.4min, respectively, compared with the wild-type XynASP (t 1 / 2 40℃ The half-life of mutants E119A, E119C and S124A at 45°C (t 1 / 2 ) were 22.7min, 49.7min and 29.2min, respectively, compared with the wild-type XynASP (t 1 / 2 45℃ =22.0min) were increased by 1.03, 2.3 and 1.3 times respectively.

[0047] (3) Integration of mutants E119C and T41W:

[0048] Through the above (2) mutation screening, 3 beneficial mutants (E119A, E119C and S124A) were obtained. Among them, the mutant E119C (its nucleotide sequence is shown in SEQ ID No.3, and its amino acid sequence is shown in SEQ ID No.4) has the greatest improvement in thermal stability and specific activity. We have reported a mutant T41W with improved heat resistance of xylanase XynASP (TBLi, SWYang, XX Wang, HXCai, Y.Wang, C.Li, EZLi, Crystals, 2022, 12, 1228.). Therefore, E119C and T41W were integrated. Using T41W as a template and site-directed mutagenesis technology, a combined mutant T41W / E119C was constructed, which has the following characteristics:

[0049] T41W / E119C: The threonine at position 41 mutates to tryptophan (the DNA sequence changes from ACG to TGG), and the glutamic acid at position 119 mutates to cysteine ​​(the DNA sequence changes from GAG to TGT). The nucleotide sequence is shown in SEQ ID No.5, and the amino acid sequence is shown in SEQ ID No.6.

[0050] The thermal stability and specific activity of the combined mutant T41W / E119CA were further improved compared with those of the single point mutants ( Figure 4 and Figure 6 ). The optimum temperature of mutant T41W / E119C is 60℃, which is 5℃ higher than that of the parent T41W. The thermal stability of mutant T41W / E119C at 45℃, 50℃ and 55℃ was measured. After heat treatment at 45℃ for 1h, the enzyme activity of T41W / E119C remained basically unchanged, while the enzyme activity of the parent T41W had dropped to 61.6%. After incubation at 50℃ and 55℃ for 1h, the residual enzyme activity of mutant T41E / E119C retained 50.9% and 25.1%, respectively, while the residual activity of T41W dropped to 41.6% and 10.5%, respectively. The half-life (t 1 / 2 ) were 56.8 min and 30.3 min, respectively, which were 1.8-fold and 2.0-fold higher than those of mutant T41W (Table 1).

[0051] Table 1 Thermostability characteristics of xylanase XynASP and its mutants

[0052]

[0053] Note: “—” means not calculated.

[0054] (4) Disulfide bond introduction mutant T41W / E119C:

[0055] Through the combined mutation of (3) above, a combined mutant T41W / E119C with further improved thermal stability was obtained. Therefore, we decided to introduce a disulfide bond into the combined mutant T41W / E119C.

[0056] Prediction of disulfide bond sites: The amino acid sequence of mutant T41W / E119C was submitted to the online website SWISS-MODEL (https: / / swissmodel.expasy.org / ), and homology modeling was performed using the xylanase XynASP model as a template to obtain a three-dimensional model of mutant T41W / E119C. The three-dimensional model was then submitted to Disulfide by Design 2 (http: / / cptweb.cpt.wayne.edu / DbD2 / index.php) for prediction of disulfide bond sites. It was found that the amino acid sites of four pairs of disulfide bonds (S90C / G118C, S94C / E119C, N95C / Y120C, and G126C / A144C) were related to the Cord region of mutant T41W / E119C. Therefore, the above four pairs of disulfide bonds were integrated into mutant T41W / E119C respectively. Using mutant T41W / E119C as a template and site-directed mutagenesis, four combined mutants containing disulfide bonds were constructed: DSM1, DSM2, DSM3 and DSM4, with the following characteristics:

[0057] DSM1: Threonine at position 41 mutates to tryptophan (DNA sequence changes from ACG to TGG), glutamic acid at position 119 mutates to cysteine ​​(DNA sequence changes from GAG to TGT), serine at position 90 mutates to cysteine ​​(DNA sequence changes from AGC to TGT), and glycine at position 118 mutates to cysteine ​​(DNA sequence changes from GGC to TGT).

