Application of a 5'UTR sequence and a 3'UTR combination

Abstract

The present invention belongs to the field of biotechnology and medicine, and is particularly related to the application of a 5'UTR sequence and a 3'UTR combination. First, the applicant designed a 5'UTR library by the mRNA 5'UTR optimization principle, analyzed and compared the different 5'UTR translation efficiencies in the library, and found that 5UTR05 had the best effect; and based on 5UTR05, a variety of 3'UTRs of highly expressed proteins and dendritic cell proteins in plasma were combined, and it was found that 5UTR05 had the highest reporter gene expression when combined with the 3'UTR of Tropomyosin2 (TPM2) and IGHG2. Subsequently, by adopting the screening strategy of double 3'UTR combination, the UTR combination of mRNA-11 and mRNA-12 showed an expression efficiency better than the positive control, improved the translation efficiency of in vitro mRNA, and can be used for mRNA-related treatment.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and medicine, and specifically relates to an application of a 5'UTR sequence and a 3'UTR combination. Background Art

[0002] mRNA is an unstable intermediate in the process of protein synthesis, which can transfer genetic information from genes to ribosomes. In recent years, with the continuous progress of molecular medicine and biotechnology, mRNA has shown great potential in medical treatment and prevention. Because mRNA does not need to enter the cell nucleus and can be translated into protein in the cytoplasm, it has a higher transcription efficiency than DNA. At the same time, this makes mRNA safer, will not be integrated into the genome, and almost no opportunistic insertion mutations will occur. Compared with traditional therapeutic proteins and peptides, the in vitro synthesis of mRNA is simple, the cost is lower, and therapeutic proteins can be expressed continuously. Therefore, mRNA is widely used in clinical treatment.

[0003] In past research and exploration, many mRNA-related technologies and problems have been effectively developed and solved. For example, with the development of liposome nanoparticle delivery systems, the problem of mRNA and anionic cell membrane charges repelling each other and making it difficult to pass through the cell barrier has been effectively solved; the immunogenicity of mRNA has been greatly improved through nucleoside modification technology. However, mRNA instability and low translation efficiency are still obstacles to the development of mRNA therapy.

[0004] 5'UTR and 3'UTR are located on both sides of the open reading region of mRNA and do not directly encode proteins. Their sequence, length, and secondary structure play a key role in pre-mRNA processing, translation initiation, mRNA stability, and translation efficiency. Therefore, 5'UTR and 3'UTR optimization is a potential method to improve mRNA stability and translation efficiency. However, finding effective 5'UTR and 3'UTR sequences and combinations is the key to improving mRNA translation efficiency. Summary of the invention

[0005] The first aspect of the present invention aims to provide a 5'UTR sequence.

[0006] The second aspect of the present invention aims to provide a 3'UTR sequence.

[0007] The third aspect of the present invention aims to provide a combination of a 5'UTR sequence and a 3'UTR sequence.

[0008] The fourth aspect of the present invention aims to provide an mRNA molecule.

[0009] The fifth aspect of the present invention is to provide an expression cassette.

[0010] The sixth aspect of the present invention aims to provide a recombinant vector.

[0011] The seventh aspect of the present invention aims to provide a recombinant cell.

[0012] The purpose of the eighth aspect of the present invention is to provide a method for producing the mRNA molecule described in the fifth aspect of the present invention.

[0013] The ninth aspect of the present invention aims to provide a medicine.

[0014] The tenth aspect of the present invention aims to provide an application.

[0015] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0016] In a first aspect of the present invention, a 5'UTR sequence is provided. The 5'UTR sequence is shown in any one of SEQ ID NOs. 1-8.

[0017] Preferably, the 5'UTR sequence is shown as SEQ ID NO.5.

[0018] Preferably, the 5'UTR sequence has a sequence selected from the group consisting of a nucleotide sequence as shown in SEQ ID NOs: 1 to 8 or a derivative sequence thereof.

[0019] Preferably, the derivative sequence refers to a derivative sequence of any one of the above nucleotide sequences that has been optionally subjected to addition, deletion, modification and / or substitution of at least one (such as 1-3) nucleotides and can retain the ability to enhance the expression of the target gene.

[0020] Preferably, the derived sequence comprises a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to any one of the above nucleotide sequences.

[0021] The second aspect of the present invention provides a 3'UTR sequence, wherein the 3'UTR sequence is shown in any one of SEQ ID NOs. 11-29.

[0022] Preferably, the 3'UTR sequence is shown as SEQ ID NO.21.

[0023] Preferably, the 3'UTR sequence has a sequence selected from the group consisting of a nucleotide sequence as shown in SEQ ID NOs: 11 to 29 or a derivative sequence thereof.

[0024] Preferably, the derivative sequence refers to a derivative sequence of any one of the above nucleotide sequences that has been optionally subjected to addition, deletion, modification and / or substitution of at least one (such as 1-3) nucleotides and can retain the ability to enhance the expression of the target gene.

[0025] Preferably, the derived sequence comprises a nucleotide sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% homology to any one of the above nucleotide sequences.

[0026] The third aspect of the present invention provides a combination of a 5'UTR sequence and a 3'UTR sequence.

[0027] The 5'UTR sequence is shown as SEQ ID NO.5.

[0028] The 3'UTR sequence is shown in any one of SEQ ID NOs. 11-29.

[0029] Preferably, the 3'UTR sequence is shown as SEQ ID NO.21.

