Xylanase mutants and uses thereof

Abstract

This invention belongs to the fields of genetic engineering and enzyme engineering technology, and particularly relates to a xylanase mutant and its applications. This invention uses methods such as Consensus, virtual saturation mutagenesis, and the introduction of disulfide bonds to predict thermostability-related sites in the XynASP cord region of xylanase. Using site-directed mutagenesis, through three rounds of iterative mutagenesis, a combinatorial mutant DSM4 with significantly improved thermostability was obtained. Compared to wild-type xylanase XynASP, the combinatorial mutant DSM4 has a significantly longer half-life at 50°C (…). t 1 / 2 The catalytic efficiency was increased by 130.9 times. k cat / K m The efficiency was increased by 9.3 times. Under high temperature conditions, this mutant exhibits high thermal stability and catalytic efficiency, showing promising prospects for industrial applications.

Description

Technical Field

[0001] This invention belongs to the fields of genetic engineering and enzyme engineering technology, and in particular relates to a xylanase mutant and its application. Background Technology

[0002] Xylanase (EC 3.2.1.8) is a class of glycoside hydrolases (GH) that cleave the β-1,4-glycosidic bonds of xylan, hydrolyzing it into functional xylo-oligosaccharides such as xylose, xylobiose, and xylotriose. Glycoside hydrolases (GH) are divided into 58 families, with xylanases mainly distributed in the GH10 and GH11 families. The structure of GH11 family xylanases mainly consists of two β-sheets and an α-helix, resembling a partially closed right-handed structure. β chains A and B correspond to the "fingers" and "palm," respectively, while β chains B8 and B7 correspond to the "thumb." The random coil connecting β chains B6 and B9 is called the "cord." Figure 1 GH11 xylanase has strict substrate specificity, low molecular weight, and a wide pH and temperature range, and is often used as an ideal enzyme preparation for industrial production.

[0003] Xylanase is also an important industrial enzyme preparation with high application value in industries such as chemical engineering, feed processing, papermaking, and food processing. To adapt to applications in extreme industrial environments, such as extreme temperatures, higher requirements are placed on the enzymatic performance of xylanase. Ideally, the enzyme should maintain good activity and stability under these conditions. Among these, the thermal stability of the enzyme is a crucial indicator for industrial applications. Under high-temperature conditions, the enzyme exhibits high catalytic efficiency and a short reaction cycle, effectively improving space-time yield, saving costs, facilitating operation, and preventing contamination by other microorganisms during the reaction process.

[0004] Protein engineering provides an effective means to improve the thermostability, pH stability, and activity of enzymes. Through protein engineering, enzymes that meet industrial requirements can be rapidly and targetedly obtained. Directed evolution and rational / semi-rational design are the main techniques for enzyme molecule modification and are currently hot topics in the field of enzyme engineering research. At present, site-directed mutagenesis has become a commonly used method in enzyme molecule modification, greatly accelerating the protein evolution process. Molecular modifications to improve the thermostability of xylanases have primarily focused on secondary structural elements, such as β-sheets and α-helices, while studies on the thermostability of the Cord region are scarce (K. Xiong, J. Hou, Y. Jiang, X. Li, C. Teng, Q. Li, Fan, GRYang, C. Zhang, BMC Biotechnol, 2019, 19, 1, 51; Y. Li, C. Li, H. Huang, S. Rao, Q. Zhang, J. Zhou, J. Li, G. Du, S. Liu, J. Agric. Food Chem. 2022, 70, 15, 4620-4630). Therefore, this invention focuses on XynASP, a xylanase from the GH11 family derived from Aspergillus saccharolyticus JOP 1030-1, and rationally designs it from a Cord perspective to improve its thermostability. Summary of the Invention

[0005] The purpose of this invention is to provide a rationally designed scheme that uses strategies such as consensus, virtual saturation mutation, and the introduction of disulfide bonds to predict the amino acid sites related to the thermal stability of the Cord region of xylanase XynASP (SEQ ID NO.2) derived from Aspergillus saccharolyticus JOP 1030-1, and then performs molecular modification, using site-directed mutagenesis to perform single-point mutations and combinatorial mutations, thereby obtaining mutants with improved thermal stability.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] A xylanase mutant, using the sequence shown in SEQ ID NO.2 as the starting sequence, mutates glutamic acid at position 119 to cysteine, thus obtaining the single-point mutant E119C, whose amino acid sequence is shown in SEQ ID NO.4.

[0008] A xylanase combinatorial mutant was obtained by mutating threonine at position 41 of the E119C mutant to tryptophan, resulting in the combinatorial mutant T41W / E119C, the amino acid sequence of which is shown in SEQ ID NO.6.

[0009] A xylanase combinatorial mutant containing disulfide bonds was obtained by mutating glycine at position 126 to cysteine ​​and alanine at position 144 to cysteine ​​in the combinatorial mutant T41W / E119C, thus obtaining mutant DSM4, whose amino acid sequence is shown in SEQ ID NO.8.

