A β-1,4-endoxylanase derived from the metagenome of Asian elephant feces, its encoding gene and applications
By isolating and optimizing β-1,4-endoxylase from the Asian elephant feces metagenome, the problem of insufficient pH and temperature stability of existing enzymes is solved, and high activity and stability in a wide range is achieved, which is suitable for applications that improve the enzymatic effect of soybean meal.
Patent Information
- Application Number
- CN202411949007.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-27
- Publication Date
- 2025-06-17
- Estimated Expiration
- 2044-12-27
AI Technical Summary
The existing β-1,4-endoxylcanase has insufficient pH and temperature stability in industrial production, resulting in low activity and stability in applications and is difficult to meet industrial needs.
A new β-1,4-endoxylase was isolated from the Asian elephant feces metagenome, and optimized by genetic engineering technology to improve its stability in the range of 50-80°C and pH 5.0-9.0.
The β-1,4-endoxylcanase exhibits good stability and activity over a wide pH and temperature range, significantly improving the growth rate of enzymatic reducing sugars in soybean meal, and is suitable for pretreatment of feed raw materials.
Smart Images

Figure CN119752859B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of genetic engineering, and particularly relates to a β-1,4-endoxylanase derived from the metagenome of Asian elephant feces, its encoding gene, and applications thereof. Background Art
[0002] Xylan is the main component of hemicellulose, the second largest renewable resource on earth, and is also the most abundant polysaccharide except cellulose. In the current era of energy shortage and serious pollution, it is urgent to rationally utilize renewable resources. Therefore, the full utilization of xylan has attracted much attention. However, the chemical structure of xylan is complex, and the degradation of xylan requires a complex set of hydrolases, among which the most important one is β-1,4-endoxylanase (β-1,4-D-xylanohydrolase: EC3.1.2.8).
[0003] β-1,4-endoxylanase is one of the most important enzymes in the hydrolysis process of xylan. It mainly acts on the glycosidic bond of β-1,4-D-xyloside bond, and the hydrolysis products are xylose, xylobiose, and xylooligosaccharides above. The existing xylanases have a molecular mass of about 8-145 kD, an optimal pH of 4.0-6.5, and an optimal temperature of 40-60°C. Most of the β-1,4-endoxylanases derived from wild strains of fungi such as Trichoderma and Aspergillus have low enzyme activities, and the protein subunits of xylanases from fungi are more complex than those from bacteria, and their thermal stability is worse than that of bacterial xylanases. Therefore, most of the currently industrialized xylanases are derived from bacteria. At present, the exploration of bacterial β-1,4-endoxylanase gene resources is limited, and there is a need to further explore β-1,4-endoxylanases with high activity and high stability.
[0004] With the development of sequencing technology and the combination of metagenomics analysis methods, in the exploration of microbial functional enzyme genes, it is possible to successfully avoid the problems of traditional microbial pure culture technology, and a large number of functional enzyme genes can be discovered quickly in a short time, improving the breadth and effectiveness of functional enzyme gene screening, greatly promoting the improvement of functional enzyme gene cloning efficiency, and providing a new research strategy for the search and discovery of new β-1,4-endoxylanase genes. Summary of the Invention
[0005] The object of the present invention is to provide a β-1,4-endoxylanase with better pH stability and temperature stability to fill the deficiencies of existing β-1,4-endoxylanases in industrial production.
[0006] To achieve the above object, the present invention provides a β-1,4-endoxylanase derived from the metagenome of Asian elephant feces, and the amino acid sequence of the β-1,4-endoxylanase is as shown in SEQ ID NO.4.
[0007] The β-1,4-endoxylanase provided by the present invention can be used in any of the following, including increasing the growth rate of in vitro enzymolysis reducing sugar in soybean meal, and the enzymolyzed soybean meal is used for preparing soybean meal feed.
[0008] The present invention also provides a coding gene for the above β-1,4-endoxylanase, and the nucleotide sequence of the coding gene is as shown in SEQ ID NO.3.
[0009] The present invention also provides a primer for identifying the above coding gene, and the nucleotide sequence of the primer is as shown in SEQ ID NO.1 and SEQ ID NO.2
[0010] The present invention also provides a recombinant plasmid containing the above coding gene, and the recombinant plasmid is selected from prokaryotic plasmids.