[0030] The fourth aspect of the present invention provides an mRNA molecule, wherein the mRNA molecule has the 5'UTR sequence as described in the first aspect of the present invention; or

[0031] The mRNA molecule has the 5'UTR sequence and the 3'UTR sequence as described in the third aspect of the present invention.

[0032] Preferably, the mRNA molecule is encoded by a DNA template.

[0033] Preferably, the DNA template has a structure of Formula I:

[0034] Z1-Z2-Z3-Z4-Z5-Z6-Z7(I)

[0035] In the formula,

[0036] Z1 and Z7 are no or restriction sites;

[0037] Z2 is none or promoter element;

[0038] Z3 is the 5'UTR sequence as described in the first aspect of the present invention;

[0039] Z4 is the target coding sequence;

[0040] Z5 is the 3'UTR element as described in the second aspect of the present invention;

[0041] Z6 is the polyA tail element.

[0042] Preferably, the enzyme cleavage site is a restriction endonuclease site.

[0043] Preferably, the restriction endonuclease is selected from one or more type II restriction endonucleases.

[0044] Preferably, the restriction endonuclease is selected from one or more of the following groups: type IIS restriction endonuclease, BamHI, Spe I, Mlu I, Hind III, Bgl II, Bcu I, BshT1, CsiI, Mbo I.

[0045] Preferably, the type IIS restriction endonuclease is selected from the group consisting of BspQ I, Bve I, Faq I, Bpi I, etc.

[0046] Preferably, the Z2 is selected from the group consisting of a T7 promoter, a T3 promoter, or a combination thereof.

[0047] Preferably, the mRNA molecule has the structure of Formula II:

[0048] X1-X2-X3-X4-X5(II)

[0049] In the formula,

[0050] X1 is none or 5' cap element;

[0051] X2 is the 5'UTR region;

[0052] X3 is the target coding region;

[0053] X4 is the 3'UTR region;

[0054] X5 is the polyA tail region.

[0055] Preferably, the 5' cap element is introduced by a method selected from the group consisting of: enzymatic capping, cap analog co-transcriptional capping (or one-step synthetic capping); preferably enzymatic capping.

[0056] The fifth aspect of the present invention provides an expression cassette, wherein the expression cassette has the 5'UTR sequence as described in the first aspect of the present invention; or

[0057] The mRNA molecule has the 5'UTR sequence and the 3'UTR sequence as described in the third aspect of the present invention.

[0058] The sixth aspect of the present invention provides a recombinant vector, wherein the recombinant vector contains the expression cassette described in the fifth aspect of the present invention.

[0059] Preferably, the recombinant vector is selected from the group consisting of DNA, RNA, viral vectors, plasmids, transposons, other gene transfer systems, or combinations thereof. Preferably, the vector is a plasmid vector.

[0060] In some embodiments of the present invention, the recombinant vector is a pUC57-Simple vector.

[0061] The seventh aspect of the present invention provides a recombinant cell, wherein the recombinant cell contains the recombinant vector described in the sixth aspect of the present invention.

[0062] Preferably, the recombinant cell comprises a prokaryotic cell or a eukaryotic cell.

[0063] Preferably, the recombinant cell is selected from the group consisting of Escherichia coli, yeast cells, and mammalian cells.

[0064] The eighth aspect of the present invention provides a method for producing the mRNA molecule according to the fourth aspect of the present invention, comprising the following steps:

[0065] (a) culturing the recombinant cell according to claim 8 under suitable conditions to obtain a culture, wherein the culture contains a DNA template encoding the mRNA molecule according to claim 5;

[0066] (b) isolating and / or recovering the DNA template from the culture obtained in (a);

[0067] (c) transcribing the DNA template obtained in (b) to obtain the mRNA; and

[0068] (d) Optionally, purifying and / or modifying the mRNA obtained in step (c).

[0069] Preferably, the step (b) may also include a step of enzyme linearization.

[0070] The ninth aspect of the present invention provides a drug, comprising the 5'UTR sequence described in the first aspect of the present invention, the combination of the 5'UTR sequence and the 3'UTR sequence described in the third aspect of the present invention, the mRNA molecule described in the fourth aspect of the present invention, the expression cassette described in the fifth aspect of the present invention, the recombinant vector described in the sixth aspect of the present invention, and / or the recombinant cell described in the seventh aspect of the present invention.

[0071] Preferably, the medicament comprises a vaccine;

[0072] In some embodiments of the present invention, the drug is a vaccine.

[0073] In some embodiments of the present invention, the medicament further comprises a pharmaceutically acceptable adjuvant, carrier, diluent or excipient.

[0074] In some embodiments of the invention, the carrier is a liposome.

[0075] In some embodiments of the present invention, the carrier is a cationic liposome, which includes a cationic lipid and a helper lipid.

[0076] In some embodiments of the invention, the cationic lipid comprises at least one of DOTAP, DOTMA, DOEPC, DC-Chol, DDAB, DODMA and DLinDMA.

[0077] In some embodiments of the invention, the helper lipid is a neutral helper lipid.

[0078] The neutral helper lipid includes at least one of DSPC, DOPE, DOPC, DOPG, DOPS and cholesterol.

[0079] In some preferred embodiments of the present invention, the liposomes are: DOTMA:DOPA; the molar ratio is 1:10 to 10:1.

[0080] In some preferred embodiments of the present invention, the liposome is: DOTMA:DOPA=2:1.

