Key miRNA and application thereof in regulation of melanin production of liancheng white duck

By screening and validating the role of the key miRNA miR-290 in melanin production in Liancheng White Duck, and regulating the expression of ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2, the unclear mechanism of melanin production in Liancheng White Duck was resolved, providing a reference for breeding melanin traits.

CN119752893BActive Publication Date: 2025-12-09INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202411781685.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-12-05
Publication Date
2025-12-09
Estimated Expiration
2044-12-05

AI Technical Summary

Technical Problem

The molecular mechanism of melanin production in Liancheng white ducks is not fully understood, which makes it difficult to select and breed melanin traits. The role of existing miRNAs in melanocyte biology is also unclear.

Method used

The key miRNA miR-290 was screened out and its protein expression of ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 was targeted and regulated through the PI3K/Akt signaling pathway. Its role in duck melanocytes was detected by quantitative real-time PCR and Western blotting.

Benefits of technology

The molecular mechanism of melanin production in ducks was elucidated, providing a reference for the breeding of melanin traits such as black beak and green feet in Liancheng White Duck. By screening and verifying target genes, effective regulation of melanin production was achieved.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN119752893B_ABST
    Figure CN119752893B_ABST
Patent Text Reader

Abstract

The present application relates to key miRNA and its application in regulating Liancheng white duck melanin production, the miRNA is miR-290, the nucleotide sequence is: 5'-CGGGAGCGGAGCUCGGCC-3'(SEQ ID NO:1), the application of the key miRNA in regulating Liancheng Liancheng white duck melanin production, the protein expression of ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 is targeted and regulated by the miR-290 through PI3K / Akt signal path, and it is applied in the selection of Liancheng white duck melanin character, such as the selection of Liancheng white duck black melanin character such as black beak, green foot, etc.The present application screens the key miRNA of difference as the control factor of research melanocyte proliferation or apoptosis, studies the effect of key miRNA on duck melanocyte and the regulation mode of target gene, and screens the meaningful candidate target gene.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of agriculture and animal husbandry, and more particularly relates to screening of key miRNAs affecting melanin production of Liancheng white duck and application thereof in regulating melanin production of Liancheng white duck. BACKGROUND

[0002] Liancheng white duck, also known as white muscovy duck, is one of the precious and rare local waterfowl germplasm resources in China, and is a variant of small white-feathered muscovy duck in Fujian Province. It was included in "Fujian Livestock and Poultry Variety Records and Atlas" in 1985 and "Chinese Poultry Variety Records" in 1989. It was listed in "National Livestock and Poultry Genetic Resource Protection Catalogue" in 2000. Liancheng white duck is praised as "the only medicinal duck in China" due to its effects of clearing heat and detoxifying, nourishing yin and reducing fire, and stimulating appetite and invigorating spleen. The "white feather, black beak and green leg" characteristics of Liancheng white duck are unique among domestic ducks and are an ideal model for studying pigment traits of waterfowl and birds. The applicant's previous studies found that when Liancheng white duck is crossed with Beijing duck, Lijia duck and other white-feathered domestic duck breeds, all F1 generations are gray or black, which is significantly different from other white-feathered domestic duck breeds. The specificity and complexity of melanin deposition in Liancheng white duck make it difficult to breed Liancheng white duck through phenotype. Therefore, analyzing the mechanism of melanin formation from the molecular level can provide a reference for the breeding of Liancheng white duck pigment traits.

