Application of LpDUF707-1 gene in regulating plant root growth and drought stress response
By cloning and validating the LpDUF707-1 gene, constructing overexpression and RNAi vectors, and transforming the hairy roots of *Gynostemma pentaphyllum* with *Agrobacterium*, the problem of scarce drought-resistant gene resources in *Gynostemma pentaphyllum* was solved, and root growth was promoted and drought resistance was improved.
Patent Information
- Application Number
- CN202411565073.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-05
- Publication Date
- 2025-11-07
- Estimated Expiration
- 2044-11-05
AI Technical Summary
Existing technologies are severely lacking in the discovery and functional analysis of drought-resistant gene resources in *Gnaphalium affine*, resulting in insufficient research on its drought adaptability and making it difficult to improve the plant's drought resistance.
The LpDUF707-1 gene was cloned and validated. By constructing overexpression and RNAi vectors, Agrobacterium was used to transform the hairy roots of *Cypripedium*, promoting root growth and enhancing drought resistance.
The LpDUF707-1 gene promotes the growth of the root system of *Gnaphalium affine*, significantly improves the plant's drought resistance, and enhances its survival ability under drought conditions.
Smart Images

Figure CN119752924B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to the application of LpDUF707-1 gene in the positive regulation of plant root growth and drought stress response. BACKGROUND
[0002] China has rich local grass resources, which not only have strong stress adaptation, but also contain excellent stress resistance genes, and is a valuable resource for studying plant drought tolerance mechanism and molecular improvement of drought-tolerant forage grass. However, current research on local grasses in China mainly focuses on the preservation and evaluation of germplasm resources, domestication and breeding, and the related research on drought-tolerant genes and molecular mechanisms is relatively weak. Therefore, it is urgent to carry out research on the drought-tolerance mechanism of domestic local grasses, to excavate excellent drought-tolerant gene resources, and to use stress-tolerant molecular breeding to accelerate the cultivation of drought-tolerant forage grasses and new varieties for ecological restoration.
[0003] Lespedeza potaninii is a perennial herbaceous semi-shrub plant of the genus Lespedeza in the family Fabaceae. As a unique drought-tolerant local grass in China, Lespedeza potaninii can grow normally in a desert habitat with an annual precipitation of 150 mm, has a well-developed root system, and is highly drought-tolerant. However, there is a lack of research on the drought adaptation phenotype of Lespedeza potaninii, such as the relationship between its well-developed axial root system and drought tolerance. Meanwhile, the excavation and functional analysis of drought-tolerant genes in Lespedeza potaninii are also very scarce.
[0004] The DUF707 protein family is a class of proteins containing the DUF707 unknown function conserved domain. In recent years, some studies have shown that DUF707 is involved in the development of plant organs or tissues, such as phloem fibers, seeds, and pollen. In addition, some studies have shown that plant DUF707 may be involved in the response to abiotic stress. So far, the theoretical basis for the function of DUF707 family proteins in plants is still very weak, and the research on the regulation of plant drought response by this family of proteins is still in its infancy. SUMMARY
[0005] In view of the above, it is necessary to provide a LpDUF707-1 gene and its application, which can promote the root growth of Lespedeza potaninii and thus improve its drought tolerance.
[0006] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is:
[0007] The LpDUF707-1 gene, wherein the nucleotide sequence of the LpDUF707-1 gene is shown as SEQ ID NO. 1.
[0008] The present application also includes a protein encoded by the LpDUF707-1 gene, wherein the amino acid sequence of the protein is shown as SEQ ID NO. 2.
[0009] The application also comprises primers for amplifying the LpDUF707-1 gene, the primers being primer P1 / primer P2, the sequence of primer P1 being shown in SEQ ID NO. 3, and the sequence of primer P2 being shown in SEQ ID NO. 4.
[0010] The application also comprises an expression vector, wherein the expression vector contains the coding sequence SEQ ID NO. 1 of the LpDUF707-1 gene.