[0010] A coding gene, wherein the coding gene is the coding gene of the single-point mutant E119C, and the nucleotide sequence of which is shown in SEQ ID No. 3.

[0011] A coding gene, wherein the coding gene is the coding gene of the combined mutant T41W / E119C, and the nucleotide sequence of which is shown in SEQ ID No. 5.

[0012] A coding gene, wherein the coding gene is the coding gene of the mutant DSM4, and the nucleotide sequence of which is shown in SEQ ID No. 7.

[0013] A recombinant expression vector comprising the aforementioned coding gene.

[0014] A recombinant engineered bacterium containing the aforementioned coding gene.

[0015] Application of a xylanase combinatorial mutant containing disulfide bonds in beech xylan catalysis.

[0016] The specific screening process for mutants is as follows:

[0017] The xylanase mutant was obtained by iterative mutation of SEQ ID NO.2 as the starting sequence.

[0018] Round 1: Tyrosine at position 117 was mutated to tryptophan (DNA sequence changed from TAT to TGG), alanine at position 125 was mutated to glycine (DNA sequence changed from GCT to GGC), glutamic acid at position 119 was mutated to alanine (DNA sequence changed from GAG to GCA), glutamic acid at position 119 was mutated to cysteine ​​(DNA sequence changed from GAG to TGT), serine at position 124 was mutated to alanine (DNA sequence changed from TCG to GCA), serine at position 124 was mutated to leucine (DNA sequence changed from TCG to CTC), serine at position 124 was mutated to methionine (DNA sequence changed from TCG to ATG), serine at position 124 was mutated to tryptophan (DNA sequence changed from TCG to TGG), and glycine at position 126 was mutated to alanine (DNA sequence changed from GGC to GCG). After thermostability screening, the beneficial single-point mutant E119C was obtained.

[0019] Second round: Threonine at position 41 was mutated to tryptophan and glutamic acid at position 119 was mutated to cysteine ​​to obtain the combined mutant T41W / E119C.

[0020] Round 3: Using mutant T41W / E119C as the parent, four pairs of disulfide bond mutants were constructed. (1) DSM1: Serine at position 90 was mutated to cysteine ​​(DNA sequence changed from AGC to TGT), and glycine at position 118 was mutated to cysteine ​​(DNA sequence changed from GGC to TGT); (2) DSM2: Serine at position 94 was mutated to cysteine ​​(DNA sequence changed from AGC to TGT); (3) DSM3: Asparagine at position 95 was mutated to cysteine ​​(DNA sequence changed from AAC to TGT), and tyrosine at position 120 was mutated to cysteine ​​(DNA sequence changed from TAT to TGT); (4) DSM4: Glycine at position 126 was mutated to cysteine ​​(DNA sequence changed from GGC to GGC), and alanine at position 144 was mutated to cysteine ​​(DNA sequence changed from GCT to TGT). After screening, mutant DSM4 with significantly improved thermal stability and catalytic activity was finally obtained.

[0021] The beneficial effects of this invention are as follows: Compared with the wild type, all the above mutants exhibit significantly improved thermal stability, and the catalytic activity of the final mutant DSM4 for beech xylan is significantly enhanced compared to the wild type. This mutant can be industrially produced at higher temperatures, which is beneficial for the flexibility of the production process and has good prospects for industrial application. Specifically, the thermal stability of the obtained mutant DSM4 is significantly improved compared to the wild type. The optimal temperature of DSM4 is 20°C higher than that of the wild type XynASP. Compared with the wild type XynASP, the half-life (t) of mutant DSM4 at 50°C and 55°C is significantly longer. 1 / 2 The specific activity of the pure enzyme DSM4 was increased by 130.9 times and 25.2 times, respectively (Table 1). The catalytic activity of wild-type XynASP and mutant DSM4 for beech xylan was determined at their respective optimal temperatures. The specific activity of pure enzyme DSM4 was 282.0 U / mg, which was 5.5 times higher than that of wild-type XynASP (51.0 U / mg). The catalytic efficiency (kJ) of pure enzyme DSM4 was... cat / K m The value was 596.0 mL·mg. -1 s -1 Compared with wild-type XynASP (63.8 mL·mg) -1 s -1 Compared to the previous year, it increased by 9.3 times (Table 2). Attached Figure Description

[0022] Figure 1 Sequence alignment of xylanase XynASP with homologous xylanase.

[0023] Figure 2 Results of virtual saturation mutations at sites 119, 123, 124, and 126.

[0024] Figure 3 Screening results for the thermal stability of key sites in the Cord region of xylanase XynASP.

[0025] Figure 4 Thermostability results of single-point mutants; Note: Figure A represents the optimal temperature for wild type and single-point mutants; Figure B represents the residual enzyme activity of wild type and single-point mutants after heat treatment at 40℃ for 1 h; Figure C represents the residual enzyme activity of wild type and single-point mutants after heat treatment at 45℃ for 1 h; Figure D represents the residual enzyme activity of wild type and single-point mutants after heat treatment at 50℃ for 1 h.