[0003] At present, more than 120 genes that regulate melanocyte development and migration, melanosome formation and melanin deposition have been found. In addition to these known genes, studies have found that although many miRNAs have been identified in the analysis of melanoma cells or samples, and more and more miRNAs target genes or pathways involved in melanocyte biology, the role of most miRNAs in the process of melanocyte biology or melanocyte development is still unclear. Many miRNAs play a crucial role in regulating melanin in the process of melanin production. In melanocytes, overexpression or inhibition of miR-145 can reduce or increase the expression levels of related genes such as Sox9, MITF, TYR, TRP1, MYO5A, Rab27a and Fscn1. The results show that miR-145 plays an important role in regulating melanin production when stimulated by external stimuli. In addition, microRNA can regulate the proliferation, apoptosis and migration of melanocytes. Upregulation of miR-21 leads to decreased apoptosis and increased proliferation of melanocytes. In alpaca melanocytes, the expression level of target gene TAK1 is reduced after transfection of miR-143-5p, thereby increasing the migration and proliferation of melanocytes and down-regulating the expression of MITF, thereby regulating the production of melanin.

[0004] The application selects Liancheng white duck as the research object, and selects differential key miRNA as a research regulator of melanocyte proliferation or apoptosis through transcriptome sequencing, studies the effect of the key miRNA on duck melanocyte and the regulation mode of the key miRNA on target genes, screens meaningful candidate target genes, and further clarifies the molecular mechanism of melanin deposition of Liancheng white duck, so as to provide certain reference for breeding of melanin traits such as black beak and green foot of Liancheng white duck. SUMMARY

[0005] The application aims to screen key miRNA affecting melanin production of Liancheng white duck and study the application of miRNA in regulating melanin production of Liancheng white duck.

[0006] The application achieves the purpose by the following technical scheme.

[0007] A key miRNA affecting melanin production of Liancheng white duck, the miRNA is miR-290, and the nucleotide sequence is 5'-CGGGAGCGGAGCUCGGCC-3'(SEQ ID NO:1).

[0008] The application of the key miRNA in regulating melanin production of Liancheng white duck, the miR-290 targets and regulates protein expression of ILK, JAK1, GSK3beta, MC1R, TRP1 and TRP2 through a PI3K / Akt signal pathway.

[0009] The application of the key miRNA in breeding of melanin traits of Liancheng white duck, such as breeding of melanin traits such as black beak and green foot of Liancheng white duck.

[0010] A detection primer of the key miRNA, the detection primer is:

[0011] A forward primer miR-290-F: 5'-TTCGGGAGCGGAGCTCGG-3'(SEQ ID NO:2),

[0012] A universal reverse primer: 5'-AGTGCAGGGTCCGAGGTATT-3'(SEQ ID NO:3).

[0013] The application of the detection primer in breeding of melanin traits of Liancheng white duck.

[0014] A kit for detecting the key miRNA, and the kit comprises the detection primer.

[0015] The kit further comprises a reverse transcription primer for miR-290, a reverse transcription reagent, a reference primer and a fluorescence quantitative PCR reaction solution.

[0016] The reverse transcription primer for miR-290 is miR-290-RT, and the sequence is as follows: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCC GA-3'(SEQ ID NO:4).

[0017] The internal reference primer comprises an internal reference gene duck U6 reverse transcription primer U6-RT and an internal reference gene duck U6 fluorescent quantitative forward primer U6-F; the sequences of the U6-RT and the U6-F are respectively:

[0018] U6-RT:

[0019] 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAA ATATG-3'(SEQ ID NO:5),

[0020] U6-F: 5'-CTCGCTTCGGCAGCACA-3'(SEQ ID NO:6).

[0021] The kit is applied to the selection of Liancheng white duck melanin traits.

[0022] Compared with the prior art, the application has the following advantages:

[0023] (1) The application selects the differential key miRNA as a regulatory factor for studying melanocyte proliferation or apoptosis, studies the effect of the key miRNA on duck melanocyte and the regulation mode of the key miRNA on the target gene, and selects a meaningful candidate target gene.

[0024] (2) The application selects the key miRNA affecting duck melanin production through transcriptome sequencing, predicts a target gene, verifies the target gene, and studies the application of the key factor miR-290 for melanin production in duck melanocyte, further clarifies the molecular mechanism for regulating duck melanin production, and provides a certain reference for the selection of Liancheng white duck melanin traits such as black beak and blue foot.