[0011] The application also comprises application of the LpDUF707-1 gene in improving drought tolerance of plants and / or promoting growth of plant roots.
[0012] The application also comprises a method for improving drought tolerance of plants and / or promoting growth of plant roots by using the LpDUF707-1 expression vector.
[0013] (1) using the plasmid of T-LpDUF707-1 as a template, and using primer P3 / primer P4 to perform PCR amplification by high-fidelity enzyme;
[0014] (2) using XbaI and BamHI to cut the plasmid pBI121, and obtaining a linearized vector of pBI121;
[0015] (3) connecting the LpDUF707-1 gene fragment of step (1) and the linearized vector of pBI121 to obtain a prokaryotic expression vector pBI121-LpDUF707-1;
[0016] (4) using the electroporation method to transform the pBI121-LpDUF707-1 plasmid into Agrobacterium rhizogenes K599, and then using the Agrobacterium rhizogenes K599 to infect the hairy roots of the Millettia pachynema, and thus obtaining the hairy roots of the Millettia pachynema;
[0017] The sequence of primer P3 is shown in SEQ ID NO. 5, and the sequence of primer P4 is shown in SEQ ID NO. 6.
[0018] Further, the plant is Millettia pachynema.
[0019] The application has the following beneficial effects:
[0020] The application is based on the genomic data of Millettia pachynema, and clones the LpDUF707-1 gene, and uses the real-time quantitative PCR technology to analyze the expression mode under drought stress, and it is verified that the LpDUF707-1 gene can promote the root growth of Millettia pachynema and improve the drought tolerance of Millettia pachynema, and the application lays a foundation for revealing the drought tolerance mechanism of the LpDUF707-1 gene, and provides gene resources and theoretical basis for plant drought tolerance molecular breeding. BRIEF DESCRIPTION OF DRAWINGS
[0021] Figure 1 Figure 1 is a gene structure diagram of LpDUF707-1 in Millettia pachynema.
[0022] Figure 2 Figure 2 is a phylogenetic tree of LpDUF707-1 in Millettia pachynema and other plant DUF707.
[0023] Figure 3 Figure 3 is a result diagram of transcriptional response of LpDUF707-1 in Millettia pachynema to drought stress.
[0024] Figure 4 Figure 4 is an agarose gel electrophoresis diagram of PCR identification of positive hairy roots of hairy roots transformed with OE-LpDUF707-1 gene.
[0025] Figure 5 Figure 5 is an agarose gel electrophoresis diagram of PCR identification of positive hairy roots of hairy roots transformed with RNAi-LpDUF707-1 gene.
[0026] Figure 5 is an agarose gel electrophoresis diagram of PCR identification of positive hairy roots of hairy roots transformed with RNAi-LpDUF707-1 gene.
[0027] Figure 6 Figure 6 is a diagram of relative expression amount of LpDUF707-1 in positive hairy roots of Millettia pachynema transformed with OE-LpDUF707-1 and RNAi-LpDUF707-1 genes and in hairy roots transformed with empty control.
[0028] Figure 7 Figure 7 is a diagram of aboveground phenotype, underground phenotype and physiological index determination of hairy root plants of Millettia pachynema transformed with OE-LpDUF707-1 and RNAi-LpDUF707-1 genes under drought stress. DETAILED DESCRIPTION
[0029] To make the above-mentioned objects, features, and advantages of the present invention more apparent and understandable, specific embodiments of the present invention will be described in detail below with reference to the accompanying drawings. Many specific details are set forth in the following description to provide a thorough understanding of the present invention. However, the present invention can be practiced in many other ways different from those described herein, and those skilled in the art can make similar modifications without departing from the spirit of the present invention. Therefore, the present invention is not limited to the specific embodiments disclosed below.
[0030] Example 1
[0031] Cloning and sequence analysis of the LpDUF707-1 gene:
[0032] (1) Using the reference genome of *Gnaphalium affine* as a reference sequence, primers (primer P1 and primer P2) were designed to amplify the LpDUF707-1 gene from the whole plant of *Gnaphalium affine*.