[0081] In some embodiments of the present invention, the vaccine is prepared by mixing mRNA with liposomes, wherein the charge ratio of mRNA to liposomes is 5:1 to 1:10; and the mass ratio of mRNA to cationic lipids is 27:1 to 1:18.

[0082] In some embodiments of the present invention, the drug is provided in a physiologically administrable form and is suitable for oral, intramuscular, intravenous, subcutaneous or cutaneous injection application.

[0083] The tenth aspect of the present invention provides use of a biomaterial in preparing a product, wherein the biomaterial is any one of (a1) to (a6):

[0084] (a1) the 5'UTR described in the first aspect of the present invention;

[0085] (a2) a combination of the 5'UTR sequence and the 3'UTR sequence according to the third aspect of the present invention;

[0086] (a3) the mRNA molecule according to the fourth aspect of the present invention;

[0087] (a4) the expression cassette according to the fifth aspect of the present invention;

[0088] (a5) the recombinant vector according to the sixth aspect of the present invention;

[0089] (a6) The recombinant cell according to the seventh aspect of the present invention.

[0090] The function of the product is any one of (b1) to (b6):

[0091] (b1) Improve the efficiency of in vitro mRNA translation;

[0092] (b2) increasing the level of mRNA protein expression in vitro;

[0093] (b3) increasing in vitro mRNA half-life;

[0094] (b4) Improve survival time;

[0095] (b5) induce an immune response;

[0096] (b6) Preparation of mRNA vaccine.

[0097] In some embodiments of the invention, the product is a drug.

[0098] In some embodiments of the present invention, the drug is preferably a vaccine.

[0099] The beneficial effects of the present invention are:

[0100] The present invention provides a mRNA 5'UTR and 3'UTR, and prepares a related combination method and screening strategy based on the invented 5'UTR and 3'UTR. First, the applicant designed a 5'UTR library according to the mRNA 5'UTR optimization principle, analyzed and compared the translation efficiency of different 5'UTRs in the library, and found that 5'UTR 5UTR05 had the best effect; and based on 5UTR05, a variety of 3'UTRs of highly expressed proteins and dendritic cell proteins in plasma were combined, and it was found that 5UTR05 had the highest reporter gene expression when combined with the 3'UTR of Tropomyosin2 (TPM2) and IGHG2. Subsequently, by adopting a screening strategy of double 3'UTR combination, the UTR combination of mRNA-11 and mRNA-12 showed better expression efficiency than the positive control, improved the translation efficiency of in vitro mRNA, and can be used for mRNA-related treatment. BRIEF DESCRIPTION OF THE DRAWINGS

[0101] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0102] Figure 1 This is the protein translation efficiency of mRNA constructed from 8 5'UTRs in the 5'UTR library in 293T cells for 12 hours.

[0103] Figure 2The protein translation efficiency of 5'UTR 5UTR05 combined with 3'UTRs of 18 human plasma high-concentration proteins and dendritic cell proteins in 293T cells for 12 hours.

[0104] Figure 3 The protein translation efficiency of 5'UTR 5UTR05 combined with various 3'UTRs in 293T cells for 12 hours.

[0105] Figure 4 The protein translation efficiency of the combination of mRNA-10 (5UTR05_AES+IGHG2), mRNA-11 (5UTR05_IGHG2+mtRNR), and mRNA-12 (5UTR05_mtRNR+IGHG2) in 293T cells for 12 hours

[0106] Figure 5 The protein translation efficiency of mRNA constructed from 8 5'UTRs in the 5'UTR library in Balb / c mice at 0.5 hours, 4 hours, 7 hours, and 21 hours.

[0107] Figure 6 The protein translation efficiency of mRNA constructed with different 3'UTRs in the 3'UTR library in Balb / c mice at 0.5 hours, 4 hours, 7 hours, and 21 hours.

[0108] Figure 7 The protein translation efficiency of the combination of 5'UTR 5UTR05 and 3'UTR IGHG2 and Tropomyosin2 (TPM2) in Balb / c mice at 0.5 hours, 2 hours, 7 hours, and 21 hours.

[0109] Figure 8 The protein translation efficiency of different mRNA combinations in 293T cells after 12 hours.

[0110] Fig. 9 The protein translation efficiency of the combination of mRNA-11 (5UTR05_IGHG2+mtRNR), mRNA-12 (5UTR05_mtRNR+IGHG2), and mRNA-19 (positive control 1+α-globin) in Balb / c mice at 0.5 hours, 2 hours, 4 hours, and 24 hours. DETAILED DESCRIPTION

[0111] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0112] Example 1 UTR design and in vitro expression verification

[0113] According to the optimization principle of 5'UTR in terms of length, secondary structure and GC content, this embodiment designed a 5'UTR library, which included 8 5'UTRs including 5UTR05, and then combined with different 3'UTRs to form a UTR combination.

[0114] In this example, mRNA template sequences containing different UTR sequences were cloned into the pUC57-Simple vector containing a T7 promoter and a 120-poly(A) tail through the EcoRI and BsmBI restriction sites, and the firefly luciferase (FFLuc) gene was used as a reporter gene. mRNA was generated by in vitro transcription, and then the mRNA was verified in 293T cells and Balb / c mice, and its translation efficiency was analyzed and compared, and the 5'UTR with the highest translation efficiency was selected for the next 3'UTR screening combination.