[0026] Figure 5 Screening for the thermal stability of disulfide bond mutants.

[0027] Figure 6 Thermostability results of the combined mutants; Note: Figure A represents the optimum temperature of the combined mutants, Figure B represents the residual enzyme activity of the combined mutants after heat treatment at 45℃ and 50℃ for 1 h, and Figure C represents the residual enzyme activity of the combined mutants after heat treatment at 55℃ and 60℃ for 1 h. Detailed Implementation

[0028] Table 1. Thermal stability characteristics of xylanase XynASP and its mutants.

[0029] Table 2. Enzyme kinetic parameters and specific enzyme activities of xylanase XynASP and its mutants.

[0030] Example 1

[0031] (1) Prediction of thermostability-related sites of xylanase XynASP: The gene sequence of xylanase XynASP (NCBI accession number: XM_025579666, amino acid sequence see SEQ ID NO.2) has been uploaded to the NCBI database. Thermostase method was used to predict thermostability sites: The amino acid sequence of xylanase XynASP was compared with the amino acid sequences of 53 homologous xylanases obtained from the NCBI database using the PSI-BLAST program. The sequence similarity was 30%-60%. The sequence alignment software used was ClustalX and the online website ESPript 3.0 (http: / / espript.ibcp.fr / ESPript / cgi-bin / ESPript.cgi). The alignment results showed that ( Figure 1In the Cord regions of the 53 selected homologous sequences, glycine (Gly), tyrosine (Tyr), proline (Pro), and threonine (Thr) residues were highly conserved at positions 118, 120, 122, and 127, consistent with the residues at the corresponding positions in XynASP. At position 117, tyrosine (Tyr) and tryptophan (Trp) were most abundant, while at position 125, glycine (Gly) was most abundant. In XynASP, the residues at positions 117 and 125 are tyrosine (Tyr) and alanine (Ala), respectively. Therefore, based on Consensus sequence analysis, it was decided to replace the amino acid residues at positions 117 and 125 in XynASP with tryptophan (Trp) and glycine (Gly), which have the highest homologous concentrations, respectively, to construct mutants Y117W and A125G.

[0032] Virtual saturation mutation prediction at sites in the Cord region: The amino acid sequence of xylanase XynASP was submitted to AlphaFold2 for homology modeling to obtain a three-dimensional model of xylanase XynASP. The three-dimensional model was then submitted to Schrödinger software, and the Residue Scanning module was used to perform virtual mutations (a total of 20 possibilities) on four sites with low conservation in the Cord region (119, 123, 124, and 126). The stability of the XynASP mutants was assessed based on the folding free energy (ΔΔG value); a lower ΔΔG value indicates greater structural stability. Considering the ΔΔG value and mutation distribution, seven mutants were proposed to be constructed: E119A, E119C, S124A, S124L, S124M, S124W, and G126A. Figure 2 ).

[0033] (2) Mutant construction and thermostability verification: A single-point mutant plasmid was constructed using site-directed mutagenesis with pET-28a-xynASP as a template. This invention can also be based on the codon-bias-optimized gene sequence of *E. coli* as a template (gene sequence is shown in SEQ ID NO.1, amino acid sequence remains unchanged in SEQ ID NO.2, nucleotide sequence SEQ ID No.1 is the original coding gene, and the xylanase mutant E119C was constructed from the nucleotide sequence SEQ ID No.1). The application example uses the optimized sequence SEQ ID NO.1 as a template to illustrate the specific scheme of this invention.

[0034] The mutant plasmid was chemically transformed into *E. coli* DH5α and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. After correct sequencing, the plasmid was extracted and transformed into the expression strain *E. coli* BL2(DE3). Single clones were selected for induced protein expression. The cells were frozen and centrifuged, and the cells were sonicated and disrupted by adding citrate-disodium hydrogen phosphate buffer (50 mM, pH 6.0). After freezing and centrifugation, an appropriate amount of supernatant crude enzyme solution was used for protein purification. Nickel affinity chromatography was used to purify wild-type and mutant proteins. Xylanase was eluted with elution buffer (20 mM Tris-HCl, pH 8.0, 500 mM sodium chloride, and 300 mM imidazole). Desalting was performed using a Superdex G25 column in citrate-disodium hydrogen phosphate buffer (50 mM, pH 6.0). Protein purity was detected by polyacrylamide gel electrophoresis (SDS-PAGE), and protein concentration was determined using a BCA protein assay kit (Sangon Biotech, Shanghai, China). Using 5% beech wood xylan as a substrate, the activity of the pure enzyme was determined after reacting for 15 minutes. Simultaneously, an appropriate amount of pure enzyme was heat-treated at different temperatures for a certain period, and the residual activity was determined using the same method. The percentage of residual enzyme activity was then obtained by comparing the activity of the pure enzyme that had not undergone high-temperature treatment with that of the pure enzyme. See Application Example 1 for detailed procedures.