[0011] Preferably, the above prokaryotic plasmid is selected from the pBE-S plasmid.
[0012] The present invention also provides a recombinant bacterium capable of expressing the above β-1,4-endoxylanase.
[0013] Preferably, the above recombinant bacterium is selected from Bacillus subtilis WB600.
[0014] The present invention also provides a preparation method for the above β-1,4-endoxylanase, comprising:
[0015] Fermenting and culturing the above recombinant bacterium, centrifuging and collecting the supernatant to obtain β-1,4-endoxylanase.
[0016] The present invention has the following advantages:
[0017] In the present invention, a bacterial genome of the genus Prevotella is assembled by metagenomic binning technology, with a genome integrity of 97.47% and a contamination rate of 0. A new β-1,4-endoxylanase gene is annotated through the KEGG Enzyme database, and the bacterial β-1,4-endoxylanase Xyneleph is prepared by genetic engineering technology. Compared with the xylanase derived from fungi, the β-1,4-endoxylanase Xyneleph has good stability at 50-80 °C and within the pH range of 5.0-9.0, and its pH stability and temperature stability are better.
[0018] The β-1,4-endoxylanase derived from the metagenome of Asian elephant feces provided by the present invention can effectively fill the problems of the existing β-1,4-endoxylanase, especially its poor tolerance to conditions such as pH and temperature, and has a good degradation effect on soybean meal, and has practical value in the preparation of feed, especially in the pretreatment of feed raw materials. Description of the Drawings
[0019] Figure 1 This is the electrophoresis result for the PCR amplification verification of the β-1,4-endoxylanase encoding gene in the present invention.
[0020] Figure 2 This is the SDS-PAGE gel electrophoresis result of the protein of β-1,4-endoxylanase in the present invention.
[0021] Figure 3 This is the curve of the enzyme activity of β-1,4-endoxylanase in the present invention affected by pH.
[0022] Figure 4 This is the curve of the enzyme activity of β-1,4-endoxylanase in the present invention affected by temperature. Detailed implementation manners
[0023] Next, the technical solutions in the embodiments of the present invention will be described clearly and completely. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all of the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0024] Note: The experimental methods in the following embodiments are all conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.
[0025] The original data of the Asian elephant intestinal metagenomic sequencing used in the present invention has been deposited in the Genome Sequence Archive of the Big Data Center of the Chinese Academy of Sciences, and the accession number is CRA003369.
[0026] Example 1 Obtaining of the β-1,4-endoxylanase encoding gene from the Asian elephant fecal metagenome
[0027] 1. According to the fresh Asian elephant fecal samples stored in this laboratory, the metagenomic DNA was extracted using a kit (QIAamp DNA Stool Mini Kit). The extraction steps of the fresh Asian elephant fecal metagenomic DNA are as follows:
[0028] 1) Weigh about 0.2 g of Asian elephant feces into a sterilized centrifuge tube;
[0029] 2) Add 1.4 mL of buffer ASL, vortex continuously for several minutes until fully mixed, incubate at 70 °C for 5 min, and then vortex and mix for 15 s;
[0030] 3) Centrifuge at 20,000 g for 1 min to remove fecal impurities, and take the supernatant to a new centrifuge tube;
[0031] 4) Immediately mix well for about 1 min after adding 1 inhibitEX Tablet, then let it stand at room temperature for 1 min to allow the inhibitor to adsorb onto the inhibitEX matrix, and centrifuge at 20,000 g for 3 min;
[0032] 5) Transfer the supernatant to a new centrifuge tube and centrifuge again as in 4);
[0033] 6) Pipette the supernatant into a new centrifuge tube containing 15 μL of proteinase K, add 200 μL of buffer AL, mix well, and incubate at 70 °C for 10 min;
[0034] 7) Add 200 μL of absolute ethanol, mix well, and transfer to a QIAamp adsorption column, then centrifuge at 20,000 g for 1 min (if not all the liquid passes through the column, centrifuge again);
[0035] 8) Wash the column successively with 500 μL of buffer AW1 and AW2, centrifuge for 3 min as in 7), and then transfer the column to a new collection tube;
[0036] 9) Add an appropriate amount of buffer AE to the center of the adsorption column, let it stand at room temperature for 1 min, and then centrifuge for 1 min as above for elution. The obtained metagenomic DNA can be used for downstream molecular biology experiments or stored at -20 °C for later use.