[0115] 1. UTR sequence design

[0116] Among them, the 5'UTR sequence is as follows:

[0117] 5UTR01:

[0118] AAUCCUUUCUUUCAGCΜGGAGΜGCUCCCAGGAGCCAGCCCCACCCUUAGAAA AG (SEQ ID NO. 1).

[0119] 5UTR02:

[0120] GGAAACAAUUAACAUACACUAAACUACUACUCAUAUCAUACCUAAAACUUACCUACUAUCGCCACC (SEQ ID NO. 2).

[0121] 5UTR03:

[0122] GGAAAACAUCAAUCUCAACUAUCACCAUAAUUCUUCΜGGUCCCCACAGACUCAGAGAGAACCCGCCACC (SEQ ID NO. 3).

[0123] 5UTR04:

[0124] GGACUAAUAUUAUCACACCUACUACAAAAUAUAUACCAACUCCAAUACACUCCUUUUCACCUCAGCCACC (SEQ ID NO. 4).

[0125] 5UTR05:

[0126] GGAUCACUUACUAUUAAAAACCCCUACCCUUUUCUCUACUUCAAACUAUCAA ACCAAUCUMGCCACC (SEQ ID NO. 5).

[0127] 5UTR06:

[0128] GGAACCUAAUAUUACAUUCUCUAAAAACCUUACUCUUCCCAAUCUCAUUCCUCA UCUUAUCCMGCCACC (SEQ ID NO. 6).

[0129] 5UTR07:

[0130] GGAACACUUAACAUUUACCCACACUUUCAACUAAUCUCCUCAAAAACACUAAUU CAACCAUCMGCCACC (SEQ ID NO. 7).

[0131] 5UTR08:

[0132] GGAAAACAUCAAUCUCAACUAUCACCAUAUCAAUACACUUUCAAUAAAACCCAACCAACCUACGCCACC (SEQ ID NO. 8).

[0133] Positive control 1: GGGAAAUAAGAGAGAAAAGAAGAGUAAGAAGAAAUAU AAGACCCCGGCGCCGCCACC (SEQ ID NO. 9).

[0134] The 3'UTR sequence is as follows:

[0135] mRNA-00 3'UTR (positive control 2):

[0136] CΜGGUACΜGCAΜGCACGCAAΜGCUAGCΜGCCCCUUUCCCGUCCΜGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAΜGCUCCCACCUCCACCΜGCCCCACUCACCACCUCΜGCUAGUUCCAGACACCUCCCAAGCACGCAGCAAΜGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGΜGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUΜGGUCAAUUUCGΜGCCAGCCACACC(SEQID NO.10)。

[0137] mRNA-01 3’UTR:GCCCCACGCCAGCGΜGGCCACCUCAGCUCUCUUCUCUCCUCUCCUUUCCAUUCUCUCUAΜGGGGAGGGGAGCAGGCAGGAGGAGCAGAAAUΜGCCAACAUΜGCACAGCCAGGCΜGGGAGCAGCCUAGGGAGAGCCCCCAUCAΜGCCCACCACCCACUCΜGGCACΜGGCUUCAUCCUUUACCUAUCCCCUUCCACCCUCCUUΜGCΜGCUUAAUAAAUUCΜGAACUΜGGGΜGCCACGGCCGGCAAGCCCCCGCUCCCCAGGCUCUCGGGGUCGCGCGAGGAΜGCUΜGGCACGUACCCCGΜGUACAUACUUCCCAGGCACCCAGCAΜGGAAAUAAAGCACCCAGCGCUUCCCΜGGGCCCCΜG(SEQ ID NO.11)。

[0138] mRNA-02 3’UTR:GΜGCCACGGCCGGCAAGCCCCCGCUCCCCAGGCUCUCGG GGUCGCGCGAGGAΜGCUΜGGCACGUACCCCGΜGUACAUACUUCCCAGGCACCCAGCAΜGGAAAUAAAGCACCCAGCGCUUCCCΜGGGCCCCΜGGCCCCACGCCAGCGΜGGCCACCUCAGCUCUCUUCUCUCCUCUCCUUUCCAUUCUCUCUAΜGGGGAGGGGAGCAGGCAGGAGGAGCAGAAAUΜGCCAACAUΜGCACAGCCAGGCΜGGGAGCAGCCUAGGGAGAGCCCCCAUCAΜGCCCACCACCCACUCΜGGCACΜGGCUUCAUCCUUUACCUAUCCCCUUCCACCCUCCUUΜGCΜGCUUAAUAAAUUCΜGAACUΜGG(SEQ ID NO.12)。

[0139] mRNA-03 3’UTR:GCCCCACGCCAGCGΜGGCCACCUCAGCUCUCUUCUCUCCUCUCCUUUCCAUUCUCUCUAΜGGGGAGGGGAGCAGGCAGGAGGAGCAGAAAUΜGCCAACAUΜGCACAGCCAGGCΜGGGAGCAGCCUAGGGAGAGCCCCCAUCAΜGCCCACCACCCACUCΜGGCACΜGGCUUCAUCCUUUACCUAUCCCCUUCCACCCUCCUUΜGCΜGCUUAAUAAAUUCΜGAACUΜGGCΜGGUACΜGCAΜGCACGCAAΜGCUAGCΜGCCCCUUUCCCGUCCΜGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAΜGCUCCCACCUCCACCΜGCCCCACUCACCACCUCΜGCUAGUUCCAGACACCUCC(SEQ ID NO.13)。