[0035] Using the Consensus method and virtual saturation mutation prediction and screening described above, nine mutants were constructed: Y117W, A125G, E119A, E119C, S124A, S124L, S124M, S124W, and G126A. Their characteristics are as follows:

[0036] Y117W: Tyrosine at position 117 is mutated to tryptophan (DNA sequence changes from TAT to TGG);

[0037] A125G: The alanine at position 125 is mutated to glycine (the DNA sequence changes from GCT to GGC);

[0038] E119A: The glutamic acid at position 119 is mutated to alanine (the DNA sequence changes from GAG to GCA);

[0039] E119C: The glutamic acid at position 119 is mutated to glutamic acid (the DNA sequence changes from GAG to TGT);

[0040] S124A: The serine at position 124 is mutated to alanine (the DNA sequence changes from TCG to GCA);

[0041] S124L: The serine at position 124 is mutated to leucine (the DNA sequence changes from TCG to CTC);

[0042] S124M: The serine at position 124 is mutated to methionine (the DNA sequence changes from TCG to ATG);

[0043] S124W: The serine at position 124 is mutated to tryptophan (the DNA sequence changes from TCG to TGG);

[0044] G126A: The glycine at position 126 is mutated to alanine (the DNA sequence changes from GGC to GCG).

[0045] Of the nine mutants, only mutants E119A, E119C, and S124A showed improved thermostability compared to the wild type. After heat treatment at 40℃ for 30 min, the crude enzyme solutions of mutants E119A, E119C, and S124A retained more than 60% of their relative enzyme activity, while the wild type's relative enzyme activity under the same treatment conditions was 46.9%. Figure 3 ).

[0046] Protein expression was performed on wild-type XynASP and three mutants (E119A, E119C, and S124A), and the thermostability of the purified enzymes was determined as follows ( Figure 4 Compared to the wild type, mutants E119A, E119C, and S124A exhibit significantly improved thermostability. The optimum temperature for wild-type XynASP is 45℃, while the optimum temperature for mutants E119A, E119C, and S124A is 50℃. The thermostability of the enzymes was determined by assessing the change in residual activity over time after heat treatment at 40℃-50℃ for 1 h. The half-life (t) of mutants E119A, E119C, and S124A at 40℃ is shown in the figure. 1 / 2 The timeframes were 40.3 min, 213 min, and 49.4 min, respectively, compared to the wild-type XynASP(t 1 / 2 40℃ =38.0 min) increased by 1.1, 5.6, and 1.3 times, respectively. The mutants E119A, E119C, and S124A had a half-life (t) at 45℃ of 1.1, 5.6, and 1.3 times, respectively. 1 / 2 The timeframes were 22.7 min, 49.7 min, and 29.2 min, respectively, compared to the wild-type XynASP(t 1 / 2 45℃ =22.0min) increased by 1.03, 2.3 and 1.3 times respectively.

[0047] (3) Integration of mutant E119C with T41W:

[0048] Through the above (2) mutation screening, three beneficial mutants (E119A, E119C, and S124A) were obtained. Among them, mutant E119C (whose nucleotide sequence is shown in SEQ ID No. 3 and amino acid sequence is shown in SEQ ID No. 4) showed the greatest improvement in thermostability and specific activity. We have reported a thermostable mutant of xylanase XynASP, T41W (TBLi, SWYang, XX Wang, HXCai, Y.Wang, C.Li, EZLi, Crystals, 2022, 12, 1228.). Therefore, E119C and T41W were integrated. Using T41W as a template, the combined mutant T41W / E119C was constructed using site-directed mutagenesis, and its characteristics are as follows:

[0049] T41W / E119C: Threonine at position 41 is mutated to tryptophan (DNA sequence changes from ACG to TGG), and glutamic acid at position 119 is mutated to cysteine ​​(DNA sequence changes from GAG to TGT). Its nucleotide sequence is shown in SEQ ID No. 5, and its amino acid sequence is shown in SEQ ID No. 6.

[0050] The thermostability and specific activity of the combined mutant T41W / E119CA were further improved compared with those of the single-point mutant. Figure 4 and Figure 6 The optimal temperature for mutant T41W / E119C is 60℃, which is 5℃ higher than that of the parent T41W. The thermostability of mutant T41W / E119C at 45℃, 50℃, and 55℃ was determined. After heat treatment at 45℃ for 1 h, the enzyme activity of T41W / E119C remained essentially unchanged, while the enzyme activity of the parent T41W decreased to 61.6%. After incubation at 50℃ and 55℃ for 1 h, the residual enzyme activity of mutant T41E / E119C was 50.9% and 25.1%, respectively, while the residual activity of T41W decreased to 41.6% and 10.5%, respectively. The half-life (t) of mutant T41W / E119C at 50℃ and 55℃ was also determined. 1 / 2 The results were 56.8 min and 30.3 min, respectively, which were 1.8 times and 2.0 times higher than those of the mutant T41W (Table 1).