[0025] (3) The application separates duck primary melanocytes, transfects miR-290 into the duck melanocytes, and analyzes the overexpression and interference effect after transfecting mimics-NC, miR-290 mimics, inhibitor-NC and miR-290 inhibitor into the duck melanocytes. The expression levels of the target gene PI3K and the key genes AKT, ILK, JAK1, GSK3β, MC1R, TRP1, TRP2 and TYR affecting melanin formation are detected by fluorescence quantitative PCR after overexpression and interference of miR-290, the total protein of the melanocytes is separated and extracted by protein lysis solution, and the protein level is analyzed by Western Blot. The results show that, compared with the miR-NC group, the indexes of PI3K, AKT, ILK and JAK1 in the miR-290 mimics group are obviously down-regulated, and the indexes of GSK3β, MC1R, TRP1 and TRP2 are obviously up-regulated (P<0.01, P<0.001, P<0.0001); compared with the inhibitor-NC group, the indexes of PI3K, AKT, ILK and JAK1 in the miR-290 inhibitor group are obviously up-regulated, and the indexes of GSK3β, MC1R, TRP1 and TRP2 are obviously down-regulated (P<0.05, P<0.0001). It is suggested that miR-290 may target and regulate the protein expression of ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 through the PI3K / Akt signaling pathway.

[0026] (4) The technical scheme of the application is complete, complete, the data is detailed, and the experimental results are reliable. BRIEF DESCRIPTION OF DRAWINGS

[0027] Figure 1 is a target relationship verification diagram;

[0028] Figure 2 is a duck melanocyte morphology observation diagram;

[0029] Figure 3 is a qPCR detection result of duck melanocyte miR-290 overexpression and interference

[0030] Figure 4 is a qPCR detection result of duck melanocyte miR-290 overexpression and interference on PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1, TRP2 and TYR genes.

[0031] Figure 5 is a WB detection result of duck melanocyte miR-290 overexpression and interference on PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 DETAILED DESCRIPTION

[0032] The present application will be described in detail below with reference to the accompanying drawings and examples:

[0033] The present application aims to screen the key miRNA affecting the melanin production of Liancheng white duck, and study the application of miRNA in regulating the melanin production of Liancheng white duck. In order to achieve the above purpose, the technical scheme is as follows:

[0034] 1.1 Test animals and materials

[0035] Select 6 healthy 130-day-old female Liancheng white ducks raised under the same feeding conditions, and after fasting for 12 hours, slaughter, take skin and mouth skin tissue, one part is quickly put into liquid nitrogen, and then placed in-80℃ ultra-low temperature refrigerator for transcriptome sequencing analysis. Use FastQC, Trinity, HTSeq and other software to analyze the sequencing data and differential genes.

[0036] 1.2 Bioinformatics analysis

[0037] The raw data is subjected to sequencing data quality evaluation, filtering, sRNA length screening, reference genome is http: / / www.ensembl.org / Anas_platyrhynchos / Info / Index,BGI_duck_1.0(GCA_000355885.1), known miRNA analysis (mirdeep2_0_0_5), novel miRNA prediction (miREvo_v1.1), sRNA classification annotation statistics, miRNA sequencing copy number conversion to standard expression, and expression difference analysis (DEG Seq 1.2.2). The R package of SAM software is used to screen the differential expression miRNAs, and cluster analysis is carried out. miRanda-3.3a, PITA and RNAhybrid are used for miRNA target gene prediction, and the corresponding relationship between miRNA and target gene is obtained, and finally the candidate target gene GeneOntology (Release2.12, GO, http: / / www.geneontology.org / ) and KEGG (Kyoto Encyclopedia of Genes and Genomes) function annotation analysis.