[0140] mRNA-04 3’UTR:CΜGGUACΜGCAΜGCACGCAAΜGCUAGCΜGCCCCUUUCCCGU CCΜGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAΜGCUCCCACCUCCACCΜGCCCCACUCACCACCUCΜGCUAGUUCCAGACACCUCCGCCCCACGCCAGCGΜGGCCACCUCAGCUCUCUUCUCUCCUCUCCUUUCCAUUCUCUCUAΜGGGGAGGGGAGCAGGCAGGAGGAGCAGAAAUΜGCCAACAUΜGCACAGCCAGGCΜGGGAGCAGCCUAGGGAGAGCCCCCAUCAΜGCCCACCACCCACUCΜGGCACΜGGCUUCAUCCUUUACCUAUCCCCUUCCACCCUCCUUΜGCΜGCUUAAUAAAUUCΜGAACUΜGG(SEQ ID NO.14)。

[0141] mRNA-05 3’UTR:GCCCCACGCCAGCGΜGGCCACCUCAGCUCUCUUCUCUCCUCUCCUUUCCAUUCUCUCUAΜGGGGAGGGGAGCAGGCAGGAGGAGCAGAAAUΜGCCAACAUΜGCACAGCCAGGCΜGGGAGCAGCCUAGGGAGAGCCCCCAUCAΜGCCCACCACCCACUCΜGGCACΜGGCUUCAUCCUUUACCUAUCCCCUUCCACCCUCCUUΜGCΜGCUUAAUAAAUUCΜGAACUΜGGCAAGCACGCAGCAAΜGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGΜGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUΜGGUCAAUUUCGΜGCCAGCCACACC(SEQ ID NO.15)。

[0142] mRNA-06 3’UTR:CAAGCACGCAGCAAΜGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGΜGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUΜGGUCAAUUUCGΜGCCAGCCACACCGCCCCACGCCAGCGΜGGCCACCUCAGCUCUCUUCUCUCCUCUCCUUUCCAUUCUCUCUAΜGGGGAGGGGAGCAGGCAGGAGGAGCAGAAAUΜGCCAACAUΜGCACAGCCAGGCΜGGGAGCAGCCUAGGGAGAGCCCCCAUCAΜGCCCACCACCCACUCΜGGCACΜGGCUUCAUCCUUUACCUAUCCCCUUCCACCCUCCUUΜGCΜGCUUAAUAAAUUCΜGAACUΜGG(SEQ ID NO.16)。

[0143] mRNA-07 3’UTR:GCCCCACGCCAGCGΜGGCCACCUCAGCUCUCUUCUCUCCUCUCCUUUCCAUUCUCUCUAΜGGGGAGGGGAGCAGGCAGGAGGAGCAGAAAUΜGCCAACAUΜGCACAGCCAGGCΜGGGAGCAGCCUAGGGAGAGCCCCCAUCAΜGCCCACCACCCACUCΜGGCACΜGGCUUCAUCCUUUACCUAUCCCCUUCCACCCUCCUUΜGCΜGCUUAAUAAAUUCΜGAACUΜGGGCUCGCUUUCUΜGCΜGUCCAAUUUCUAUUAAAGGUUCCUUΜGUUCCCUAAGUCCAACUACUAAACΜGGGGGAUAUUAΜGAAGGGCCUΜGAGCAUCΜGGAUUCΜGCCUAAUAAAAAACAUUUAUUUUCAUΜGCAA(SEQ ID NO.17)。

[0144] mRNA-08 3’UTR:GCUCGCUUUCUΜGCΜGUCCAAUUUCUAUUAAAGGUUCCUUΜGUUCCCUAAGUCCAACUACUAAACΜGGGGGAUAUUAΜGAAGGGCCUΜGAGCAUCΜGGAUUCΜGCCUAAUAAAAAACAUUUAUUUUCAUΜGCAAGCCCCACGCCAGCGΜGGCCACCUCAGCUCUCUUCUCUCCUCUCCUUUCCAUUCUCUCUAΜGGGGAGGGGAGCAGGCAGGAGGAGCAGAAAUΜGCCAACAUΜGCACAGCCAGGCΜGGGAGCAGCCUAGGGAGAGCCCCCAUCAΜGCCCACCACCCACUCΜGGCACΜGGCUUCAUCCUUUACCUAUCCCCUUCCACCCUCCUUΜGCΜGCUUAAUAAAUUCΜGAACUΜGG(SEQ ID NO.18)。

[0145] mRNA-09 3’UTR:GΜGCCACGGCCGGCAAGCCCCCGCUCCCCAGGCUCUCGGGGUCGCGCGAGGAΜGCUΜGGCACGUACCCCGΜGUACAUACUUCCCAGGCACCCAGCAΜGGAAAUAAAGCACCCAGCGCUUCCCΜGGGCCCCΜGCΜGGUACΜGCAΜGCACGCAAΜGCUAGCΜGCCCCUUUCCCGUCCΜGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAΜGCUCCCACCUCCACCΜGCCCCACUCACCACCUCΜGCUAGUUCCAGACACCUCC(SEQ ID NO.19)。