[0033] (2) Total RNA was extracted from the whole plant of *Gnaphalium affine* according to the instructions of the RNA extraction kit. The extracted RNA was reverse transcribed into cDNA using a reverse transcription kit. Using this cDNA as a template, PCR amplification was performed using primers P1: 5'-ATGGGAATCACCACTCGAAGTT-3' (SEQ ID NO.3) and P2: 5'-TTAATGAGCAGTGGAATCAGA-3' (SEQ ID NO.4) with a high-fidelity enzyme.
[0034] The reaction system for the above PCR amplification is as follows: 2× Max Buffer 12.5 μL, dNTP 0.5 μL, forward and reverse primers (10 μM) 1 μL each, Max Super-Fidelity DNA Polymerase (Novizan) 0.5 μL, ddH2O 8.5 μL.
[0035] The PCR program was as follows: 95℃ for 3 min; 95℃ for 30 s, 52℃ for 30 s, 72℃ for 1 min 30 s, 35 cycles; 72℃ for 5 min.
[0036] (3) After the reaction, 5 μL of the PCR product was taken for 1.5% agarose gel electrophoresis, and a band of about 1206 bp was observed in the ultraviolet gel imaging system, which was consistent with the expected size. The LpDUF707-1 gene fragment was recovered using a PCR product purification kit. The recovered and purified DNA fragment was ligated using the 5 min TA / Blunt-Zero Cloning Kit instructions. The recombinant plasmid T-LpDUF707-1 was transformed into E. coli competent cells, and positive clones were screened using ampicillin Amp (100 mg / L) as a marker, and bacterial liquid PCR identification was performed. The bacterial liquid of the positive recombinant plasmid was sequenced. The composition of the intron and exon of the LpDUF707-1 gene was analyzed using local TBtools software, and a phylogenetic tree was constructed using MEGA7.0. The constructed phylogenetic tree is as follows: Figure 2The phylogenetic tree was obviously divided into three branches. The scale bar indicates the evolutionary distance, and the numbers on the nodes represent the percentage (%) of the credibility of the nodes based on 1000 times of repetition in the Bootstrap verification. The sources of the sequences used in the figure: Arabidopsis thaliana: AtDUF707-1 (AT1G08040.1), AtDUF707-2 (AT1G11170.1), AtDUF707-3 (AT1G13000.1), AtDUF707-4 (AT1G24570.1), AtDUF707-5 (AT1G61240.1), AtDUF707-6 (AT1G67850.1), AtDUF707-7 (AT2G28310.1), AtDUF707-8 (AT3G26440.1), AtDUF707-9 (AT3G27470.1), AtDUF707-10 (AT4G12840.1), AtDUF707-11 (AT4G18530.1); Rice: OsDUF707-1 (LOC_Os01g68260.1), OsDUF707-2 (LOC_Os01g69050.1), OsDUF707-3 (LOC_Os01g73970.1), OsDUF707-4 (LOC_Os02g19510.1), OsDUF707-5 (LOC_Os05g01760.1), OsDUF707-6 (LOC_Os06g51180.1), OsDUF707-7 (LOC_Os06g51190.1), OsDUF707-8 (LOC_Os06g51200.1), OsDUF707-9 (LOC_Os06g51520.1), OsDUF707-10 (LOC_Os07g23190.1), OsDUF707-11 (LOC_Os07g37760.1); Millettia pinnata LpDUF707-1 is the amino acid sequence shown in SEQ ID No. 2.
[0037] (4) The gene structure of LpDUF707-1 gene is shown in Figure 1 The nucleotide sequence of LpDUF707-1 gene is shown in SEQ ID No. 1, which contains 1206 bases, encodes 401 amino acids, and the amino acid sequence is shown in SEQ ID No. 2, with a molecular weight of 46.08 kDa.