[0051] Table 1. Thermal stability characteristics of xylanase XynASP and its mutants

[0052]

[0053] Note: "—" indicates that it has not been calculated.

[0054] (4) Disulfide bond introduction into mutant T41W / E119C:

[0055] Through the combined mutation described in (3) above, a combined mutant T41W / E119C with further improved thermal stability was obtained. Therefore, we intend to introduce disulfide bonds into the combined mutant T41W / E119C.

[0056] Disulfide bond site prediction: The amino acid sequence of mutant T41W / E119C was submitted to the online website SWISS-MODEL (https: / / swissmodel.expasy.org / ). Homology modeling was performed using the xylanase XynASP model as a template to obtain a three-dimensional model of mutant T41W / E119C. This three-dimensional model was then submitted to Disulfide by Design 2 (http: / / cptweb.cpt.wayne.edu / DbD2 / index.php) for disulfide bond site prediction. Four pairs of disulfide bonds (S90C / G118C, S94C / E119C, N95C / Y120C, G126C / A144C) were found to be associated with the Cord region of mutant T41W / E119C. Therefore, these four pairs of disulfide bonds were integrated into mutant T41W / E119C. Using the mutant T41W / E119C as a template, four combinatorial mutants containing disulfide bonds were constructed using site-directed mutagenesis: DSM1, DSM2, DSM3, and DSM4, with the following characteristics:

[0057] DSM1: Threonine at position 41 is mutated to tryptophan (DNA sequence changes from ACG to TGG), glutamic acid at position 119 is mutated to cysteine ​​(DNA sequence changes from GAG to TGT), serine at position 90 is mutated to cysteine ​​(DNA sequence changes from AGC to TGT), and glycine at position 118 is mutated to cysteine ​​(DNA sequence changes from GGC to TGT).

[0058] DSM2: Threonine at position 41 is mutated to tryptophan (DNA sequence changes from ACG to TGG), glutamic acid at position 119 is mutated to cysteine ​​(DNA sequence changes from GAG to TGT), and serine at position 94 is mutated to cysteine ​​(DNA sequence changes from AGC to TGT).

[0059] DSM3: Threonine at position 41 is mutated to tryptophan (DNA sequence changes from ACG to TGG), glutamic acid at position 119 is mutated to cysteine ​​(DNA sequence changes from GAG to TGT), asparagine at position 95 is mutated to cysteine ​​(DNA sequence changes from AAC to TGT), and tyrosine at position 120 is mutated to cysteine ​​(DNA sequence changes from TAT to TGT).

[0060] DSM4: Threonine at position 41 is mutated to tryptophan (DNA sequence changes from ACG to TGG), glutamic acid at position 119 is mutated to cysteine ​​(DNA sequence changes from GAG to TGT), glycine at position 126 is mutated to cysteine ​​(DNA sequence changes from GGC to GGC), and alanine at position 144 is mutated to cysteine ​​(DNA sequence changes from GCT to TGT).

[0061] Crude enzyme solutions of four combined mutants (DSM1, DSM2, DSM3, and DSM4) were incubated at 55°C for 30 min to screen for mutants with further improved thermostability. The residual activity of mutant DSM4 was 64.6% higher than that of the parental T41W / E119C. Under the same heat treatment conditions, the residual enzyme activities of mutants DSM1, DSM2, and DSM3 were not significantly higher than those of T41W / E119C. Figure 5 ).

[0062] The enzymatic properties of the purified DSM4 mutant enzyme were determined as follows:

[0063] The optimal temperature for mutant DSM4 was 65℃, which was 5℃ higher than that of the parental T41W / E119C. The thermostability of mutant DSM4 at 45℃, 50℃, and 55℃ was determined. After heat treatment at 50℃ for 1 h, the enzyme activity of DSM4 showed no significant change, while the parental T41W / E119C retained only 50.9% of its enzyme activity. The half-life (t) of mutant DSM4 at 50℃ and 55℃ was also determined. 1 / 2 The time limits were 693.7 min and 108.5 min, respectively, representing increases of 12.2-fold and 9.1-fold compared to the parental T41W / E119C. After heat treatment at 60℃ for 40 min, the parental T41W / E119C was completely inactivated, while the mutant DSM4 (its nucleotide sequence is shown in SEQ ID No. 7, and its amino acid sequence is shown in SEQ ID No. 8) retained 40.1% of its enzyme activity. Figure 6 ).