[0146] mRNA-10 3’UTR:CΜGGUACΜGCAΜGCACGCAAΜGCUAGCΜGCCCCUUUCCCGUCCΜGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAΜGCUCCCACCUCCACCΜGCCCCACUCACCACCUCΜGCUAGUUCCAGACACCUCCGΜGCCACGGCCGGCAAGCCCCCGCUCCCCAGGCUCUCGGGGUCGCGCGAGGAΜGCUΜGGCACGUACCCCGΜGUACAUACUUCCCAGGCACCCAGCAΜGGAAAUAAAGCACCCAGCGCUUCCCΜGGGCCCCΜG(SEQ ID NO.20)。

[0147] mRNA-11 3’UTR:GΜGCCACGGCCGGCAAGCCCCCGCUCCCCAGGCUCUCGGGGUCGCGCGAGGAΜGCUΜGGCACGUACCCCGΜGUACAUACUUCCCAGGCACCCAGCAΜGGAAAUAAAGCACCCAGCGCUUCCCΜGGGCCCCΜGCAAGCACGCAGCAAΜGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGΜGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUΜGGUCAAUUUCGΜGCCAGCCACACC(SEQ ID NO.21)。

[0148] mRNA-12 3’UTR:CAAGCACGCAGCAAΜGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGΜGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUΜGGUCAAUUUCGΜGCCAGCCACACCGΜGCCACGGCCGGCAAGCCCCCGCUCCCCAGGCUCUCGGGGUCGCGCGAGGAΜGCUΜGGCACGUACCCCGΜGUACAUACUUCCCAGGCACCCAGCAΜGGAAAUAAAGCACCCAGCGCUUCCCΜGGGCCCCΜG(SEQ ID NO.22)。

[0149] mRNA-13 3'UTR:GΜGCCACGGCCGGCAAGCCCCCGCUCCCCAGGCUCUCGGGUCGCGCGAGGAΜGCUΜGGCACGUACCCCGΜGUACAUACUUCCCAGGCACCCAGCAΜGGAAAUAAAGCACCCAGCGCUUCCCΜGGGCCCCΜG GCUCGCUUUCUΜGCΜGUCCAAUUUCUAUAAAGGUUCCUUΜGUUCCCUAAGUCCAACUACUAAACΜGGGGGAUAUUAΜGAAGGGCCUΜGAGCAUCΜGGAUUCΜGCCUAAUAAAAAACAUUUUUCAUΜGCAA(SEQ ID NO.23)。

[0150] mRNA-14 3'UTR:GCUCGCUUUCUΜGCΜGUCCAAUUUCUAUAAAGGUUCCUUUGUUCCCAAAGUCCAACUAACΜGGGGGAUAUUAΜGAAGGGCCUΜGAGCAUCΜGGAUUCΜGCCUAAUAAAAAACAUUUUUUCAUGC AAGΜGCCACGGCCGGCAAGCCCCCGCUCCCCAGGCUCUCGGGGUCGCGCGAGGAΜGCUΜGGCACGUACCCCGΜGUACAUACUUCCCAGGCACCCAGCAΜGGAAAUAAAGCACCCAGCGCUUCCCΜGGGCCCCΜG(SEQ ID NO.24)。

[0151] mRNA-15 3'UTR:CΜGGUACΜGCAΜGCACGCAAΜGCUAGCΜGCCCCUUUCCCGUCCΜGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAΜGCUCCCACCUCCACCΜGCCCCACUCACCACCUCΜGCUAGUUCCAGACCACCU CCGCUCGCUUUCUΜGCΜGUCCAAUUUCUAUAAAGGUUCCUUΜGUUCCCUAAGUCCAACUACUAAACΜGGGGGAUAUUAΜGAAGGGCCUΜGAGCAUCΜGGAUUCΜGCCUAAUAAAAAACAUUUUUCAUΜGCAA(SEQ ID NO.25)。

[0152] mRNA-16 3’UTR:GCUCGCUUUCUΜGCΜGUCCAAUUUCUAUUAAAGGUUCCUUΜGUUCCCUAAGUCCAACUACUAAACΜGGGGGAUAUUAΜGAAGGGCCUΜGAGCAUCΜGGAUUCΜGCCUAAUAAAAAACAUUUAUUUUCAUΜGCAACΜGGUACΜGCAΜGCACGCAAΜGCUAGCΜGCCCCUUUCCCGUCCΜGGGUACCCCGAGUCUCCCCCGACCUCGGGUCCCAGGUAΜGCUCCCACCUCCACCΜGCCCCACUCACCACCUCΜGCUAGUUCCAGACACCUCC(SEQ ID NO.26)。

[0153] mRNA-17 3’UTR:CAAGCACGCAGCAAΜGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGΜGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUΜGGUCAAUUUCGΜGCCAGCCACACCGCUCGCUUUCUΜGCΜGUCCAAUUUCUAUUAAAGGUUCCUUΜGUUCCCUAAGUCCAACUACUAAACΜGGGGGAUAUUAΜGAAGGGCCUΜGAGCAUCΜGGAUUCΜGCCUAAUAAAAAACAUUUAUUUUCAUΜGCAA(SEQ ID NO.27)

[0154] mRNA-18 3’UTR GCUCGCUUUCUΜGCΜGUCCAAUUUCUAUUAAAGGUUCCUUUGUUCCCUAAGUCCAACUACUAAACΜGGGGGAUAUUAΜGAAGGGCCUΜGAGCAUCΜGGAUUCΜGCCUAAUAAAAAACAUUUAUUUUCAUΜGCAACAAGCACGCAGCAAΜGCAGCUCAAAACGCUUAGCCUAGCCACACCCCCACGGGAAACAGCAGΜGAUUAACCUUUAGCAAUAAACGAAAGUUUAACUAAGCUAUACUAACCCCAGGGUΜGGUCAAUUUCGΜGCCAGCCACACC(SEQ ID NO.28)。

[0155] mRNA-19 3'UTR: GCΜGGAGCCUCGGΜGGCCUAGCUUCUΜGCCCCUΜGGGCCUCCCCCCAGCCCCUCCUCCCCUUCCΜGCACCCGUACCCCCGΜGGUCUUΜGAAUAAAGU CΜGAGΜGGGCGGC (SEQ ID NO. 29).