[0038] Figure 1 The gene structure of LpDUF707-1 gene is shown in SEQ ID No. 1. The DNA sequence of LpDUF707-1 includes 1206 nucleotides, which consists of 14 exons and 13 introns. The exons are represented by boxes, and the numbers are the number of nucleotides.
[0039] Example 2
[0040] Expression pattern analysis of LpDUF707-1 in roots of Millettia pinnata under drought stress
[0041] In order to further identify that LpDUF707-1 is involved in drought stress response of Millettia pinnata, the transcription level of LpDUF707-1 in different tissues and roots under drought stress was analyzed. The RNA of different tissues of Millettia pinnata after stress was extracted, and the expression amount under drought stress was analyzed by using real-time fluorescence quantitative PCR technology, and the results are shown in Figure 3 Figure 3 A, L is leaf, S is seed, ST is stem, R is root, and F is flower; from Figure 3 A, it can be seen that the expression amount of LpDUF707-1 is high in roots and stems, which indicates that LpDUF707-1 mainly functions in roots and stems. Figure 3 B, RCK is control, RLS is mild drought stress, RSS is severe drought stress, and RRW is rehydration treatment, from Figure 3 It can be seen that the expression amount of LpDUF707-1 in roots of Millettia pinnata under mild drought stress (RLS) and severe drought stress (RSS) shows a significant upward trend compared with the control, which indicates that LpDUF707-1 responds to drought stress in roots of Millettia pinnata.
[0042] Example 3
[0043] Construction of plant overexpression vector
[0044] (1) The plasmid of T-LpDUF707-1 was used as a template, and PCR amplification was carried out by using the upstream primer P3 and the downstream primer P4 through high-fidelity enzyme, the primer P3 is 5'-GAGAACACGGGGGACTCTAGAATGGGAATCACCACTCGAAGT T-3'(SEQ ID NO. 5), and the primer P4 is 5'-CCATGGTACCCCCGGGGATCCGATGAGCAGTGGAATCAG ATATA-3'(SEQ ID NO. 6);
[0045] The reaction system of PCR amplification is as follows: 2x Max Buffer 12.5 μL, dNTP 0.5 μL, 1 μL of forward and reverse primers (10 μM) respectively, Max Super-Fidelity DNA Polymerase (Novozyme high-fidelity DNA polymerase) 0.5 μL, and ddH2O 8.5 μL.
[0046] The PCR program was as follows: 95℃ for 3 min; 95℃ for 30 s, 55℃ for 30 s, 72℃ for 1 min 30 s, 35 cycles; 72℃ for 5 min.
[0047] (2) Take 5 μL of PCR product for 1.5% agarose gel electrophoresis. Use a UV gel imager to see the fragment that is consistent with the expected size. Use a PCR product purification kit to recover the LpDUF707-1 gene fragment.
[0048] (3) Linearization of the vector: The plant overexpression vector plasmid pBI121 was digested with XbaI and BamHI enzymes. After digestion, the product was purified using a PCR product purification kit. The digestion reaction system was as follows: 1 μg of vector plasmid, 1 μL of XbaI enzyme, 1 μL of BamHI enzyme, 2 μL of 10× buffer, and ddH2O to a final volume of 20 μL. The digestion reaction was carried out at 37℃ for 1 h.
[0049] (4) The LpDUF707-1 gene fragment from step (2) and the linearized pBI121 vector from step (3) were cloned using a one-step cloning kit. The MultiS One Step Cloning Kit (Novizan) was used for homologous recombination. The system consisted of: 2.5 μL of linearized pBI121 vector, 1 μL of LpDUF707-1 gene fragment, 1 μL of 5×CE MultiS Buffer, and 0.5 μL of Exnase MultiS. The reaction was carried out at 37°C for 30 min; then cooled to 4°C or immediately placed on ice. E. coli DH5α was transformed using the heat shock method. Single clones were picked for colony PCR detection. Positive single clones were sequenced. Single clones with correct sequencing results were considered successfully constructed vectors. The cells were then cultured, and plasmids were extracted using a plasmid extraction kit to obtain the prokaryotic expression vector: pBI121-LpDUF707-1, which was stored at -20°C.