[0058] DSM2: Threonine at position 41 mutates to tryptophan (DNA sequence changes from ACG to TGG), glutamic acid at position 119 mutates to cysteine ​​(DNA sequence changes from GAG to TGT), and serine at position 94 mutates to cysteine ​​(DNA sequence changes from AGC to TGT).

[0059] DSM3: Threonine at position 41 mutates to tryptophan (DNA sequence changes from ACG to TGG), glutamic acid at position 119 mutates to cysteine ​​(DNA sequence changes from GAG to TGT), asparagine at position 95 mutates to cysteine ​​(DNA sequence changes from AAC to TGT), and tyrosine at position 120 mutates to cysteine ​​(DNA sequence changes from TAT to TGT);

[0060] DSM4: The threonine at position 41 mutates to tryptophan (the DNA sequence changes from ACG to TGG), the glutamate at position 119 mutates to cysteine ​​(the DNA sequence changes from GAG to TGT), the glycine at position 126 mutates to cysteine ​​(the DNA sequence changes from GGC to GGC), and the alanine at position 144 mutates to cysteine ​​(the DNA sequence changes from GCT to TGT).

[0061] The crude enzyme solutions of the four combined mutants (DSM1, DSM2, DSM3, and DSM4) were incubated at 55°C for 30 min to screen mutants with further improved thermal stability. The residual activity of mutant DSM4 was 64.6% higher than that of the parent T41W / E119C. Under the same heat treatment conditions, the residual enzyme activities of mutants DSM1, DSM2, and DSM3 were not significantly improved compared with T41W / E119C ( Figure 5 ).

[0062] The enzymatic properties of the pure enzyme of mutant DSM4 were determined as follows:

[0063] The optimal temperature of mutant DSM4 is 65℃, which is 5℃ higher than that of parent T41W / E119C. The thermal stability of mutant DSM4 at 45℃, 50℃ and 55℃ was measured. After heat treatment at 50℃ for 1h, the enzyme activity of DSM4 did not change significantly, while the parent T41W / E119C only had 50.9% of the enzyme activity. The half-life (t 1 / 2 ) were 693.7min and 108.5min, respectively, which were 12.2 times and 9.1 times higher than those of the parent T41W / E119C. After heat treatment at 60°C for 40min, the parent T41W / E119C was completely inactivated, while the mutant DSM4 (whose nucleotide sequence is shown in SEQ ID No.7 and amino acid sequence is shown in SEQ ID No.8) still retained 40.1% of the enzyme activity ( Figure 6 ).

[0064] Through the site screening and combined mutation of (1), (2), (3) and (4) above, the thermal stability of the mutant DSM4 was significantly improved compared with the wild type. The optimal temperature of DSM4 was 20℃ higher than that of the wild type XynASP. Compared with the wild type XynASP, the half-life (t 1 / 2 ) were increased by 130.9 times and 25.2 times respectively (Table 1). The catalytic ability of wild-type XynASP and mutant DSM4 on beechwood xylan was determined at their respective optimal temperatures. The specific activity of pure enzyme DSM4 was 282.0 U / mg, which was 5.5 times higher than that of wild-type XynASP (51.0 U / mg). The catalytic efficiency (k cat / K m ) is 596.0 mL·mg -1 s -1 , compared with wild-type XynASP (63.8 mL·mg -1 s -1 ) was increased by 9.3 times (Table 2).

[0065] Table 2 Kinetic parameters and specific enzyme activities of xylanase XynASP and its mutants

[0066]

[0067] Application Example 1 Construction of 9 single-point mutants

[0068] Single point mutants Y117W, A125G, E119A, E119C, S124A, S124L, S124M, S124W and G126A were constructed using the xylanase XynASP codon-optimized gene SEQ ID NO.1 as a template, and the primers used are shown in Table 3:

[0069] Table 3

[0070]

[0071]

[0072] PCR conditions were: 2×Phanta Max Buffer 10μL, dNTP Mix (10mM each) 1μL, primers (10mM) 2μL each, Phanta Max Super-Fidelity DNA Polymerase 1μL, plasmid 20ng, ultrapure water to 50μL, conditions: 95℃ pre-denaturation 3min, 95℃ denaturation 16s, 58℃ annealing 15s, 72℃ extension 4min, 30 cycles in total, and then 72℃ extension 10min. The PCR product was treated with 1μL DpnI at 37℃ for 3h. 10μL of the DpnI-digested PCR product was taken and chemically transferred into Escherichia coli DH5α. It was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing. After sequencing was correct, the plasmid was extracted and transferred into the expression strain Escherichia coli BL21 (DE3).