[0038] 1.3 Duck melanocyte transfection and total RNA extraction and quality identification

[0039] After the cells are resuscitated, special culture solution is used for resuscitation, and 37℃ culture is carried out until the confluence degree is about 90%, and the cells are trypsinized, and the six-well plate is subcultured at a density of 5×10^5 / ml.

[0040] Dissolve 5nmol or more of miR-290 mimics / NC and miR-290 inhibitor / NC (purchased from Guangzhou Ribobio) in 250μl RNase-Free ddH2O to dilute to 50μM.

[0041] When the cell confluence is about 70%, replace the culture medium with fresh serum-free medium; then use Lipofectamine TM 3000 Transfection Reagent to transfect the cells, divide into 5 groups, 3 parallel samples in each group, the 5 groups including control group (i.e. untreated group) and A, B, C, D groups shown in Table 1, wherein, A group is miR-mimics-NC group (transfected with mimics-NC), B group is miR-290 mimics group (transfected with miR-290 mimics), C group is miR-inhibitor-NC group (transfected with inhibitor-NC), D group is miR-290-inhibitor group (transfected with miR-290 inhibitor), the cell transfection reaction system and reaction conditions are shown in Table 2.

[0042] Table 1 Experimental grouping

[0043]

[0044] Table 2 Cell transfection reaction system and conditions

[0045]

[0046] Replace with special melanocyte complete culture medium the next day and continue to culture to 72hr, collect samples for quantitative PCR and Western Blot detection analysis.

[0047] Extract total RNA from each group of cells using TRIzol Regent, detect RNA concentration and purity using NanoDrop2000 ultramicro spectrophotometer, and detect its integrity using 1% agarose electrophoresis.

[0048] 1.4 Fluorescent quantitative PCR detection of miR-290 expression level

[0049] 1) miRNA reverse transcription: stem-loop reverse transcription was performed using miRNA 1st Strand cDNA Synthesis Kit, the primers are shown in Table 3, and the reaction system and conditions are as follows: 500 ng total RNA, 2 μl gDNA Wiper buffer, RNase-free H2O was added to 8 μl, 42°C for 2 min; then 2 μl HiScript II Enzyme Mix, 2 μl RT Buffer, 1 μl miR-290-RT (2 μM) or U6-RT (2 μM) (internal reference) were added, and finally RNase-free H2O was added to 20 μl. The mixture was placed in a PCR instrument, 25°C for 5 min, 50°C for 15 min, 85°C for 5 min; then stored at 4°C for standby.

[0050] 2) Fluorescent quantitative PCR detection: duck U6 was used as an internal reference gene, and the forward primer sequence is shown in Table 4. Fluorescent quantitative PCR was performed using PowerUp SYBR TM Green MasterMix kit, the reaction system was as follows: 10 μl PowerUp SYBR TM Green MasterMix, 4 μl cDNA (cDNA stock solution was diluted 1:10), 0.5 μl forward primer (10 μM), 0.5 μl universal reverse primer (10 μM) (sequence: 5' AGTGCAGGGTCCGAGGTATT 3', SEQ ID NO: 3), and finally H2O was added to 20 μl. The reaction conditions were as follows: 95°C for 1 min; 95°C for 15 sec, 60°C for 25 sec, for a total of 40 cycles. Three replicate wells were set for each sample, and the relative expression was calculated using the 2 -ΔΔCt method.

[0051] Table 3 miRNA reverse transcription stem-loop primer sequence, quantitative PCR forward primer

[0052]

[0053] The nucleotide sequence of the miR-290 is: 5'-cgggagcggagcucggcc-3' (SEQ ID NO: 1).

