Method for constructing a PLSCR1 gene knockout mouse model in MRL / Lpr genetic background using CRISPR / Cas9

Abstract

The present invention belongs to the field of gene editing technology, and specifically relates to a method for constructing a PLSCR1 gene knockout mouse model in an MRL / Lpr genetic background using CRISPR / Cas9. The technical problem to be solved by the present invention is to create a PLSCR1 gene knockout mouse to further study the role of PLSCR1 in physiology and pathology. The technical scheme of the present invention is a method for constructing a PLSCR1 gene knockout mouse model in an MRL / Lpr genetic background using CRISPR / Cas9, comprising the following steps: S1, designing gRNA for the PLSCR1 gene, and constructing a CRISPR / Cas9 vector; S2, obtaining F0 generation mice, and screening out positive F0 generation mice; S3, hybridizing positive F0 generation mice with wild-type mice to obtain F1 generation mice, and self-pollinating F1 generation heterozygous mice to obtain homozygous F2 generation. By constructing PLSCR1 gene knockout mice in an MRL / lpr background, it helps to explore the mechanism of autoimmune diseases in depth and open up new research directions.

Description

Technical Field

[0001] The present invention belongs to the technical field of gene editing, and specifically relates to a method for constructing a PLSCR1 gene knockout mouse model in an MRL / Lpr genetic background by using CRISPR / Cas9. Background Art

[0002] The protein encoded by the PLSCR1 (phospholipid scramblase 1) gene plays an important role in cell membrane phospholipid transport and cell signaling, involving multiple biological processes such as cell proliferation, apoptosis, and immune response. In recent years, studies have found that PLSCR1 is abnormally expressed in diseases related to immune system disorders and inflammation, and is closely related to the development of systemic lupus erythematosus (SLE) and certain tumors. Systemic lupus erythematosus is a complex autoimmune disease characterized by the immune system attacking its own tissues, leading to chronic inflammation, tissue damage, and multi-organ dysfunction. So far, its specific pathogenic mechanism is not fully understood. Current SLE treatments include immunosuppressants and biological agents. Although they can alleviate symptoms, it is still difficult to control the disease in the long term, and there are side effects and risks of recurrence. Therefore, exploring new targets related to the onset of SLE is of great scientific and clinical significance.

[0003] MRL / lpr mice are currently a classic model for studying SLE, because they carry lpr mutations that lead to programmed cell death defects, causing excessive lymphocyte proliferation and immune dysregulation, and showing immune deficiency and autoimmune disease symptoms similar to human SLE. Studying the function of PLSCR1 in the context of MRL / lpr can provide direct model support for exploring its specific role in SLE. However, there is still a lack of PLSCR1 gene knockout models in existing animal models, so it is difficult to deeply reveal the potential impact of PLSCR1 on SLE. Traditional gene editing technology has problems of low efficiency and poor specificity when knocking out the PLSCR1 gene, which affects the reliability of the research results.

[0004] The construction of a PLSCR1 knockout mouse model in the MRL / lpr background provides an experimental platform for in-depth study of the mechanism of action of PLSCR1 in SLE. This will help promote the therapeutic application of PLSCR1 in autoimmune diseases such as SLE and provide new theoretical basis and potential targets for this field. Summary of the invention

[0005] The technical problem to be solved by the present invention is to explore the role of the PLSCR1 gene in SLE, create PLSCR1 gene knockout mice, and provide an effective experimental model to deeply study the role of PLSCR1 in physiology and pathology.

[0006] The technical solution of the present invention is a method for constructing a PLSCR1 gene knockout mouse model in an MRL / Lpr genetic background using CRISPR / Cas9, comprising the following steps: S1. Design gRNA targeting PLSCR1 gene and construct CRISPR / Cas9 vector; S2, prepare fertilized eggs, transfer the CRISPR / Cas9 expression system into the fertilized eggs; transplant the fertilized eggs into surrogate mice; obtain F0 generation mice, and screen out positive F0 generation mice; S3. Positive F0 mice were crossed with wild-type mice to obtain F1 mice, and the F1 heterozygous mice were self-pollinated to obtain homozygous F2 mice, thereby constructing a PLSCR1 gene knockout mouse model with MRL / Lpr genetic background.

[0007] Furthermore, in step S1, the nucleotide sequence of gRNA is shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.4.

[0008] The present invention also provides a PLSCR1 gene knockout mouse model with an MRL / Lpr genetic background obtained by the above method.

[0009] The present invention also provides the use of the PLSCR1 gene knockout mouse model with MRL / Lpr genetic background as an experimental tool in studying autoimmune diseases.