[0156] The composition and characteristics of the 5'UTR and 3'UTR combinatorial libraries are shown in Table 1 .

[0157] Table 1 Composition and characteristics of 5'UTR and 3'UTR combinatorial libraries

[0158]

[0159]

[0160] 2. Experimental methods

[0161] The method for detecting the translation efficiency of mRNA in 293T cells (mRNA transfection) is as follows:

[0162] 1) 293T cells were seeded in a 24-well plate;

[0163] 2) When the cells reached 60% confluence, mRNA (0.8 μg / well) was transfected into 293T cells. TM RNAiMAX reagent instructions, prepare a mixture at a ratio of 1 μg mRNA plus 1 μL RNAiMAX. First, dilute mRNA (0.8 μg) in a reaction tube containing 50 μL of opti-MEM serum-free medium, named tube A; add 0.8 μL RNAiMAX to another reaction tube containing 50 μL of opti-MEM serum-free medium, named tube B. After mixing the solutions in tubes A and B, incubate at room temperature for 5 minutes.

[0164] 3) After incubation, add 100 μL of the total reaction system to the cells and culture at 5% CO 2 and 37° C.

[0165] 4) After 12 hours of culture, the luciferase activity of 293T cells was measured using a firefly luciferase reporter gene assay kit (Yeasen). First, the supernatant was discarded and each well was washed with 1 mL of PBS. 200 μL of cell lysis solution was then added to each well, and the cells were incubated on ice for 5 minutes to ensure complete lysis. Next, 20 μL of lysate was transferred to an opaque white ELISA plate, and 100 μL of firefly luciferase detection reagent was added and mixed thoroughly. The microplate reader was set to measure for 10 seconds at a wavelength of 350-700 nm, with a measurement interval of 2 seconds. The final result was corrected by subtracting the blank control luminescence measurement value.

[0166] 5) Compare the measured values ​​to reflect the translation efficiency of different UTR combinations.

[0167] 3. Experimental results

[0168] 1) mRNA carrying 5'UTR combinations was transfected into 293T cells, and the relative expression levels of different 5'UTRs were evaluated by fluorescence detection. In order to better evaluate the translation efficiency, NEB was set as a negative control in this example. After 12 hours, the expression of all designed 5'UTRs was higher than that of the NEB control, among which 5UTR05 had the highest expression. Figure 1 )

[0169] 2) This example screened 17 conserved 3'UTRs from highly expressed genes, including tropomyosin alpha-2 chain (TPM2), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), tubulin alpha-1A chain (TUBA1A), pigment epithelium-derived factor (SERPINF1), CD1e molecule (CD1E), N-myc downstream regulatory gene 2 (NDRG2), gelsolin, CD207, leucine-rich repeat protein 26 (LRRC26), keratin 5, serine dehydrogenase (SDS), helical domain-containing protein 124 (CCDC124), potassium voltage-gated channel subfamily A member 5 (KCNA5), cAMP-dependent protein kinase inhibitor β (PKIB), phospholipase D3 (PLD3), mTOR interacting protein containing a DEP domain (DEPTOR) and IGHG2. These 17 3'UTRs were combined with 5UTR05 to construct the corresponding luciferase mRNA, and then their expression efficiency was evaluated by in vitro experiments. The results are shown in Figure 2 .

[0170] 3) In the second round of 3'UTR optimization, this example combined the 3'UTRs (IGHG2, TPM2), mtRNR1, AES, and β-globin that performed well in the first round of screening, and generated a total of 18 new combinations. The 3'UTRs (mRNA-00 and mRNA-19) with better effects on the market were used as controls. These RNAs were transfected into 293T cells, and the fluorescence was measured after 12 hours. The in vitro expression levels of multiple sequences were higher than mRNA-00. The best performing combinations in in vitro expression were mRNA-11 and mRNA-12. ( Figure 3-Figure 4 )

[0171] Example 2 Verification of the effect of UTR combination-mediated mRNA expression in vivo

[0172] The method for detecting translation efficiency in Balb / c mice is as follows:

[0173] 1) Liposomes were used to encapsulate in vitro transcribed mRNA for in vivo delivery. Liposomes were prepared using a lipid mixture containing DOTMA (purchased from Avanti Polar Lipids, 890898P) and DOPE (purchased from Sigma-Aldrich, 76548), with a DOPE to DOTMA molar ratio of 1:2. The mRNA was mixed with the liposome components and incubated at room temperature for 5 minutes to allow self-assembly of the RNP complex. The particle size and zeta potential of the formulated LNP mRNA nanoparticles were characterized using a Malvern Zetasizer Nano ZS dynamic light scattering instrument (MalvernInstruments, Worcestershire, UK). Nanoparticles with a diameter of ≈340 nm and a net negative zeta potential were used for subsequent in vivo administration and were injected into each mouse via the tail vein at a dose of 20 μg.