[0054] 1.5 Duck beak melanocyte primary separation and culture

[0055] Soak duck beaks in alcohol for 10 minutes, then remove them with tweezers and place them in a culture dish. Wash several times with PBS. Carefully remove the epidermis from the duck beaks with tweezers, and place the skin containing melanocytes into a culture dish containing 3% penicillin-dextrose antimicrobial (PDTA) solution. Use ophthalmic scissors to cut the skin containing melanocytes into 1mm × 1mm fragments. Wash with PDTA-free PDTA solution, discard the supernatant, and repeat the washing process three times. Digest with 2% Dispase II for 110 minutes, then digest with trypsin for 10 minutes. After digestion, add complete culture medium to stop the digestion, centrifuge to discard the supernatant, repeat twice, and then pass the cells through a 200-mesh sieve. Finally, resuspend the cells in complete culture medium and culture them in six-well plates. After culturing for 12 hours, discard the culture medium. Change the culture medium every 2-3 days until the cells are completely confluent. Once the cells have reached confluence, digest them with 0.25% trypsin containing EDTA and passage them at a 1:2 ratio. After passage 5, identify the cells.

[0056] 1.6 Detection of gene expression levels of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1, TRP2 and TYR by real-time quantitative PCR

[0057] cDNA synthesis: using The Reverse Transcription Kit reverse transcribes extracted total RNA into cDNA. The reaction system and conditions are as follows: 500 ng total RNA, 2 μl gDNA Wiper buffer, RNase-free H2O added to 14 μl, treated at 42℃ for 2 min; then add 1 μl QuantiScript RTase, 4 μl QuantiScript RT Buffer, and 1 μl RT Primer Mix, incubate the mixture at 42℃ for 10 min, and finally store at 4℃ for later use.

[0058] Quantitative real-time PCR detection: Duck β-actin was used as an internal reference gene. The specific primer sequences for quantitative real-time PCR of the internal reference gene and the target gene are shown in Table 4. Quantitative real-time PCR was performed using PowerUp SYBR. TM The Green Master Mix kit reaction system contains 10 μl of PowerUp SYBR. TM Green Master Mix, 1 μl cDNA, 0.5 μl forward primer (10 μM), 0.5 μl reverse primer (10 μM), and H2O added to a final volume of 20 μl. Reaction conditions: 95℃, 1 min; 95℃, 15 sec; 63℃, 25 sec, for a total of 40 cycles. Each sample was tested in triplicate, and the relative expression levels were calculated using a 2:1 ratio. (Ct内参基因-Ct目的基因) Perform calculations and analysis.

[0059] Table 4 quantitative PCR gene name, gene sequence number, primer sequence and amplification length

[0060]

[0061]

[0062] Statistical processing

[0063] Statistical analysis was performed using SPSS19.0 software, and the results were expressed as mean ± standard deviation (Mean ± SD). Independent sample t-test was used for comparison between groups. When P < 0.05 (*), it was considered that the difference was significant, and when P < 0.01 (**), it was considered that the difference was extremely significant.

[0064] 1.7 Western Blot detection of protein level

[0065] After 72 hours of transfection, the cells were lysed with RIPA cell lysis buffer, total protein was extracted and quantified. 60 μg of total protein was added to 5x protein loading buffer (containing DTT), boiled for 10 min, then loaded for SDS-PAGE electrophoresis, and then transferred to PVDF membrane, then 5% skim milk powder was blocked at room temperature for 1 hr, primary antibody was added, and the shaking bed was incubated at 4°C overnight. After T-TBS rinsing, secondary antibody was added, incubated at room temperature for 1 hr, rinsed several times with T-TBS, and finally ECL chemiluminescence reagent was added in the dark room for exposure and development. After scanning, Image Pro Plus 6.0 software was used to analyze the optical density of each band, each band was repeated for 3 times, and the relative expression of the target protein was represented as {target protein (optical density value) / internal reference (optical density value)}x10. The results were expressed as mean ± standard deviation.