[0037] 2. Through the binning assembly technology of metagenomics analysis, a genome of a bacterium belonging to the genus Prevotella was obtained (completeness: 97.47%, contamination rate: 0). After annotation in the KEGG Enzyme database, it was found to contain a β-1,4-endoxylanase gene (EC 3.2.1.8). After blasting in the NR database, the results showed that the highest amino acid identity with the β-1,4-endoxylanase in the NR database was approximately 69.01%. Analyze the conserved sequence of this β-1,4-endoxylanase and design amplification primers for the β-1,4-endoxylanase-encoding gene. The specific sequences are as follows:
[0038] Forward primer P1 (SEQ ID NO.1):
[0039] CAATTCATGCTAAATTATATCCTTTGG,
[0040] Reverse primer P2 (SEQ ID NO.2):
[0041] TCTAGATTATTGCTTGTATTTCTTCAC.
[0042] The upstream and downstream primers P1 and P2 were used to amplify the β-1,4-endoxylanase gene, and the restriction enzyme sites EcoRI and XbaI were introduced into the upstream and downstream primers, respectively.
[0043] The amplification template was the Asian elephant intestinal metagenomic DNA. The PCR amplification reaction system was as follows: 1.25 μL of EX Taq, 10 μL of 10X Buffer, 5 μL of dNTP mix, 2.5 μL each of P1 and P2, 5 μL of DNA, 73.75 μL of ddH2O, with a total volume of 100 μL.
[0044] The amplification reaction conditions were: 94 °C for 5 min; 94 °C for 30 s; 55 - 61 °C for 30 s; 72 °C for 1 min (30 cycles); 72 °C for 10 min; 4 °C for 10 min.
[0045] The PCR products were verified by 0.8% agarose gel electrophoresis, and a 1659 bp band was obtained. The electrophoresis results were as Figure 1 shown. Lane 1 was the DNA marker, and lane 2 was the PCR amplification product. After the PCR products were recovered from the gel, they were digested with two enzymes and purified and recovered to obtain the β-1,4-endoxylanase-encoding gene Xyneleph from the genus Prevotella in the Asian elephant intestinal metagenome of the present invention. Its nucleotide sequence was as shown in SEQ ID NO.3, and thus the amino acid sequence of the β-1,4-endoxylanase was as shown in SEQ ID NO.4.
[0046] Example 2 Preparation of β-1,4-endoxylanase
[0047] 1. Construction of the β-1,4-endoxylanase recombinant plasmid
[0048] 1) The expression plasmid pBE-S was digested with the restriction endonucleases EcoRI and XbaI. Then, the purified product after digestion of the pBE-S plasmid and the purified product after digestion of the target gene were ligated overnight at 16 °C using T4 ligase. The ligation product was chemically transformed into E. coli DH5α.
[0049] 2) After being identified correctly by colony PCR, double digestion, and sequencing, the recombinant plasmid pBE-S-Xyneleph was obtained;
[0050] 3) The cloning strain E. coli DH5α / pBE-S-Xyneleph of the verified recombinant plasmid pBE-S-Xyneleph was added with 15% glycerol and stored at -80 °C.
[0051] 2. Construction of the β-1,4-endoxylanase recombinant bacteria
[0052] 1) Add 1 μL (50 ng / μL) of the pBE-S-Xyneleph recombinant plasmid to the competent cells of Bacillus subtilis WB600, and gently mix well.
[0053] 2) After mixing, transfer it to a pre-chilled electroporation cuvette. After ice-bathing for 1 - 1.5 min, perform electroporation once (3.0 kV, 3.0 - 4.5 ms). Immediately after electroporation, add 1 mL of recovery medium (LB + 0.5 mol / L sorbitol + 0.38 mol / L mannitol).
[0054] 3) After shaking culture at 37°C for 3 h, spread the bacterial solution on an LB plate containing Kan resistance, and culture at 37°C for about 16 h.
[0055] 4) Pick positive transformants and perform double digestion verification to confirm the acquisition of the recombinant strain Bacillus subtilis WB600 / pBE-S-Xyneleph expressing Xyneleph.