[0010] Specifically, the autoimmune disease is systemic lupus erythematosus.

[0011] The present invention also provides the use of the PLSCR1 gene knockout mouse model with the MRL / Lpr genetic background in developing or screening drugs for treating autoimmune diseases.

[0012] Specifically, the autoimmune disease is systemic lupus erythematosus.

[0013] Beneficial effects of the present invention: 1. Construction of a specific model: By creating PLSCR1 knockout mice, an effective experimental model is provided to deeply study the role of PLSCR1 in physiology and pathology.

[0014] 2. Improve gene editing efficiency: Use CRISPR / Cas9 technology to improve the efficiency and accuracy of PLSCR1 gene knockout, thereby obtaining reliable experimental results.

[0015] 3. In-depth study of gene function: Provide experimental evidence for the function of PLSCR1 in cell proliferation, apoptosis and immune response, and promote the understanding of its biological mechanism.

[0016] 4. Promote the research on autoimmune diseases: By constructing PLSCR1 knockout mice under the MRL / lpr background, we can help to explore the mechanism of autoimmune diseases in depth and open up new research directions. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 , Primer 1 and Primer 2 identify pure heterozygous PLSCR1 knockout mice, and only 566bp can be run, indicating that the PLSCR1 knockout mice are homozygous. The first loading well of Primer 1 runs 566bp, indicating that it is a homozygous PLSCR1 knockout mouse, and the corresponding position of the WT loading well of Primer 2 indicates that it is wild type. Sample loading instructions: The first loading well added PLSCR1 knockout mouse DNA sample, WT added wild-type MRL / lpr DNA sample; Water did not add any DNA sample, only water; M represents the addition of DNA marker, which is used to display the sample molecular weight.

[0018] Figure 2 Primers 3 and 4 identify pure heterozygous MRL / lpr mice. They can only run 500bp, which means that the MRL / lpr mouse background is homozygous. The first loading well of primer 3 runs 500bp, which means it is a homozygous MRL / lpr mouse. The corresponding position of the corresponding well of primer 4WT indicates that it is a wild-type MRL / lpr mouse. Sample addition instructions: The first loading well and WT well are added with wild-type MRL / lpr DNA samples; Water does not add any DNA sample, only water; M represents the addition of DNA marker, which is used to display the sample molecular weight.

[0019] Figure 3 , Knockout strategy model diagram: Orange represents exons, yellow represents the area to be knocked out, and pink represents the Mir6386 site. The positions shown by gRNA-A1, gRNA-B1, gRNA-A2, and gRNA-B2 are insertion sites, and the exon 3 to exon 7 region of the Plscr1 gene is pre-knocked out.

[0020] Figure 4, The sequencing results are compared by a BLAST-like alignment tool (BLAT), which is designed to find sequences with 95% or more similarity of at least 40 bases, and can achieve 100% alignment similarity in exon 3 and exon 7. QUERY, indicates the name of the query sequence; SCORE, the score, the higher the score, the better the alignment, and the parameters are sorted by score; START, the starting position of the query alignment; END, the end position of the query alignment; QSIZE, indicates the length of the query sequence; IDENTITY, the alignment similarity; CHROM, which chromosome it is located on; STRAND, indicates whether it is located on the positive or negative strand of the chromosome; START, indicates the starting position of the chromosome; END, indicates the ending position of the chromosome; SPAN, indicates the span of the alignment position on the chromosome. DETAILED DESCRIPTION

[0021] To better illustrate the purpose, technical solutions and advantages of the present invention, the present invention will be further described below in conjunction with the accompanying drawings and specific embodiments. It should be understood by those skilled in the art that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0022] Unless otherwise specified, the experimental methods used in the examples are all conventional methods; the materials, reagents, etc. used, unless otherwise specified, can be obtained from commercial channels.

