Methods and applications for targeted knockout of pig txlnb locus

By designing sgRNA to target exon 3 of the porcine TXLNB gene and constructing a gene editing system, the problem of TXLNB gene knockout in pigs was solved, and a miniature pig model of muscular atrophy was established, providing a new animal model for the research and treatment of muscular atrophy.

CN119752892BActive Publication Date: 2025-12-09ZHEJIANG UNIV +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411769234.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-04
Publication Date
2025-12-09
Estimated Expiration
2044-12-04

AI Technical Summary

Technical Problem

It is difficult to efficiently and accurately knock out the TXLNB gene in pigs, and the gene editing efficiency is far lower than that in mice and rats, and there is a lack of effective animal models of muscle atrophy.

Method used

We designed specific sgRNAs to target both ends of exon 3 of the porcine TXLNB gene, constructed a recombinant expression vector and a gene editing system, used Cas9 nuclease for gene editing, and established a porcine fibroblast model with TXLNB gene knockout.

Benefits of technology

The efficient deletion of the porcine TXLNB gene was achieved, resulting in a miniature pig model of muscle atrophy, which can be used for research on the mechanism of muscle atrophy and its treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119752892B_ABST
    Figure CN119752892B_ABST
Patent Text Reader

Abstract

The application discloses a method and application of targeting knockout of a pig TXLNB gene locus, and belongs to the technical field of gene editing engineering. The application designs a TXLNB gene knockout method based on a CRISPR / Cas9 system. Specifically, by screening gRNA target points and gRNA combinations, it is found that when the two ends of a targeted TXLNB exon 3 are adopted, a specific gRNA combination can realize efficient TXLNB gene deletion. After the related gene fragments in pig fibroblasts are deleted by the method, the animal model formed by transplanting the knockout cells into a small pig in vivo has obvious phenotypes, and has great potential in pig breeding related research.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to a method and application of targeting knockout of pig TXLNB gene locus, and belongs to the technical field of gene editing. BACKGROUND

[0002] TXLNB gene is one of the members of TXLN gene family (including TXLNA, TXLNB and TXLNG), which encodes β-taxilin protein. The common feature of the proteins encoded by TXLN gene family (including α-taxilin, β-taxilin and γ-taxilin) is that there is a very long coiled coil domain at the C terminal, i.e. taxilin domain. The members of this family all interact with syntaxin protein family members, and thus may be related to the process of intracellular vesicle transport. In 2002, Japanese researchers Kazuhiro et al. first cloned TXLNB gene (also known as MDP77) from cDNA library of chicken muscle tissue. TXLNA and TLXNG genes in TXLN family are expressed in various tissues, while TXLNB gene is only expressed in heart and muscle tissue. This unique expression pattern suggests that TXLNB gene may have a special role related to muscle cells. Through immunohistochemical analysis of chicken embryos and in vitro cultured chicken primary myoblasts, it was further found that TXLNB gene was only expressed in differentiated mature myotubes, but not in unfused myoblasts. Thereafter, Hiroshi et al. further explored the role of TXLNB gene in muscle development in a mouse model. In mice, TXLNB gene is also only expressed in heart and skeletal muscle tissue. By detecting the expression level of TXLNB gene in different stages of differentiation of mouse myoblast cell line C2C12, it was found that TXLNB was not expressed in undifferentiated myoblasts, and the expression gradually increased from the second day of differentiation. These results are consistent with the data in chickens. Thereafter, a TXLNB knockdown C2C12 cell line was constructed by siRNA technology, and it was found that the fusion of muscle cells and the differentiation of myotubes were inhibited after knocking down TXLNB, and the formed myotubes were reduced and the diameter was narrowed. This result shows that TXLNB gene plays a certain role in the process of differentiation and maturation of myoblasts.

[0003] The above research results show that TXLNB gene is involved in the regulation of myoblast differentiation biological process, and is a potential target gene for regulating animal skeletal muscle development.

[0004] Skeletal muscle is the largest organ in the human body, plays a crucial role in supporting and protecting the body, is the key tissue of movement, gesture assistance, metabolic homeostasis and heat production. It accounts for about 40% of the total body weight and 50% of the total protein. The characteristics of skeletal muscle atrophy are muscle mass and fiber cross-sectional area reduction, shrinkage and decrease at the histological level. The current clinical treatment mainly includes physical therapy (exercise training, electrical stimulation therapy), drug therapy (nerve nutrition drugs, microcirculation improvement drugs, hormone drugs), surgical treatment, etc. Research has found that the similarity of the expression profile of pig skeletal muscle to the expression profile of human progressive pseudohypertrophic muscular dystrophy (DMD) and progressive spinal muscular atrophy (SMA) susceptible genes reaches the human / mouse similarity level, and the proteomics of pig skeletal muscle is also very similar to that of humans (Xu, et al. 2013, Advanced Science).