[0056] 3. Expression and preparation of β-1,4-endoxylanase
[0057] 1) Pick a single colony of the recombinant strain Bacillus subtilis WB600 / pBE-S-Xyneleph and inoculate it into an LB liquid medium containing kanamycin, and culture it overnight with shaking at 37°C.
[0058] 2) Inoculate the seed culture obtained in step 1) into 50 mL of LB liquid medium at a ratio of 2%, and culture it with shaking at 37°C for about 48 h.
[0059] 3) Centrifuge the fermentation broth obtained in step 2), collect the supernatant, and thus obtain a crude enzyme solution of highly stable β-1,4-endoxylanase. Perform SDS-PAGE electrophoresis on the crude enzyme solution, and the results are shown in Figure 2 as follows. Among them, Figure 2 lane 1 in
[0060] is the protein ladder, lane 2 is the sample of the fermentation broth after fermentation, lane 3 is the sample of the precipitate of the fermentation broth after centrifugation, and lane 4 is the sample of the supernatant of the fermentation broth after centrifugation;
[0061] Example 3 Determination of the enzyme activity of β-1,4-endoxylanase
[0062] The method for determining enzyme activity is the DNS reagent method. The determination of enzyme activity is carried out in three parallel experiments, and the results are averaged.
[0063] Enzyme activity unit (U): The amount of enzyme required to release 1 μmol of reducing sugar per minute.
[0064] Optimal pH of the enzyme: At 50 °C, the reaction system is placed in buffer solutions with different pH values (2.5 - 10.5, measured every 0.5 °C, see Figure 3 ) for measuring enzyme activity. Taking the highest enzyme activity as 100%, a pH - relative enzyme activity curve is plotted.
[0065] Optimal temperature: Under the condition of the optimal reaction pH, an appropriate dilution of the enzyme solution is taken for enzymatic hydrolysis reaction in a water bath at 30 - 100 °C. Enzyme activity is measured every 10 °C. Taking the highest enzyme activity as 100%, a temperature - relative enzyme activity curve is plotted.
[0066] pH stability: The enzyme solution is placed in buffer solutions with different pH values and incubated at 50 °C for 5 h. Taking the highest enzyme activity as 100%, its remaining enzyme activity is measured.
[0067] Thermal stability determination: Under the condition of the optimal reaction pH, the enzyme solution is incubated at different temperature gradients (30 - 100 °C) for 2 h. Taking the highest enzyme activity as 100%, the remaining enzyme activity of Xyneleph is measured.
[0068] The enzymatic properties of β - 1,4 - endoxylanase are determined by the above - mentioned method. When using beechwood xylan as the substrate to determine the enzymatic properties of β - 1,4 - endoxylanase, the optimal pH of this enzyme is 6.5, see Figure 3 , and the optimal temperature is 60 °C, see Figure 4 .
[0069] When using beechwood xylan as the substrate to determine the pH stability and thermal stability of this β - 1,4 - endoxylanase, the results show that: this bacterial β - 1,4 - endoxylanase has good stability at 50 - 80 °C and within the range of pH = 5 - 9. Taking the enzyme activity at 60 °C as the standard, the relative enzyme activity is higher than 90% within the range of 50 - 80 °C. As the temperature increases, the enzyme activity gradually decreases. When the temperature reaches 100 °C, the relative enzyme activity is only about 25%. When the pH of this enzyme is within the range of 5 - 9, the relative enzyme activity is relatively stable, maintaining above 95%. When pH > 9, the enzyme activity decreases rapidly. When pH reaches 10, the relative enzyme activity drops to 20%.
[0070] Application Example 1 Degradation of feed raw material soybean meal by β - 1,4 - endoxylanase Xyneleph
[0071] This application example aims to determine the degradation effect of this enzyme on soybean meal, specifically as follows:
[0072] The experimental feed raw material substrate was soybean meal, which was dried, crushed, and passed through a 24-mesh sieve. Two treatments were designed in the experiment: a control group (without enzyme) and an enzyme-added group.
[0073] Control group: Weigh 10 g of the substrate feed, according to a feed-water ratio of 1:10 (the water is 0.1 mol / L acetic acid-sodium acetate buffer solution with pH = 6.5), and then mix it with the enzyme. After the enzymatic hydrolysis starts, shake it once every 1 h at 120 r / min. After the enzymatic hydrolysis ends, add 5 mL of 10% trichloroacetic acid solution, take an appropriate amount of the enzymatic hydrolysis sample, centrifuge it at 4000 r / min for 10 min, collect the supernatant for testing.