[0023] sgRNA design: Design specific sgRNA (small guide RNA) for the PLSCR1 gene (NCBI accession number: NM_011636.3). sgRNA design usually designs two pairs of sgRNA for each target gene. The purpose is to: Improve knockout efficiency: Different sgRNA sites have different cutting efficiencies, so designing multiple pairs of sgRNAs can improve the knockout efficiency and ensure that at least one pair can effectively cut the target gene. Avoid off-target effects: Multiple sgRNAs can effectively avoid off-target effects. If the target sequence of a certain sgRNA is off-target, other sgRNAs may still be able to successfully knock out the target gene. Target site selection: Sometimes it may be necessary to design sgRNAs from different sites to avoid secondary structures or other editing difficulties that may exist in certain regions of the gene. In summary, designing two pairs of sgRNAs can ensure the reliability and efficiency of the knockout process. Select a suitable target sequence (such as Figure 3 As shown in the figure), to ensure its specificity and effectiveness. The details are as follows: gRNA-A1 (forward strand matching gene): CTACATATTTAACAACCTTCAGG (SEQ ID No. 1); gRNA-A2 (forward strand matching gene): AAAAAGCAGAGGTCGGTAATTGG (SEQ ID No. 2); gRNA-B1 (forward strand of the matching gene): CATATCTTGCAAAATAATACTGG (SEQ ID No. 3); gRNA-B2 (forward strand matching gene): AAAAGCAGAGGTCGGTAATTGGG (SEQ ID No. 4).

[0024] CRISPR / Cas9 vector construction: Clone the sgRNA sequence into the CRISPR / Cas9 expression vector to construct a plasmid that can express Cas9 protein and sgRNA. Cloning process: Select the appropriate CRISPR / Cas9 vector pX330 (purchased from Saiye Biotechnology Co., Ltd.), which contains the Cas9 gene and a U6 promoter region, and can express Cas9 protein and sgRNA in mouse cells; sgRNA synthesis and cloning: Synthesize the sgRNA sequence of the target PLSCR1 gene by chemical synthesis or PCR. Use the restriction enzyme BsaI to clone the sgRNA sequence downstream of the U6 promoter of the vector; Vector transformation and screening: Transform the recombinant plasmid into the Escherichia coli DH5α strain, and screen the positive clones with antibiotics. Select clones containing the target sgRNA sequence and culture them; plasmid extraction and verification: extract plasmids from positive strains, use restriction analysis to confirm that sgRNA is inserted into the vector, and then verify whether the construction is correct by sequencing; successful construction verification: restriction analysis: use appropriate restriction endonucleases to verify whether the sgRNA sequence is correctly inserted; sequencing verification: confirm the correctness of the sgRNA sequence by Sanger sequencing, exon 3 and exon 7 of the Plscr1 gene are the target regions, and the sequencing results are as follows Figure 4 The sequencing results were compared using a BLAST-like alignment tool (BLAT), which was designed to find sequences with 95% or higher similarity of at least 40 bases, and a 100% alignment similarity rate was achieved in both exon 3 and exon 7.

[0025] Preparation of fertilized eggs: 3-4 week old MRL / lpr female mice (purchased from Saiye Biotechnology Co., Ltd.) were selected and injected with pregnant mare serum (PMSG) and human chorionic gonadotropin (hCG) respectively, with an interval of 46-48 hours between the two. After HCG injection, the MRL / lpr female mice were mated with adult fertile male mice to fertilize the MRL / lpr female mice. The next day, the MRL / lpr female mice were euthanized, and the fertilized eggs were collected from the oviducts and placed in a constant temperature 37°C 5% CO2 incubator for later use.

[0026] Electroporation of fertilized eggs: Turn on the electroporator, connect the positive and negative electrodes, set the electroporation parameters, and set aside; place the prepared fertilized eggs in acid solution to weaken the zona pellucida for 10-20 seconds; at the same time, add the prepared CRISPR / Cas9 mRNA solution to the electrode dish; wash the weakened fertilized eggs 3 times and transfer them to the electrode dish for electroporation. During the electroporation process, CRISPR / Cas9 mRNA interacts with the fertilized eggs and is introduced into the egg cells through the action of the electric field to start gene editing; after electroporation, the fertilized eggs are transferred to M16 culture medium and placed in a 37°C constant temperature 5% CO2 incubator for 0.5-1 hour before transplantation; or culture to 2 cells and transplant the next day.

[0027] Preparation of surrogate mice and embryo transplantation: Select fertile female mice of appropriate age to mate with male mice sterilized after vasectomy, stimulate a series of pregnancy changes in the female mice to obtain pseudo-pregnant female mice, and use them as surrogate mice after fertilized eggs are transgenic; transplant the fertilized eggs in the above steps into the fallopian tubes of surrogate female mice on the day of thrombus formation; after transplantation, place the surrogate female mice in a clean cage and keep them warm until they wake up and then return them to the cage for breeding; after successful fallopian tube transplantation, the female mice will generally give birth 19 to 20 days after the operation; one week after the mice are born, the mice can be clipped and numbered, and PCR identification can be performed at the same time. Three weeks after the mice are born, they can be raised independently in separate cages.