[0066] Table 5 Western Blotting primary and secondary antibody information

[0067]

[0068]

[0069] The application screens the differential key miRNA as a regulatory factor for studying melanocyte proliferation or apoptosis, studies the effect of the key miRNA on duck melanocyte and the regulation mode of the key miRNA on the target gene, screens the meaningful candidate target gene, further clarifies the molecular mechanism of melanin deposition of Liancheng white duck, and provides certain reference for breeding of melanin traits such as black beak and green foot of Liancheng white duck.

[0070] 2. Experimental results

[0071] 2.1 Screening of differential miRNA by transcriptome sequencing, functional annotation and prediction of target genes of miRNA

[0072] The RNA-Seq sequencing of Liancheng white duck bill skin and skin tissue was performed by Illumina PE150. A total of 12 differential miRNAs were screened out in Liancheng white duck bill skin vs skin tissue, of which 7 were up-regulated and 5 were down-regulated. The partial KEGG annotation data of the target genes of the differential expression miRNAs showed that the herpes simplex virus 1 infection pathway, MAPK signaling pathway, focal adhesion signaling pathway, NOD-like receptor pathway, and RIG-I-like receptor signaling pathway were significantly different in LCZ vs LCP group (P<0.05). The herpes simplex virus 1 infection pathway included miRNAs novel_144, novel_146, novel_197, novel_201, novel_290 (miR-290), novel_351, and novel_353 corresponding to the target gene PI3K, which might inhibit the generation of tissue melanin.

[0073] 2.2 Verification of the targeting relationship between miR-novel-290 (miR-290) and PI3K

[0074] The potential interaction sites of miR-290 and PI3K were predicted. The potential interaction between PI3K and miR-290 was further verified by constructing a reporter plasmid of the potential interaction site of PI3K and using a dual luciferase reporter system. The results are shown in Figure 1

[0075] The results showed that compared with the miR-NC / miR-290-Wt co-transfection group, the relative fluorescence value of the miR-290 / PI3K-Wt co-transfection group was reduced (P<0.01); compared with the miR-NC / PI3K-Mut, the relative fluorescence value of the miR-290 / PI3K-Mut was reduced, but there was no significant difference (P<0.05); compared with the miR-290 / PI3K-Wt, the relative fluorescence value of the miR-290 / PI3K-Mut was significantly increased (P<0.01), which indicated that miR-290 effectively combined with the 3-UTR region of PI3K gene, and the mutation affected the binding capacity between them.

[0076] 2.3 Observation of the morphology of duck melanocyte cells

[0077] One week after the primary cell separation, the cells were observed under an inverted microscope and photographed. The cells were long spindle-shaped and connected into a reticular interweaving distribution, which could be passaged (see Figure 2 ).

[0078] 2.4 Analysis of the overexpression and interference effects of duck melanocyte cell miR-290

[0079] ​According to the results of 1.4 fluorescence quantitative PCR, compared with the mimics-NC group, the miR-290 mimics transfection group was up-regulated by 1.88 times, and the difference was statistically significant (P<0.001); similarly, compared with the inhibitor-NC transfection group, the miR-290 inhibitor transfection group was down-regulated by 0.46 times, and the difference was statistically significant (P<0.01). The specific results are shown in Figure 3 .

[0080] 2.5 Detection of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1, TRP2 and TYR gene expression levels in duck melanocytes

[0081] 1.6 Partial fluorescence quantitative PCR was used to detect the expression levels of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1, TRP2 and TYR after overexpression and interference of miR-290, and the results showed that compared with the respective control, the PI3K and AKT gene expression levels in the miR-290 mimics group were down-regulated (P<0.05, P<0.01), the ILK, GSK3β, MC1R, TRP1, TRP2 and TYR gene expression levels were up-regulated (P<0.001, P<0.0001), and the JAK1 index had no difference; the PI3K and AKT gene expression levels in the miR-290 inhibitor group were up-regulated (P<0.05, P<0.01), the ILK, GSK3β, MC1R, TRP1, TRP2 and TYR gene expression levels were down-regulated (P<0.05, P<0.01), and the JAK1 index had no difference. The specific results are shown in Figure 4 The original data is shown in the appendix. It is inferred that the expression of miR-290 is negatively correlated with PI3K and AKT, positively correlated with ILK, GSK3β, MC1R, TRP1, TRP2 and TYR, and possibly has no correlation with JAK1.