[0074] Enzyme-added group: Weigh 10 g of the substrate feed, and finally add β-1,4-endoxylanase Xyneleph: 10 U / g of raw material; according to a feed-water ratio of 1:10 (the water is 0.1 mol / L acetic acid-sodium acetate buffer solution with pH = 6.5). The enzymatic hydrolysis temperature is 60 °C, and the total enzymatic hydrolysis time is 5 h. After the enzymatic hydrolysis starts, shake it once every 1 h at a speed of 120 r / min for 10 min each time. After the enzymatic hydrolysis ends, add 5 mL of 10% trichloroacetic acid solution, take an appropriate amount of the enzymatic hydrolysis sample, centrifuge it at 4000 r / min for 10 min, collect the supernatant for testing.
[0075] The soluble reducing sugar content of the enzymatically hydrolyzed sample was measured by the DNS method. Absorb an appropriate amount of the sample solution, place it in a 25-mL volumetric flask, make up the water to 2 mL, then add 1.5 mL of 3,5-dinitrosalicylic acid solution, develop color in boiling water for 5 min, then quickly cool it with running water, and make up the volume to 20 mL with water, shake well. Zero with distilled water, colorimetric at 540 nm, and calculate the content of reducing sugar with reference to the glucose standard curve.
[0076] Among them, the growth rate of reducing sugar (%) = (enzyme-added group - control group) / control group × 100%
[0077] The in vitro enzymatic hydrolysis reducing sugar growth rate of this β-1,4-endoxylanase Xyneleph on soybean meal was 54.5%.
[0078] In summary, the present invention provides a β-1,4-endoxylanase derived from the fecal metagenome of Asian elephants, provides its amino acid sequence and coding gene sequence, and at the same time, also provides an efficient preparation method of this enzyme. The prepared β-1,4-endoxylanase has an efficient enzymatic hydrolysis treatment effect on soybean meal, can significantly improve the in vitro enzymatic hydrolysis reducing sugar growth rate of soybean meal, is beneficial to the pretreatment of soybean meal raw materials, and has application value for preparing feed with soybean meal.
[0079] Although the content of the present invention has been described in detail through the above preferred embodiments, it should be recognized that the above description should not be construed as a limitation of the present invention. After those skilled in the art have read the above content, various modifications and alternatives to the present invention will be obvious. Therefore, the protection scope of the present invention shall be defined by the appended claims.
Claims
1. A β-1,4-endo-xylanase derived from the Asian elephant feces metagenome, characterized in that: The amino acid sequence of the β-1,4-endo-xylanase is shown in SEQ ID NO.
4.
2. The use of the β-1,4-endo-xylanase according to claim 1 in any of the following items, comprising increasing the growth rate of reducing sugars in soybean meal by enzymatic hydrolysis in vitro; Enzymatic hydrolysis of soybean meal is used to prepare soybean meal feed.
3. The gene encoding β-1,4-endo-xylanase according to claim 1, characterized in that The nucleotide sequence of the coding gene is shown in SEQ ID NO.
3.
4. A primer for identifying a gene encoding a gene as claimed in claim 3, characterized in that: The nucleotide sequences of the primers are shown in SEQ ID NO.1 and SEQ ID NO.
2.
5. A recombinant plasmid comprising the coding gene as claimed in claim 3.
6. The recombinant plasmid according to claim 5, characterized in that The recombinant plasmid is selected from prokaryotic plasmids.
7. The recombinant plasmid according to claim 6, characterized in that The prokaryotic plasmid is selected from pBE-S plasmid.
8. A recombinant bacterium capable of expressing the β-1,4-endo-xylanase according to claim 1.
9. The recombinant bacterium according to claim 8, characterized in that The recombinant bacteria is selected from Bacillus subtilis WB600.
10. The method for preparing β-1,4-endo-xylanase according to claim 1, characterized in that: Include: The recombinant bacteria in claim 8 or 9 are fermented and cultured, and the supernatant is collected after centrifugation to obtain the β-1,4-endo-xylanase.
Citation Information
Patent Citations
Xylanase for biobleaching
CA2048322A1
Xylanases, nucleic adics encoding them and methods for making and using them
CN101967490A