[0028] The identification process is as follows: 1-2 weeks after birth, collect tail (2-3 mm) or toe tissues, and wash the sample surface with 70% ethanol to avoid contamination. Use a rapid DNA extraction kit or conventional proteinase K digestion method to extract DNA. Place the sample in lysis buffer (containing proteinase K) and incubate at 37°C for 1-2 hours or 56°C for 30 minutes to lyse the cells. Use the phenol-chloroform method to extract DNA. Add isopropanol to precipitate DNA, wash and dissolve in TE buffer. Measure the DNA concentration and dilute to a concentration suitable for PCR reaction (40 ng / μL). The primers used are upstream primer (F1): 5'-ACACGATGCAGACCATACTCTATT-3' (SEQ ID No.13), downstream primer (R1): 5'-TGAGACAGGGATTCTCACTTGCTG-3' (SEQ ID No.14). PCR amplification, PCR reaction system (20 μL system): gDNA template 20-50 ng, 10× PCR buffer 2 μL, dNTP mixture 0.2 mM, each primer 0.5 μM, Taq DNA polymerase 1 U, ddH2O supplemented to 20 μL. PCR program: 95℃, 5 minutes, pre-denaturation, 95℃, 30 seconds; 58-62℃, 30 seconds; 72℃, 30 seconds, 35 cycles, 72℃, 5 minutes, extension. PCR products were electrophoresed on 1.5-2% agarose gels, using DNA markers of appropriate size. A total of 36 F0 mice were obtained, and 13 positive mice were identified.

[0029] Generation and establishment of knockout mice: Mice with foreign genes are mated and generation is carried out with mice that are not transgenic. The F1 mice born are identified. The F0 that can be transmitted through the normal reproductive system has a 50% chance of carrying the integrated target gene in its offspring. The obtained F1 positive mice can be used for experiments and continued generation. The positive F1 from the same source is mated with siblings, and the F2 mice born have a 25% probability of being homozygous. A total of 6 F1 mice were obtained, including 4 Plscr1+ / - mice, 3 male mice, and 1 female mouse. 9 F2 mice were obtained, including 8 positive mice, 1 Plscr1- / - female mouse, and 7 Plscr1+ / - male mice. Plscr1- / - mice were screened. The stable generation of the established lineage, these positive mice (especially homozygous and heterozygous) will be used as subsequent established lineage mice for stable genetic transmission. Initial mating: First, these positive mice (Plscr1+ / - heterozygotes and Plscr1- / - homozygotes) need to be mated with mice of the same genotype or mice of other genotypes to ensure a good genotype distribution in the next generation (F3 generation). Mating purpose: Heterozygous mating: If the F2 generation Plscr1+ / - heterozygous male mice are mated with Plscr1+ / - heterozygous female mice, a 50% probability of Plscr1+ / - heterozygotes, 25% of Plscr1- / - homozygotes, and 25% of Plscr1+ / + wild type can be obtained. Homozygous mating: If the genotypes of the Plscr1- / - homozygous female and male mice obtained in the F2 generation are correct, these homozygotes can be mated to obtain 100% Plscr1- / - homozygous offspring. Genotyping and screening: After mating, genotyping must be performed after each generation of mice is born (such as by PCR amplification of the target gene region) to ensure the correctness of the knockout of the target gene (PLSCR1). At the same time, the generation status and pedigree should be recorded.

[0030] PCR is used to amplify a specific region of the PLSCR1 gene. Amplification is performed on the F0 generation (founder generation) mice to confirm that the PLSCR1 gene has been successfully knocked out. When genotyping the F1 generation and subsequent generations, PCR amplification is also performed to confirm whether the target gene has been transmitted and to screen for heterozygotes, homozygotes, and wild-type. In the F0 generation of mice, the knockout mice obtained by PCR and genotyping usually result in Plscr1+ / - heterozygotes and Plscr1- / - homozygotes. In the F1 and F2 generations, genotyping is also performed to ensure the transmission of the knockout gene and to screen for the correct genotype (i.e., Plscr1+ / - heterozygotes and Plscr1- / - homozygotes). In the F2 generation, it is expected that there will be 25% homozygotes (Plscr1- / -) and 50% heterozygotes (Plscr1+ / -), while 25% are wild-type.

[0031] Amplification primers Primer 1 and Primer 2 identified pure heterozygosity of knockout, and Primer 3 and Primer 4 identified pure heterozygosity of mouse background. A total of 6 F1 mice were obtained, including 4 Plscr1+ / - mice, 3 male mice, and 1 female mouse; 8 positive F2 mice were obtained, including 1 Plscr1- / - female mouse and 7 Plscr1+ / - male mice.