[0073] Application Example 2 Preparation of crude enzyme solution and determination of enzyme activity

[0074] 2.1 Preparation of crude enzyme solution

[0075] Each mutant plasmid in Application Example 1 was chemically transferred into the Escherichia coli expression strain BL21 (DE3), coated with LB plates containing kanamycin (50 μg / mL), cultured at 37°C for 16 hours, and single clones were picked and placed in 2 mL of LB liquid medium containing kanamycin (50 μg / mL), cultured at 37°C, 180 rpm, and cultured for 16 hours. 1% of the inoculum was inoculated into 100 mL of TB medium containing kanamycin (50 μg / mL), cultured at 37°C for 2.5 hours, added with a final concentration of 2 mM IPTG, induced at 30°C for 2 hours, centrifuged at 8000 rpm and 4°C for 10 minutes, discarded the supernatant, added 10 mL of citric acid-sodium hydrogen phosphate buffer (50 mM, pH 6.0), mixed, and ultrasonically disrupted the cells (working conditions: working time 4s, rest time 4s, working times 40, power 200W), centrifuged at 12000 rpm, 4°C for 20 minutes, and the supernatant crude enzyme solution was used for reaction.

[0076] 2.2 Determination of xylanase activity

[0077] Take 1.5mL 0.5% beechwood xylan and 1mL appropriately diluted enzyme solution and react at an appropriate temperature for 15min, add 2.5mL DNS to terminate the reaction, boil in a water bath for 7min; after cooling, add 5mL ddH2O, shake and mix, and measure the absorbance at 540nm. The activity unit (U) of xylanase is defined as: the amount of enzyme required to hydrolyze xylan to produce 1μmol xylose per minute under the above activity determination conditions.

[0078] 2.3 Single-point mutant thermal stability screening method

[0079] 500 μL of the crude enzyme solution of the single-point mutant was placed in a centrifuge tube with a capacity of 1.5 mL, and sampled after heat treatment at 40°C for 30 min, and quickly placed on ice for cooling. The crude enzyme solution after heat treatment was taken to determine the residual activity, and the crude enzyme activity was determined at 45°C with reference to Example 2.2. The crude enzyme solution that had not been subjected to high temperature treatment was used as a reference to obtain the residual relative enzyme activity.

[0080] 2.4 Wild-type and single-point mutant protein purification methods

[0081] The crude enzyme solution was obtained by referring to Application Example 2.1, and the crude enzyme solution of the wild type and mutant was purified by nickel affinity chromatography, and the xylanase was eluted with elution buffer (20mM Tris-HCl, pH 8.0, 500mM sodium chloride and 300mM imidazole), and desalted using a Superdex G25 column in a citric acid-sodium hydrogen phosphate buffer (50mM, pH 6.0). The protein purity was detected by polyacrylamide gel electrophoresis (SDS-PAGE), and the protein concentration was determined using a BCA protein assay kit (SangonBiotech, Shanghai, China).

[0082] 2.5 Method for determining the optimum temperature and thermal stability of pure mutant enzymes

[0083] Referring to the method for determining the enzyme activity of xylanase in Application Example 2.2, the enzyme activity of pure enzymes of wild-type XynASP and mutants (E119A, E119C and S124A) was determined at 35°C-60°C, and the relative enzyme activity of the enzyme at each temperature was calculated with the highest enzyme activity as 100%. Wild-type XynASP and mutants (E119A, E119C and S124A) were incubated at 40°C, 45°C and 50°C for 1 hour, respectively, and samples were taken every 10 minutes to determine the residual enzyme activity at each optimal temperature. The enzyme activity of the unincubated enzyme was taken as 100%, and the residual enzyme activity of the enzyme at different incubation times was calculated.

[0084] In this round of screening, three mutants with improved thermal stability were obtained: E119A, E119C and S124A. The thermal stability results of the wild type and mutants are shown in Figure 3 and 4 .