[0005] However, there is no TXLNB knockout experiment in pigs at present, and the efficiency and accuracy of gene editing in pigs are far from those in mice, rats and other commonly used gene editing animals, which also makes it difficult to target knockout pig TXLNB gene. Therefore, we carry out TXLNB knockout experiments on small pigs to establish a method that can efficiently, accurately and effectively delete TXLNB, obtain pig fibroblasts with deleted TXLNB gene, and obtain a muscle atrophy small pig model to provide a new animal model for the mechanism research and treatment of muscle atrophy. SUMMARY

[0006] To solve the above problems, the present application provides a method for efficiently knocking out the TXLNB gene in pigs by screening the sgRNA target site, which can efficiently and conveniently delete specific genes while reducing damage to transfected cells. Moreover, by constructing TXLNB gene knockout pig fibroblasts, a muscle atrophy small pig model is expected to be obtained, which provides a new animal model for the mechanism research and treatment of muscle atrophy.

[0007] The first object of the present application is to provide a sgRNA for knocking out the TXLNB gene in pigs, which comprises the sequence shown in SEQ ID NO. 1-2, wherein:

[0008] SEQ ID NO. 1: 5'-ATATAGTATGCCTTCCGATA-3',

[0009] SEQ ID NO. 2: 5'-ATAGAGCGTCTCACCTGCAT-3'.

[0010] The second object of the present application is to provide a recombinant expression vector containing the sgRNA.

[0011] A third object of the present application is to provide a gene editing system for knocking out the TXLNB gene in pigs, which comprises an expression frame of the sgRNA and a Cas9 nuclease expression frame.

[0012] A fourth object of the present application is to provide a recombinant pig fibroblast cell (cell model) treated by the gene editing system.

[0013] Further, the gene TXLNB in the fibroblast cell is knocked out using the gene editing system.

[0014] Further, the TXLNB genotype of the recombinant pig fibroblast cell treated by gene editing is 5'-GACAATGATAAA ATATAGTATGCCTTCC GCATGGGCCCCTCTGAGG-3'.

[0015] A fifth object of the present application is to provide a method for knocking out the gene TXLNB in a pig fibroblast cell, which adopts the gene editing system for knocking out.

[0016] Further, the gene knockout can be used in vivo or in vitro.

[0017] A sixth object of the present application is to provide an application of the sgRNA, the recombinant expression vector, the gene editing system or the recombinant pig fibroblast cell in preparing a pig breeding product or an animal model.

[0018] Further, the recombinant pig fibroblast cell treated by gene editing is transplanted into a small pig in vivo for preparation.

[0019] Advantages of the present application:

[0020] The present application screens gRNA target points and finds that, compared with other target points, efficient TXLNB gene deletion can be achieved when targeting both ends of the TXLNB exon 3. After successfully deleting the TXLNB gene in the pig fibroblast cell, the cell model obtained can not only be used for related research, but also the animal model formed after the cell model is transplanted into a small pig has obvious phenotype, which is helpful for the research of muscle atrophy mechanism, such as breeding of genetically mutated muscle atrophy pigs. BRIEF DESCRIPTION OF DRAWINGS

[0021] Figure 1 The differentiation state of wild type and long fragment deletion C2C12 cells.

[0022] Figure 2 The figure is the identification result of the knockout efficiency of different gRNA combinations.

[0023] Figure 3 The figure is the schematic diagram of the TXLNB gene and the schematic diagram of the positions of the F1 / R1 and F2 / R2 primers.

[0024] Figure 4 Schematic diagram for cloning long fragment deletion.

[0025] Figure 5 Confluent state of cells before cryopreservation. DETAILED DESCRIPTION

[0026] The present application will be further described with reference to the drawings and specific examples, so that those skilled in the art can better understand the present application and implement it. The examples are not intended to limit the present application.

[0027] Example 1: gRNA screening

[0028] According to the structure of TXLNB, we constructed a C2C12 cell model knocking out exon 3 of TXLNB gene using C2C12 cells. The differentiation results of wild-type C2C12 cells are shown in the schematic diagram Figure 1 A, the differentiation results of long fragment deletion C2C12 cells are shown in the schematic diagram Figure 1 B, it can be seen that this long fragment deletion leads to inhibition of muscle cell fusion and myotube differentiation, and the formed myotubes are reduced in number and become thinner in diameter.