[0174] 2) In vivo imaging of bioluminescence was performed using the IVIS spectral imaging system (PerkinElmer) at different time points of 0.5h, 2h, 4h, 7h, and 24h. Before imaging, 100 μl of 15 mg / mL D-luciferin potassium salt (Promega, E1601) was injected intraperitoneally into the mouse, and then the mouse was anesthetized with isoflurane gas, and then the mouse was transferred to the IVIS in vivo imaging chamber connected to inhalation anesthesia for imaging. According to the actual fluorescence signal of the mouse, the exposure time was set to automatic, usually 5-10 seconds. Appropriate and identical graphs were drawn to include all fluorescence values ​​in the imaging field of each mouse to determine the ROI and calculate and compare the in vivo translation efficiency of different 5'UTRs.

[0175] The results are as follows:

[0176] 1) mRNAs carrying different 5'UTR combinations were injected into BALB / c mice, and their in vivo translation efficiency was evaluated by fluorescence measurement at 0.5, 4, 7, and 21 hours. The results showed no significant differences among the groups. Figure 5 )

[0177] 2) The in vivo expression effect in mice showed that 5UTR05-TPM2 showed comparable translation efficiency to 5UTR05-positive control 2 mRNA in BALB / c mice, while 5UTR05-NDRG2-300 and 5UTR05-KCNA5-300 had poor in vivo expression efficiency. In contrast, 5UTR05-IGHG2 showed stable and efficient translation in cells and at various time points in vivo. ( Figure 6-Figure 7 )

[0178] 3) In the experiment evaluating 11 3'UTR combinations, mRNA was transfected into 293T cells to verify expression ( Figure 8 ) were injected into BALB / c mice, and their translation efficiency was assessed by fluorescence measurement at 0.5, 3.5, 8, and 24 h after injection ( Fig. 9 ). mRNA-06, 08, 10, 11 and 12 all showed excellent in vivo and in vitro translation efficiency. Among them, mRNA-11 showed the highest in vivo expression efficiency, followed by mRNA-12. ( Figure 8-Figure 9 )

[0179] In summary, it can be seen that through 5'UTR optimization and 3'UTR screening and combination strategies, the final UTR combination of mRNA-11 and mRNA-12 has the best in vivo and in vitro protein translation level and translation efficiency.

Claims

1. A 5'UTR sequence, characterized in that: The 5'UTR sequence is shown in any one of SEQ ID NOs. 1-8.

2. The 5'UTR sequence according to claim 1, characterized in that: The 5'UTR sequence is shown as SEQ ID NO.

5.

3. A 3'UTR sequence, characterized in that: The 3'UTR sequence is shown in any one of SEQ ID NOs. 11 to 29; Preferably, the 3'UTR sequence is shown as SEQ ID NO.

21.

4. A combination of a 5'UTR sequence and a 3'UTR sequence, characterized in that: The 5'UTR sequence is shown in SEQ ID NO.5; The 3'UTR sequence is shown in any one of SEQ ID NOs. 11 to 29; Preferably, the 3'UTR sequence is shown as SEQ ID NO.

21.

5. An mRNA molecule, characterized in that: The mRNA molecule has a 5'UTR sequence as claimed in any one of claims 1 to 2; or The mRNA molecule has the 5'UTR sequence and the 3'UTR sequence as claimed in claim 4.

6. An expression cassette, characterized in that: Comprising the 5'UTR sequence of any one of claims 1 to 2; or Comprising the 5'UTR sequence and 3'UTR sequence combination of claim 4.

7. A recombinant vector, characterized in that: Comprising the expression cassette of claim 6.

8. A recombinant cell, characterized in that: Containing the recombinant vector according to claim 7.

9. The method for producing the mRNA molecule according to claim 5, comprising the following steps: (a) culturing the recombinant cell according to claim 8 under suitable conditions to obtain a culture, wherein the culture contains a DNA template encoding the mRNA molecule according to claim 5; (b) isolating and / or recovering the DNA template from the culture obtained in (a); (c) transcribing the DNA template obtained in (b) to obtain the mRNA; and (d) Optionally, purifying and / or modifying the mRNA obtained in step (c).

10. A drug, characterized in that: comprising the 5'UTR sequence according to any one of claims 1 to 2, the combination of the 5'UTR sequence and the 3'UTR sequence according to claim 4, the mRNA molecule according to claim 5, the expression cassette according to claim 6, the recombinant vector according to claim 7, and / or the recombinant cell according to claim 8; Preferably, the medicament comprises a vaccine; Preferably, the drug further comprises a pharmaceutically acceptable adjuvant, carrier, diluent or excipient; Preferably, the carrier is a liposome.

11. Use of a biomaterial in preparing a product, wherein the biomaterial is any one of (a1) to (a6): (a1) the 5'UTR according to any one of claims 1 to 2; (a2) the combination of the 5'UTR sequence and the 3'UTR sequence according to claim 4; (a3) the mRNA molecule according to claim 5; (a4) the expression cassette of claim 6; (a5) the recombinant vector according to claim 7; (a6) the recombinant cell according to claim 8; The function of the product is any one of (b1) to (b6): (b1) Improve the efficiency of in vitro mRNA translation; (b2) increasing the level of mRNA protein expression in vitro; (b3) increasing in vitro mRNA half-life; (b4) Improve survival time; (b5) induce an immune response; (b6) Preparation of mRNA vaccine.

Images