[0064] Through site screening and combined mutations as described in (1), (2), (3), and (4) above, the thermostability of the mutant DSM4 was significantly improved compared to the wild type. The optimum temperature of DSM4 was increased by 20℃ compared to the wild type XynASP. Compared to the wild type XynASP, the half-life (t) of mutant DSM4 at 50℃ and 55℃ was significantly increased. 1 / 2 The specific activity of the pure enzyme DSM4 was increased by 130.9 times and 25.2 times, respectively (Table 1). The catalytic activity of wild-type XynASP and mutant DSM4 for beech xylan was determined at their respective optimal temperatures. The specific activity of pure enzyme DSM4 was 282.0 U / mg, which was 5.5 times higher than that of wild-type XynASP (51.0 U / mg). The catalytic efficiency (kJ) of pure enzyme DSM4 was... cat / K m The value was 596.0 mL·mg. -1 s -1 Compared with wild-type XynASP (63.8 mL·mg) -1 s -1 Compared to the previous year, it increased by 9.3 times (Table 2).

[0065] Table 2 Enzyme kinetic parameters and specific enzyme activities of xylanase XynASP and its mutants.

[0066]

[0067] Application Example 1: Construction of 9 single-point mutants

[0068] Single-point mutants Y117W, A125G, E119A, E119C, S124A, S124L, S124M, S124W, and G126A were constructed using the gene SEQ ID NO.1 with optimized codons for xylanase XynASP as a template. The primers used are shown in Table 3.

[0069] Table 3

[0070]

[0071]

[0072] PCR conditions were as follows: 10 μL of 2×PhantaMax Buffer, 1 μL of dNTP Mix (10 mM each), 2 μL of primers (10 mM each), 1 μL of PhantaMax Super-Fidelity DNA Polymerase, 20 ng of plasmid, and 50 μL of ultrapure water. The conditions were: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 16 s, 58℃ annealing for 15 s, and 72℃ extension for 4 min, for a total of 30 cycles, followed by a final extension at 72℃ for 10 min. The PCR product was treated with 1 μL of DpnI at 37℃ for 3 h. 10 μL of the DpnI-digested PCR product was chemically transformed into *E. coli* DH5α. The product was sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. After successful sequencing, the plasmid was extracted and transformed into the expression strain *E. coli* BL21(DE3).

[0073] Application Example 2: Preparation of Crude Enzyme Solution and Determination of Enzyme Activity

[0074] 2.1 Preparation of crude enzyme solution

[0075] The mutant plasmids from Application Example 1 were chemically transformed into E. coli expression strain BL21(DE3), plated on LB agar plates containing kanamycin (50 μg / mL), and incubated at 37°C for 16 h. Single colonies were picked and cultured in 2 mL of LB liquid medium containing kanamycin (50 μg / mL) at 37°C and 180 rpm for 16 h. A 1% inoculum was inoculated into 100 mL of TB medium containing kanamycin (50 μg / mL) and incubated at 37°C for 2.5 h. 2 mM IPTG was added, and the culture was induced at 30°C for 2 h. The cells were centrifuged at 8000 rpm and 4°C for 10 min, the supernatant was discarded, and 10 mL of citrate-disodium hydrogen phosphate buffer (50 mM, pH 6.0) was added. The cells were mixed, and the cells were sonicated (working conditions: working time 4 s, interval 4 s, number of cycles 40, power 200 W). The cells were centrifuged at 12000 rpm and 4°C for 20 min, and the supernatant crude enzyme solution was used for the reaction.

[0076] 2.2 Determination of xylanase activity

[0077] Take 1.5 mL of 0.5% beechwood xylan and 1 mL of appropriately diluted enzyme solution, react at a suitable temperature for 15 min, add 2.5 mL of DNS to terminate the reaction, and boil in a water bath for 7 min; after cooling, add 5 mL of ddH2O, shake to mix, and measure the absorbance at 540 nm. The xylanase activity unit (U) is defined as: the amount of enzyme required to hydrolyze xylan to produce 1 μmol of xylose per minute under the above activity measurement conditions.

[0078] 2.3 Screening method for thermal stability of single-point mutants

[0079] 500 μL of the crude enzyme solution of the single-point mutant was placed in a 1.5 mL centrifuge tube and heat-treated at 40 °C for 30 min. The sample was then quickly placed on ice to cool. The residual activity of the heat-treated crude enzyme solution was measured at 45 °C, following the procedure in Example 2.2. The residual relative enzyme activity was then obtained using the untreated crude enzyme solution as a reference.

[0080] 2.4 Purification methods for wild-type and single-point mutant proteins

[0081] Following the procedure in Application Example 2.1, the supernatant crude enzyme solution was obtained. The crude enzyme solutions of wild-type and mutant strains were purified using nickel affinity chromatography. Xylanase was eluted with elution buffer (20 mM Tris-HCl, pH 8.0, 500 mM sodium chloride, and 300 mM imidazole). Desalting was performed using a Superdex G25 column in citrate-disodium hydrogen phosphate buffer (50 mM, pH 6.0). Protein purity was assessed using SDS-PAGE, and protein concentration was determined using a BCA protein assay kit (Sangon Biotech, Shanghai, China).