[0029] Therefore, we designed gRNAs targeting both ends of exon 3 of the pig TXLNB gene, in which gRNA1: 5'-ATATAGTATGCCTTCCGATA-3' targets the sequence 5'-ATATAGTATGCCTTCCGATA-3' on TXLNB intron 2; gRNA2: 5'-ATAGAGCGTCTCACCTGCAT-3' targets the sequence 5'-ATAGAGCGTCTCACCTGCAT-3' on TXLNB intron 3; gRNA3: 5'-TTACATGGTATTACTGCGCA-3' targets the sequence 5'-TTACATGGTATTACTGCGCA-3' on TXLNB intron 2; gRNA4: 5'-GTGAGACGCTCTATCTTTAG-3' targets the sequence 5'-GTGAGACGCTCTATCTTTAG-3' on TXLNB intron 3; gRNA5: 5'-CCTATTCTGATTAGACAGGG-3' targets the sequence 5'-CCTATTCTGATTAGACAGGG-3' on TXLNB intron 2; gRNA6: 5'-TGGCGTGGAAAATGAAGTCG-3' targets the sequence 5'-TGGCGTGGAAAATGAAGTCG-3' on TXLNB intron 3. Two gRNAs on introns 2 and 3 can be combined to obtain 9 different knockout schemes.

[0030] By comparing the knockout efficiency of TXLNB gene exon 3 after transfection of 9 gRNA combinations, we found that the knockout efficiency of gRNA1: 5'-ATATAGTATGCCTTCCGATA-3' and gRNA2: 5'-ATAGAGCGTCTCACCTGCAT-3' was the highest, and the results are shown in the schematic Figure 2 .

[0031] Example 2: Construction of gene deletion vector

[0032] Based on the results of Example 1, the vector we used is the U6 promoter-driven gRNA cloning vector pX459. The gRNAs used to target both ends of the exon 3 of the pig TXLNB gene, in which gRNA1: 5'-ATATAGTATGCCTTCCGATA-3' targets the sequence 5'-ATATAGTATGCCTTCCGATA-3' on TXLNB intron 2; gRNA2: 5'-ATAGAGCGTCTCACCTGCAT-3' targets the sequence 5'-ATAGAGCGTCTCACCTGCAT-3' on TXLNB intron 3. When the two gRNA sites are cut at the same time, the 3rd exon (92bp) of the TXLNB gene is excised, a frameshift mutation is generated, and a stop codon is formed in advance at the start of the subsequent 4th exon, so that the gene expresses a non-functional truncated mutant protein.

[0033] First, the pX459 vector was linearized using Bbsl restriction endonuclease, and then primers gDNA-TXLNB-F1: 5'-caccgATATAGTATGCCTTCCGATA-3' and gDNA-TXLNB-R1: 5'-aaacTATCGGAAGGCATACTATAT-3' were annealed to construct the pX459-gRNA-1 vector; primers gDNA-TXLNB-F2: 5'-caccgATATAGTATGCCTTCCGATA-3' and gDNA-TXLNB-R2: 5'-aaacTATCGGAAGGCATACTATAT-3' were annealed to construct the pX459-gRNA-2 vector.

[0034] Example 3: Culture, transfection and screening of porcine fetal fibroblasts

[0035] Porcine fetal fibroblasts (PFFs) were isolated from a 32-day-old male Chinese experimental miniature pig embryo. These primary cells were cultured in high glucose Dulbecco's Medium Eagle medium (Gibco, Gaithersburg, DEME, USA) containing 20% fetal bovine serum (FBS, Gibco).

[0036] All animal experiments were performed in accordance with the guidelines established by the Chinese Animal Protection and Experimental Protocol Committee and were approved by the Zhejiang University Committee on Animal Welfare (Zhejiang, China).

[0037] Transfection of 3 pg pX459-gRNA-1 and 3 pg pX459-gRNA-2 into PFFs was performed using Lonza 4D-Nucleofector. One day before transfection, PFFs were thawed and cultured. Transfection was then performed using the electroporation reagent 82 pL PS solution and 18 pL supplement at parameter DO-113, with approximately 1 x 105cells per transfection. 6 PFFs cells. Since both pX459-gRNA-1 and pX459-gRNA-2 vectors carry Puro R resistance, puromycin antibiotic was used for subsequent screening. 24 h after transfection, cell screening was performed using the single colony limiting dilution method: cells were plated in 96-well plates at 50 cells / well. After 24 h, cells were cultured in DEME containing 3 pg / mL puromycin, 20% FBS for 3 days, and then replaced with DEME containing 20% FBS without puromycin until single cell colony points grew. Single cell colony points were then selected and cultured in 24-well plates. When colony points appeared in the 24-well plates, the cells were transferred to 6-well plates for continued culture, and the remaining small amount of cells were grown in 24-well plates for subsequent genomic extraction to identify mutations. Cells in the 6-well plates were frozen for storage when they reached confluence for subsequent somatic cell nuclear transfer operations.