[0050] Example 4
[0051] Gateway technology for constructing RNAi expression vectors:
[0052] (1) According to the Gateway instructions, the attB site was merged into the 5' ends of the gene-specific upstream and downstream primers, resulting in primers P5 and P6. Using the plasmid T-LpDUF707-1 as a template, the gene was... Max Super-Fidelity DNA Polymerase for PCR amplification, and the PCR product was recovered by a gel recovery kit. The entry vector pDONR-Zeo and the gel recovery product were used for BP reaction to construct the entry vector; wherein, the P5 sequence was as follows: 5'-GGGGACAAGTT TGTACAAAAAAGCAGGCTTAATGGGAATCACCACTCGAAGTT-3' (SEQ ID NO. 7); and the P6 sequence was as follows: 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTTTTAATCATTCCTAAGCTCATTAA GCTC-3' (SEQ ID NO. 8).
[0053] The BP reaction system was as follows: Gateway BP II Clonase enzyme mixture 0.4 μL, gel recovery product (50 ng / μL) 1 μL, pDONR-Zeo (150 ng / μL) 0.6 μL. The reaction was performed at 25°C overnight.
[0054] (2) The ligation product was transformed into E. coli DH5α. 100 μL of the culture was spread on an LB solid plate containing Zeo antibiotic with a final concentration of 33 mg / L. Universal primers M13F and M13R were used for positive single clone detection, and the single clone was sequenced. The single clone was shaken after correct sequencing, and the plasmid was extracted by a plasmid extraction kit and stored at -20°C.
[0055] The RNAi vector pK7GWIWG2(II)RR and the entry vector were subjected to LR reaction to construct the RNAi recombinant vector. The LR reaction system was as follows: Gateway LR II Clonase enzyme mixture 0.4 μL, Entry Clone (150 ng / μL) 0.6 μL, target vector (150 ng / μL) 0.6 μL, ddH2O 0.4 μL. The reaction was performed at 25°C overnight. The ligation product was transformed into E. coli DH5α. After completion of the transformation, 100 μL of the culture was spread on an LB solid plate containing Spe antibiotic with a final concentration of 50 mg / L. After positive single clone broth detection, the positive single clone with a target band was shaken, and the plasmid was extracted by a plasmid extraction kit, thereby constructing the successful RNAi-LpDUF707-1 recombinant plasmid, which was stored at -20°C.
[0056] Example 5
[0057] LpDUF707 gene transformation of calli of Pueraria phaseoloides
[0058] The pBI121-LpDUF707-1 plasmid, RNAi-LpDUF707-1 and empty vector were transformed into Agrobacterium K599 by electric shock. Single colonies were picked and subjected to bacterial liquid PCR detection. The product fragment was consistent with the expected size of the target fragment, indicating that the Agrobacterium with LpDUF707-1 gene overexpression and RNAi vector was successfully obtained.
[0059] K599, LpDUF707-1 overexpression vector and RNAi vector K599 bacterial liquid 200 μL was plated on the plate, and the seed of Millettia pachynema was germinated for 7 days. The root tip of the seedling was quickly cut with a scalpel at a distance of 5 mm from the top, and the cut seedling was lightly dipped in the bacterial film. The seedling was placed on the 1 / 2MS medium containing PPM antibiotic, and was wrapped with tin foil paper and cultured in the dark for 3 days. After 3 days of co-culture, the seedling was taken out from the dark treatment condition and placed on the 1 / 2MS solid medium, and was placed in the structure of filter paper-seedling-filter paper, and was placed vertically in the 22°C tissue culture room (16h light / 8h dark) for 14 days. Hairy roots began to grow, and then the hairy roots were transferred to water for 15-20 days for observation of growth for subsequent experiments.