[0082] 2.5 Optimal Temperature and Thermal Stability Determination Methods for Mutant Pure Enzymes

[0083] Referring to the enzyme activity assay method for xylanase in Application Example 2.2, the enzyme activities of wild-type XynASP and mutants (E119A, E119C, and S124A) were measured at 35℃-60℃. The highest enzyme activity was taken as 100%, and the relative enzyme activity at each temperature was calculated. Wild-type XynASP and mutants (E119A, E119C, and S124A) were incubated at 40℃, 45℃, and 50℃ for 1 h, respectively. Samples were taken every 10 min, and the residual enzyme activity was measured at their respective optimum temperatures. The enzyme activity of the unincubated enzyme was taken as 100%, and the residual enzyme activity at different incubation times was calculated.

[0084] This round of screening yielded three mutants with improved thermal stability: E119A, E119C, and S124A. The thermal stability results for wild-type and mutants are shown below. Figure 3 and 4 .

[0085] Application Example 3: Construction of the combinatorial mutant T41W / E119C

[0086] 3.1 Construction of mutant T41W / E119C

[0087] The site-directed mutagenesis method mutated threonine at position 41 of mutant E119C to tryptophan, constructing mutant T41W / E119C. The primers used are shown in Table 4.

[0088] Table 4

[0089] Primer name Sequence (5'-3') T41W-F <![CDATA[ACTACTCCTTCTGG TGG GATGGTGCAAGCGGA]]> T41W-R <![CDATA[TCCGCTTGCACCATC CCA CCAGAGGAGGTAGTA]]>

[0090] The PCR conditions and procedures were the same as in Application Example 1, and the combined mutant T41W / E119C was obtained.

[0091] 3.2 Purification method for the combined mutant T41W / E119C protein

[0092] Protein purification and protein concentration determination were performed according to the method in Application Example 2.4.

[0093] 3.3 Determination of the optimal temperature and thermal stability of the combined mutant T41W / E119C

[0094] The enzyme activity of the purified enzyme from the hybrid mutant T41W / E119C was determined at temperatures ranging from 45℃ to 70℃. The highest enzyme activity was taken as 100%, and the relative enzyme activity at each temperature was calculated. The hybrid mutant T41W / E119C was incubated at 45℃, 50℃, 55℃, and 60℃ for 1 hour, with samples taken every 10 minutes. Residual activity was measured at the optimal temperature for each incubation period. The enzyme activity of the unincubated enzyme was taken as 100%, and the residual enzyme activity at different incubation times was calculated.

[0095] The optimal temperature and thermal stability data for the combined mutant T41W / E119C are shown in [reference needed]. Figure 6 See Table 1.

[0096] Application Example 4: Constructing Combinatorial Mutants Containing Disulfide Bonds

[0097] 4.1 Construction of mutant DSM1

[0098] The site-directed mutagenesis method was used to mutate serine at position 90 to cysteine ​​and glycine at position 118 to cysteine ​​to construct the mutant DSM1. The primers used are shown in Table 5.

[0099] Table 5

[0100] Primer name Sequence (5'-3') S90C-F <![CDATA[TCCGGCTCGTGGACC TGT ACCGACAACAGCAAC<!-- 8 --> ]]> S90C-R <![CDATA[GTTGCTGTTGTCGGT ACA GGTCCACGAGCCGGA]]> G118C-F <![CDATA[ATTCTGGAGGACTGT TGT GAGTATAATCCGGGC]]> G118A-R <![CDATA[GCCCGGATTATACTC ACA ACAGTCCTCCAGAAT]]>

[0101] The PCR conditions and procedures were the same as in Application Example 1, and the combined mutant DSM1 was obtained.

[0102] 4.2 Construction of the DSM2 mutant

[0103] The site-directed mutagenesis method mutated serine at position 94 of T41W / E119C to cysteine ​​to construct the mutant DSM2. The primers used are shown in Table 6.

[0104] Table 6

[0105] Primer name Sequence (5'-3') S94C-F <![CDATA[ACCAGCACCGACAAC TGT AACAGCTACCTCTCC]]> S94C-R <![CDATA[GGAGAGGTAGCTGTT ACA GTTGTCGGTGCTGGT]]>

[0106] The PCR conditions and procedures were the same as in Example 1, and the combined mutant DSM2 was obtained.

[0107] 4.3 Construction of mutant DSM3

[0108] The site-directed mutagenesis method was used to mutate glutamine at position 95 to cysteine ​​and tyrosine at position 120 to cysteine ​​to construct the mutant DSM3. The primers used are shown in Table 7.

[0109] Table 7

[0110] Primer name Sequence (5'-3') N95C-F AGCACCGACAACAGCTGTAGCTACCTCTCCGTC N95C-R GACGGAGAGGTAGCTACAGCTGTTGTCGGTGCT Y120C-F GAGGACTATGGCTGTTGTAATCCGGGCTCGGCT Y120C-R AGCCGAGCCCGGATTACAACAGCCATAGTCCTC

[0111] The PCR conditions and procedures were the same as in Application Example 1, and the combined mutant DSM3 was obtained.