[0032] Primer 1: annealing temperature 60.0 °C, product size 566 bp; Forward primer: 5'-ACACGATGCAGACCATACTCTATT-3' (SEQ ID No. 5); Reverse primer: 5'-TGAGACAGGGATTCTCACTTGCTG-3' (SEQ ID No. 6).

[0033] Primer 2: annealing temperature 60.0 °C, product size 423 bp; Forward primer: 5′-ATGAAAAGAACGTATCCCGATA-3′ (SEQ ID No. 7); Reverse primer: 5'-CAAGTCTTTAGACAAGAGTGGT-3' (SEQ ID No. 8).

[0034] If it is a homozygous knockout: a single band is located at 566 bp; if it is a heterozygous knockout: two bands are located at 566 bp and 423 bp; wild type: a single band is located at 423 bp. Figure 1 . Primer 1 and Primer 2 identify the pure heterozygous PLSCR1 gene knockout mice. Only 566bp can be run, indicating that the PLSCR1 gene knockout mice are homozygous. The first loading well of Primer 1 runs 566bp, indicating that it is a homozygous PLSCR1 gene knockout mouse, and the corresponding position of the WT loading well of Primer 2 indicates that it is wild type. Sample loading instructions: The first loading well is added with the DNA sample of the PLSCR1 gene knockout mouse, and the WT is added with the DNA sample of the wild-type MRL / lpr; Water does not add any DNA sample, only water is added, and M represents the addition of a DNA marker, which is used to display the sample molecular weight.

[0035] Primer 3: annealing temperature 60.0°C, product size 500 bp; Forward primer: 5'-TTGCTCCAGACTCTCTTGCTTTAC-3' (SEQ ID No.9), Reverse primer: 5'-CAACGTGAACGGTTCGACTGAG-3' (SEQ ID No. 10).

[0036] Primer 4: annealing temperature 60.0°C, product size 330 bp; Forward primer: 5'-TTGCTCCAGACTCTCTTGCTTTAC-3' (SEQ ID No.11), Reverse primer: 5'-CTCAGTGCAGCAAATGTACAGGGAA-3' (SEQ ID No. 12).

[0037] If homozygous: single band at 500 bp; if heterozygous: two bands at 500 and 330 bp; wild type: single band at 330 bp. Figure 2 As shown. Primers 3 and 4 identify pure heterozygotes of MRL / lpr mice. Only 500bp can be run, indicating that the background of MRL / lpr mice is homozygous. The first loading well of primer 3 runs 500bp, indicating that it is a homozygous MRL / lpr mouse. The corresponding position of the corresponding well of primer 4WT indicates that it is a wild-type MRL / lpr mouse. Sample loading instructions: The first loading well and WT well are added with wild-type MRL / lpr DNA samples; Water does not add any DNA sample, only water is added, and M represents the addition of DNA marker, which is used to display the sample molecular weight.

Claims

1. A method for constructing a PLSCR1 knockout mouse model in an MRL / Lpr genetic background using CRISPR / Cas9, characterized in that: The steps include: S1. Design gRNA targeting PLSCR1 gene and construct CRISPR / Cas9 vector; S2, prepare fertilized eggs, transfer the CRISPR / Cas9 expression system into the fertilized eggs; transplant the fertilized eggs into surrogate mice; obtain F0 generation mice, and screen out positive F0 generation mice; S3. Positive F0 mice were crossed with wild-type mice to obtain F1 mice, and the F1 heterozygous mice were self-pollinated to obtain homozygous F2 mice, thereby constructing a PLSCR1 gene knockout mouse model with MRL / Lpr genetic background.

2. The method according to claim 1, characterized in that: In step S1, the nucleotide sequence of gRNA is shown as SEQ ID No.1, SEQ ID No.2, SEQ ID No.3 and SEQ ID No.

4.

3. A PLSCR1 gene knockout mouse model with an MRL / Lpr genetic background obtained by the method of claim 1 or 2.

4. Use of the PLSCR1 gene knockout mouse model with MRL / Lpr genetic background as claimed in claim 3 as an experimental tool in studying autoimmune diseases.

5. The application according to claim 4, characterized in that: The autoimmune disease is systemic lupus erythematosus.

6. Use of the PLSCR1 gene knockout mouse model with MRL / Lpr genetic background as claimed in claim 3 in developing or screening drugs for treating autoimmune diseases.

7. The use according to claim 6, characterized in that: The autoimmune disease is systemic lupus erythematosus.

Images