[0060] Example 6
[0061] Molecular level identification of transgenic Millettia pachynema hairy roots: The transgenic Millettia pachynema hairy roots were identified at the genomic level and the transcriptional level. The 1 mm root tip was treated with 20 μL of super speed Mix at 95°C for 5 min, and then centrifuged. 1 μL of supernatant was used as a template for PCR detection of the target band with the upstream primer of the vector and the self primer, Figure 4 and Figure 5 as shown in Figure 4 and Figure 5 , wherein M is Marker, (-) is blank control: ddH2O PCR product, (+) is positive control; Figure 4 and Figure 5 The Marker is 2000 bp, and from top to bottom are 2000 bp, 1000 bp, 750 bp, 500 bp, 250 bp and 100 bp; Figure 4 the target band 1200 bp in Figure 5 and the target band 300 bp in Figure 6 , indicating that the target gene was successfully transformed into Millettia pachynema hairy roots. In addition, as shown in Figure 6Figure A shows the fluorescence tag detection results after transfection of different hairy roots with OE-LpDUF707-1 and RNAi-LpDUF707-1; Figure B shows the relative expression level of LpDUF707-1 in hairy roots after transfection with OE-LpDUF707-1; Figure C shows the relative expression level of LpDUF707-1 in hairy roots after transfection with RNAi-LpDUF707-1. qRT-PCR detection of LpDUF707-1 expression in transgenic hairy roots revealed that, compared with the control plant K599(EV), the LpDUF707-1 gene had higher expression levels in overexpression lines and lower expression levels in RNAi lines.
[0062] Example 7
[0063] Drought tolerance test of transgenic *Gnaphalium affine* complex: After the *Gnaphalium affine* plants to be transformed (control plant K599), *Gnaphalium affine* plants overexpressing the LpDUF707-1 vector, and *Gnaphalium affine* plants with the RNAi-LpDUF707-1 vector developed hairy roots for 60 days, the *Gnaphalium affine* complex was subjected to a 3-week drought treatment. The aerial phenotypes of the control, LpDUF707-1 overexpressing, and RNAi lines were observed after the stress. Results are as follows: Figure 7 As shown, Figure 7 Figure A① shows the phenotype of plants under normal treatment, and Figure B① shows the phenotype of plants under drought treatment. Figure 7 A and Figure 7 In group B, OE plants were plants overexpressing the LpDUF707 gene, EV plants were the control group, and RNAi plants were plants interfering with the LpDUF707 gene. Figure 7 A and Figure 7 As shown in Figure B, the leaves of the overexpression complex showed normal phenotypes after drought stress, while the leaves of the control complex withered and turned yellow, and the leaves of the RNAi complex turned yellow and curled.
[0064] Figure 7 C shows the results of the relative water content of the leaves. Figure 7 D is the result graph for malondialdehyde. Figure 7 E shows the aboveground dry weight results. In the figure, gray-white blocks represent plants in the control group, blue blocks represent plants overexpressing the LpDUF707 gene, and orange-yellow blocks represent plants interfering with the LpDUF707 gene. As can be seen from the figure, after drought treatment, the relative leaf water content of the overexpressing plants was significantly greater than that of the control group, while the relative leaf water content of the interfering plants was significantly less than that of the control group. The aboveground dry weight of the overexpressing plants was significantly greater than that of the control group, while the aboveground dry weight of the interfering plants was significantly less than that of the control group. The malondialdehyde (MDA) content of the overexpressing plants was significantly lower than that of the control group, while the MDA content of the interfering plants was significantly higher than that of the control group. Therefore, combined with the results of physiological indicators such as relative leaf water content, aboveground dry weight, and MDA, it can be concluded that overexpression of the LpDUF707-1 gene improves the drought resistance of the complex *Cypripedium spp.*
[0065] Example 8
[0066] Transgenic complex Millettia root phenotype detection: After 60 days of hairy roots of the control plant K599, the overexpression LpDUF707-1 vector, and the RNAi-LpDUF707-1 vector of Millettia were grown, the complex Millettia was subjected to 3 weeks of drought treatment, and the root phenotypes of the control, overexpression LpDUF707-1, and RNAi strains were observed after stress. The results are shown in Figure 7 , Figure 7 A 2 and Figure 7 B 2 are apparent images of the root system. In the figures, the OE plant is an overexpression LpDUF707 gene plant, the EV is a blank plant, and the RNAi is an LpDUF707 gene interference plant. As can be seen from Figure 7 A and Figure 7 B, the overexpression complex root growth is significantly promoted after drought stress, and the RNAi complex root growth is significantly promoted.