[0112] 4.4 Construction of the DSM4 mutant

[0113] The site-directed mutagenesis method was used to mutate glycine at position 126 to cysteine ​​and alanine at position 144 to cysteine ​​in T41W / E119C to construct the mutant DSM4. The primers used are shown in Table 8.

[0114] Table 8

[0115] Primer name Sequence (5'-3') G126C-F <![CDATA[AATCCGGGCTCGGCT TGC ACCTACAAGGGAAGC]]> G126C-R <![CDATA[GCTTCCCTTGTAGGT GCA AGCCGAGCCCGGATT]]> T144C-F <![CDATA[TACGATATCTACACC TGT ACCCGCACCAATGCT]]> T144C-R <![CDATA[AGCATTGGTGCGGGT ACA GGTGTAGATATCGTA]]>

[0116] The PCR conditions and procedures were the same as in Application Example 1, and the combined mutant DSM4 was obtained.

[0117] 4.5 Screening Methods for Thermal Stability of Combined Mutants

[0118] 500 μL of crude enzyme solution from the combined mutants (DSM1, DSM2, DSM3, and DSM4) was placed in a 1.5 mL centrifuge tube and heat-treated at 50 °C for 30 min. The sample was then rapidly cooled on ice. The residual activity of the heat-treated crude enzyme solution was measured at 60 °C, following the procedure in Example 2.2. The residual relative enzyme activity was then obtained using the untreated crude enzyme solution as a reference.

[0119] 4.6 Protein purification method for mutant DSM4

[0120] Protein purification and protein concentration determination were performed according to the method in Application Example 2.4.

[0121] 4.7 Determination of the optimal temperature and thermal stability of mutant DSM4

[0122] Protein purification and protein concentration determination were performed according to the method in Application Example 3.3.

[0123] 4.8 Determination of specific enzyme activities and enzyme kinetic parameters between wild-type and mutant DSM4

[0124] Specific enzyme activity assay: Referring to the enzyme activity assay method for xylanase in Application Example 2.2, the specific enzyme activity of each pure enzyme was determined at their respective optimal temperatures for wild type (enzyme concentration of 0.96 U / mg) and mutant DSM4 (enzyme concentration of 0.78 U / mg).

[0125] Enzyme kinetic parameter determination: Beech xylan solutions with different substrate concentrations (0.1–0.8 mg / mL) were prepared. Following the enzyme activity determination method for xylanase in Application Example 2.2, the specific enzyme activities of wild-type (0.96 U / mg) and mutant DSM4 (0.78 U / mg) were determined under optimal conditions for each enzyme. V0 was calculated using PraphPadPrism 8.0 software. max and K m Value, and then based on k cat =V max Using the / E formula, calculate the k value for each enzyme. cat value.

[0126] The thermal stability screening results for disulfide bond mutants are shown in […]. Figure 5 The optimal temperature and thermal stability data for mutant DSM4 can be found in [link to relevant data]. Figure 6 See Table 1. The enzyme activity and enzyme kinetics data for wild-type and mutant DSM4 are shown in Table 2.

Claims

1. A xylanase mutant, characterized in that: The sequence shown in SEQ ID NO. 2 is used as a starting sequence, and glutamic acid at position 119 is mutated to cysteine, i.e. single-point mutant E119C, and the amino acid sequence is shown in SEQ ID NO.

4.

2. A xylanase combinatorial mutant, characterized in that: The threonine at position 41 of the E119C mutant of claim 1 is mutated to tryptophan, i.e. combination mutant T41W / E119C, and the amino acid sequence is shown in SEQ ID NO.

6.

3. A xylanase combinatorial mutant containing disulfide bonds, characterized in that: The glycine at position 126 of the combination mutant T41W / E119C of claim 2 is mutated to cysteine, and the alanine at position 144 is mutated to cysteine, i.e. mutant DSM4, and the amino acid sequence is shown in SEQ ID NO.

8.

4. A gene encoding a gene, characterized in that, The coding gene is the coding gene of the single-point mutant E119C of claim 1, and the nucleotide sequence is shown in SEQ ID No.

3.

5. A gene encoding a gene, characterized in that, The coding gene is the coding gene of the combination mutant T41W / E119C of claim 2, and the nucleotide sequence is shown in SEQ ID No.

5.

6. A gene encoding a polypeptide according to any one of claims 1 to 5. The coding gene is the coding gene of the mutant DSM4 of claim 3, and the nucleotide sequence is shown in SEQ ID No.

7.

7. A recombinant expression vector, characterized in that, It comprises the coding gene of any one of claims 4-6.

8. A recombinant engineered bacterium, characterized in that, It comprises the coding gene of any one of claims 4-6.

9. Use of the disulfide-containing xylanase combination mutant of claim 3 in catalysis of beechwood xylan.

Images