[0085] Application Example 3 Construction of combined mutant T41W / E119C

[0086] 3.1 Construction of mutant T41W / E119C

[0087] The threonine at position 41 of the mutant E119C was mutated to tryptophan by site-directed mutagenesis to construct the mutant T41W / E119C. The primers used are shown in Table 4:

[0088] Table 4

[0089] Primer name Sequence (5'-3') T41W-F <![CDATA[ACTACTCCTTCTGG TGG GATGGTGCAAGCGGA]]> T41W-R <![CDATA[TCCGCTTGCACCATC CCA CCAGAGGAGGTAGTA]]>

[0090] The PCR conditions and operations were the same as those in Application Example 1, and the combined mutant T41W / E119C was obtained.

[0091] 3.2 Protein purification method of combined mutant T41W / E119C

[0092] Protein purification and protein concentration determination were performed according to the method in Application Example 2.4.

[0093] 3.3 Determination of optimal temperature and thermal stability of the combined mutant T41W / E119C

[0094] The enzyme activity of the pure enzyme of the combined mutant T41W / E119C was measured at 45°C-70°C, and the relative enzyme activity of the enzyme at each temperature was calculated with the highest enzyme activity as 100%. The combined mutant T41W / E119C was incubated at 45°C, 50°C, 55°C and 60°C for 1 hour, and samples were taken every 10 minutes. The residual activity was measured at each optimal temperature, and the enzyme activity of the unincubated enzyme was taken as 100%, and the residual activity of the enzyme at different incubation times was calculated.

[0095] The optimal temperature and thermal stability data of the combined mutant T41W / E119C are shown in Figure 6 and Table 1.

[0096] Application Example 4: Construction of a combined mutant containing a disulfide bond

[0097] 4.1 Construction of mutant DSM1

[0098] The serine at position 90 of T41W / E119C was mutated to cysteine, and the glycine at position 118 was mutated to cysteine ​​by site-directed mutagenesis to construct mutant DSM1. The primers used are shown in Table 5:

[0099] Table 5

[0100] Primer name Sequence (5'-3') S90C-F <![CDATA[TCCGGCTCGTGGACC TGT ACCGACAACAGCAAC<!-- 8 --> ]]> S90C-R <![CDATA[GTTGCTGTTGTCGGT ACA GGTCCACGAGCCGGA]]> G118C-F <![CDATA[ATTCTGGAGGACTGT TGT GAGTATAATCCGGGC]]> G118A-R <![CDATA[GCCCGGATTATACTC ACA ACAGTCCTCCAGAAT]]>

[0101] The PCR conditions and operations were the same as those in Application Example 1 to obtain the combined mutant DSM1.

[0102] 4.2 Construction of mutant DSM2

[0103] The serine at position 94 of T41W / E119C was mutated to cysteine ​​by site-directed mutagenesis to construct mutant DSM2. The primers used are shown in Table 6:

[0104] Table 6

[0105] Primer name Sequence (5'-3') S94C-F <![CDATA[ACCAGCACCGACAAC TGT AACAGCTACCTCTCC]]> S94C-R <![CDATA[GGAGAGGTAGCTGTT ACA GTTGTCGGTGCTGGT]]>

[0106] The PCR conditions and operations were the same as those in Example 1 to obtain the combined mutant DSM2.

[0107] 4.3 Construction of mutant DSM3

[0108] The glutamine at position 95 of T41W / E119C was mutated to cysteine, and the tyrosine at position 120 was mutated to cysteine ​​by site-directed mutagenesis to construct mutant DSM3. The primers used are shown in Table 7:

[0109] Table 7

[0110] Primer name Sequence (5'-3') N95C-F AGCACCGACAACAGCTGTAGCTACCTCTCCGTC N95C-R GACGGAGAGGTAGCTACAGCTGTTGTCGGTGCT Y120C-F GAGGACTATGGCTGTTGTAATCCGGGCTCGGCT Y120C-R AGCCGAGCCCGGATTACAACAGCCATAGTCCTC

[0111] The PCR conditions and operations were the same as those in Application Example 1 to obtain the combined mutant DSM3.

[0112] 4.4 Construction of mutant DSM4

[0113] The site-directed mutagenesis method was used to mutate the glycine at position 126 of T41W / E119C to cysteine ​​and the alanine at position 144 to cysteine ​​to construct the mutant DSM4. The primers used are shown in Table 8:

[0114] Table 8

[0115] Primer name Sequence (5'-3') G126C-F <![CDATA[AATCCGGGCTCGGCT TGC ACCTACAAGGGAAGC]]> G126C-R <![CDATA[GCTTCCCTTGTAGGT GCA AGCCGAGCCCGGATT]]> T144C-F <![CDATA[TACGATATCTACACC TGT ACCCGCACCAATGCT]]> T144C-R <![CDATA[AGCATTGGTGCGGGT ACA GGTGTAGATATCGTA]]>

[0116] The PCR conditions and operations were the same as those in Application Example 1, and the combined mutant DSM4 was obtained.