[0067] Figure 7 F is a root weight result figure, Figure 7 G is a root length result figure, H is a root area result figure. In the figures, the orange block is a blank plant, the light green block is an overexpression LpDUF707 gene plant, and the light purple block is an LpDUF707 gene interference plant. As can be seen from the figures, the root length of the overexpression plant is significantly greater than that of the blank group after drought treatment, and the root length of the interference expression plant is significantly less than that of the blank group. The root length of the overexpression plant is significantly greater than that of the blank group, and the root length of the interference expression plant is significantly less than that of the blank group. The root area of the overexpression plant is significantly greater than that of the blank group, and the root area of the interference expression plant is significantly less than that of the blank group. Therefore, in combination with the root length, root dry weight, and root area, the results show that the overexpression of the LpDUF707-1 gene promotes the growth of the complex Millettia root system, thereby improving the drought tolerance of the complex Millettia.
[0068] In summary, the LpDUF707-1 gene isolated from Millettia can promote the growth of the complex Millettia root system, thereby improving the drought tolerance of the complex Millettia.
[0069] The above-described examples only express several embodiments of the present application, and the description is more specific and detailed, but it cannot be understood as limiting the scope of the present application. It should be noted that for ordinary skilled persons in the art, without departing from the concept of the present application, several modifications and improvements can be made, which are within the scope of protection of the present application. Therefore, the protection scope of the present application should be subject to the appended claims.
Claims
1. LpDUF707-1 A gene characterized in that, The LpDUF707-1 The nucleotide sequence of the gene is shown as SEQ ID NO.
1.
2. LpDUF707-1 A protein encoded by a gene, characterized in that, The amino acid sequence of the protein is shown as SEQ ID NO.
2.
3. An expression vector, characterized in that, The expression vector contains the coding sequence of the gene of SEQ ID NO. 1 as claimed in claim 1 LpDUF707-1 The coding sequence of the gene is SEQ ID NO.
1.
4. The method of claim 1 LpDUF707-1 Use of a gene in improving drought tolerance and / or promoting root growth in a plant, the plant being Millettia pinnata.
5. Use of a compound as claimed in claim 3 LpDUF707-1 Method for increasing the drought tolerance and / or for promoting the root growth of a plant, characterized in that, The method is: (1) using the plasmid of T- LpDUF707-1 as a template, PCR amplification is carried out by using primer P3 and primer P4 through high-fidelity enzyme; a gene fragment is obtained LpDUF707-1 (2) using Xba I and Bam HI cut plasmid pBI121 to obtain linearized vector of pBI121; (3) ligating the linearized vector pBI121- LpDUF707-1 LpDUF707-1 obtained in step (1) with the linearized vector pBI121- LpDUF707-1 obtained in step (2) to obtain the prokaryotic expression vector pBI121- (4) Using electric shock, pBI121- LpDUF707-1 The plasmid was transformed into Agrobacterium rhizogenes K599, and then Agrobacterium rhizogenes K599 was used to infect the hairy roots of the plant to obtain the product. The sequence of the primer P3 is shown as SEQ ID NO. 5, the sequence of the primer P4 is shown as SEQ ID NO. 6, and the plant is Millettia pinnata.
Citation Information
Patent Citations
Method for improving germination rate of Amaranthus trifoliatus seeds under drought stress and application thereof
CN117918082A
Plant Stress Tolerance Related Protein GmSIK1 and Encoding Gene and Use Thereof
US20120266325A1