[0082] 2.6 Detection of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 protein expression levels in duck melanocytes

[0083] 1.7 Western Blot was used to analyze the protein expression levels of PI3K, AKT, ILK, JAK1, GSK3β, MC1R, TRP1 and TRP2 in the four groups of mimics-NC, miR-290 mimics, inhibitor-NC and miR-290 inhibitor. The results showed that, compared with the mimics-NC group, the indicators of PI3K and AKT in the miR-290 mimics group were significantly down-regulated (P<0.001, P<0.0001), the indicator of JAK1 had no difference, and the indicators of ILK, GSK3β, MC1R, TRP1 and TRP2 were significantly up-regulated (P<0.05, P<0.01, P<0.001, P<0.0001). Compared with the inhibitor-NC group, the indicators of PI3K and AKT in the miR-290 inhibitor group showed a significant up-regulation trend (P<0.01, P<0.0001), the indicator of JAK1 had no difference, and the indicators of ILK, GSK3β, MC1R, TRP1 and TRP2 were significantly down-regulated (P<0.05, P<0.01, P<0.001). The specific results are shown in Table 1, and the raw data is shown in the appendix. It is suggested that miR-290 may target and regulate the protein expression of ILK, GSK3β, MC1R and TYR through the PI3K / Akt signaling pathway. Figure 5

[0084] The above description is only the preferred embodiment of the present application, and any equivalent changes and modifications made within the scope of the present application should be included in the scope of the present application.​

Claims

1. A key miRNA affecting melanin production of Liancheng white duck, characterized in that: The miRNA is miR-290, and its nucleotide sequence is 5'-CGGGAGCGGAGCUCGGCC-3'(SEQ ID NO:1).

2. The key miRNA for use in regulating melanogenesis in Liancheng Liancheng white duck according to claim 1, characterized in that: The miR-290 targets and regulates protein expression of ILK, JAK1, GSK3ss, MC1R, TRP1 and TRP2 through a PI3K / Akt signaling pathway. 3.The application of the key miRNA in the selection of Liancheng white duck melanin traits.

4. The detection primer of the key miRNA according to claim 1, characterized by: The detection primer is: Forward primer miR-290-F: 5'-TTCGGGAGCGGAGCTCGG-3', Universal reverse primer: 5'-AGTGCAGGGTCCGAGGTATT-3'. 5.The application of the detection primer in the selection of Liancheng white duck melanin traits according to claim 4.

6. A kit for detecting the key miRNAs of claim 1, characterized by: It comprises the detection primer according to claim 4.

7. The kit of claim 6, wherein: The kit further comprises a reverse transcription primer for miR-290, a reverse transcription reagent, an internal reference primer and a fluorescent quantitative PCR reaction solution.

8. The kit of claim 7, wherein: The reverse transcription primer for miR-290 is miR-290-RT, and its sequence is as follows: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGGCC GA-3'.

9. The kit of claim 7, wherein: The internal reference primer comprises an internal reference gene duck U6 reverse transcription primer U6-RT and an internal reference gene duck U6 fluorescent quantitative forward primer U6-F; the sequences of the U6-RT and the U6-F are as follows: U6-RT: 5'-GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAAA ATATG-3', U6-F: 5'-CTCGCTTCGGCAGCACA-3'. 10.The application of the kit in the selection of Liancheng white duck melanin traits according to any one of claims 6-9.

Citation Information

Patent Citations

  • Regulating function of miR-290 family in mouse embryonic stem cell

    CN103285404A

  • Use of MicroRNA for Assessing Embryos Grown in Vitro and Improving Culture Media

    US20140296099A1