[0038] Example 4: Detection of genetic modification and exogenous gene integration

[0039] Genomic DNA was extracted using the Genomic DNA Purification Kit (EZ Bioscoence), and then PCR detection was performed using a high-fidelity polymerase (Thermo Fisher Scientific). The primers for detecting the deletion of the long fragment gene were F1 : 5'-TGTGCTGTATATCCTCCCACAATCA-3' and R1 : 5'-ATTATGCAGACTGTTGCCTTTGGA-3'; and the primers for detecting the non-deletion of the long fragment gene were F2: 5'-GCTAATCCTCACTTATTCTGCAAGG-3' and R2: 5'-ACGTAATTGAAGGTAGAGTGGACTC-3.

[0040] F1 / R1 is located at both sides of designed gRNA1 and gRNA2 sites, and the middle is the gene fragment of intron 2 to intron 3 of long fragment TXLNB; and F2 / R2 is the primer designed according to the fragment of about 540bp of exon 3 of TXLNB gene. If the exon 3 of long fragment TXLNB gene is not deleted, the F2 / R2 primer can amplify the specific band of about 540bp, while the F1 / R1 primer cannot amplify the template completely due to the too large span, so that there is no specific band. If the exon 3 of long fragment TXLNB gene is deleted, the F1 / R1 primer can amplify the specific band of about 527bp, while the F2 / R2 primer has no specific band. The schematic diagram of TXLNB gene and the position of F1 / R1 and F2 / R2 primers is shown in Figure 1. Figure 3 .

[0041] Pure water is used as negative control. If the positive cell clone point is homozygous, there is a band of 527bp when using F1 / R1 for PCR amplification, and there is no band when using primer F2 / R2 for PCR amplification; if the positive cell clone point is heterozygous, there are bands of 527bp and 540bp respectively when using F1 / R1 and F2 / R2 primers for PCR amplification.

[0042] After about 3 days of screening, it is identified that at least one correct long fragment deletion clone point exists in 14 clone points, and the genotype is TXLNB - / - , and the deletion rate is 7.14%. The positive clone point is frozen and used as somatic cell nuclear transfer donor cell. The sequence of wild type TXLNB gene locus is 5'-TGACAATGATAAA ATATAGTATGCCTTCCGATA TGG— / / —ATAGAGC GTCTCACCTGCATGGGCCCCTCTGAGGCCCTGG-3'. After sequencing, the sequence of the deletion site of one clone point is: 5'-GACAATGATAAA ATATAGTATGCCTTCC GCATGGGCCCCTCTGAGG-3', and the schematic diagram of long fragment deletion of the positive clone point is shown in Figure 2. Figure 4 .

[0043] The cell confluence state of the positive clone point before freezing is shown in Figure 3. Figure 5 .

[0044] Obviously, the above examples are only examples for clearly illustrating, and are not limitation to the embodiments. Other different forms of changes or variations can be made by those skilled in the art on the basis of the above description. Here, all the embodiments are not required to be exhausted, and the obvious changes or variations derived therefrom are still within the protection scope of the present application.

Claims

1. A sgRNA for knocking out a TXLNB gene in a pig, characterized in that, The sequence of the sgRNA is shown as SEQ ID NO. 1-2.

2. A recombinant expression vector containing the sgRNA of claim 1.

3. A gene editing system for TXLNB gene knockout in pigs, characterized in that, The gene editing system comprises an expression frame of the sgRNA of claim 1 and a Cas9 nuclease expression frame.

4. A recombinant cell treated by the gene editing system of claim 3; the recombinant cell is a recombinant pig fibroblast cell.

5. The recombinant cell of claim 4, wherein, The TXLNB genotype of the genetically edited recombinant pig fibroblast cell is 5'- GACAATGATAAAATATAGTATGCCTTCCGCATGGGCCCCTCTGAGG-3'.

6. A method of knocking out a gene TXLNB in a porcine fibroblast cell, characterized by, Knockout is performed using the gene editing system of claim 3.

7. The method of claim 6, wherein, Gene knockout in vitro is performed using the gene editing system.

8. Use of the sgRNA of claim 1, the recombinant expression vector of claim 2, the gene editing system of claim 3, or the recombinant cell of any one of claims 4-6 in preparing an animal model; the animal model is a muscle atrophy animal model.

Citation Information

Patent Citations

  • Antisense compounds and methods for targeting CUG reductives

    CN117957022A

  • Method for knocking out APOC3 gene in porcine fetal fibroblast line by using CRISPR-CAS9 system

    CN118256560A