[0117] 4.5 Thermal stability screening method for combined mutants

[0118] 500 μL of crude enzyme solution of combined mutants (DSM1, DSM2, DSM3 and DSM4) was placed in a centrifuge tube with a capacity of 1.5 mL, and sampled after heat treatment at 50°C for 30 min, and quickly placed on ice for cooling. The crude enzyme solution after heat treatment was taken to determine the residual activity, and the crude enzyme activity was determined at 60°C with reference to Example 2.2. The crude enzyme solution that had not been subjected to high temperature treatment was used as a reference to obtain the residual relative enzyme activity.

[0119] 4.6 Protein purification method of mutant DSM4

[0120] Protein purification and protein concentration determination were performed according to the method in Application Example 2.4.

[0121] 4.7 Determination of optimal temperature and thermal stability of mutant DSM4

[0122] Protein purification and protein concentration determination were performed according to the method in Application Example 3.3.

[0123] 4.8 Determination of enzyme activity and enzyme kinetic parameters of wild-type and mutant DSM4

[0124] Determination of specific enzyme activity: Referring to the method for determining the enzyme activity of xylanase in Application Example 2.2, the specific enzyme activity of each pure enzyme was determined at the respective optimal temperatures of the wild type (enzyme concentration of 0.96 U / mg) and mutant DSM4 (enzyme concentration of 0.78 U / mg).

[0125] Determination of enzyme kinetic parameters: Prepare beechwood xylan solutions with different substrate concentrations (0.1-0.8 mg / mL), refer to the method for determining the activity of xylanase in Application Example 2.2, and determine the specific enzyme activity of the wild type (enzyme concentration of 0.96 U / mg) and mutant DSM4 (enzyme concentration of 0.78 U / mg) under the optimal conditions of each enzyme. PraphPad Prism 8.0 software was used to calculate V max and K m value, and then according to k cat =V max / E formula to find the k of each enzyme cat value.

[0126] The results of thermal stability screening of disulfide bond mutants are shown in Figure 5 The optimal temperature and thermal stability data of mutant DSM4 are shown in Figure 6 and Table 1. The specific enzyme activity and enzyme kinetics data of wild-type and mutant DSM4 are shown in Table 2.

Claims

1. A xylanase mutant, characterized in that: Taking the sequence shown in SEQ ID NO.2 as the starting sequence, the glutamic acid at position 119 was mutated to cysteine, i.e., the single point mutant E119C, whose amino acid sequence is shown in SEQ ID NO.

4.

2. A xylanase combination mutant, characterized in that: The threonine at position 41 of the E119C mutant of claim 1 is mutated to tryptophan, i.e., the combined mutant T41W / E119C, whose amino acid sequence is shown in SEQ ID NO.

6.

3. A xylanase combination mutant containing a disulfide bond, characterized in that: The glycine at position 126 of the combined mutant T41W / E119C of claim 2 is mutated to cysteine, and the alanine at position 144 is mutated to cysteine, i.e., the mutant DSM4, whose amino acid sequence is shown in SEQ ID NO.

8.

4. A coding gene, characterized in that The coding gene is the coding gene of the single point mutant E119C according to claim 1, and its nucleotide sequence is shown in SEQ ID No.

3.

5. A coding gene, characterized in that The coding gene is the coding gene of the combined mutant T41W / E119C according to claim 2, and its nucleotide sequence is shown in SEQ ID No.

5.

6. A coding gene, characterized in that The coding gene is the coding gene of the mutant DSM4 described in claim 3, and its nucleotide sequence is shown in SEQ ID No.

7.

7. A recombinant expression vector, characterized in that: It comprises the coding gene according to any one of claims 4 to 6.

8. A recombinant engineered bacterium, characterized in that: It comprises the coding gene according to any one of claims 4 to 6.

9. Use of the disulfide bond-containing xylanase combination mutant according to claim 3 in beechwood xylan catalysis.

Images