Application of SlBES1 gene in regulation and control of biosynthesis of flavonoids in tomato peel

Abstract

The invention belongs to the technical field of biology, and provides application of an SlBES1 gene in regulation and control of tomato peel flavonoid biosynthesis, and the nucleotide sequence of the SlBES1 gene is shown as SEQ ID No: 1. SlBES1 gene knockout promotes accumulation of flavonoids in tomato peel.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to the application of a tomato SlBES1 gene in regulating the biosynthesis of tomato peel flavonoids. Background Art

[0002] Tomato (Solanum lycopersicum) is native to South America. It is not only a widely grown vegetable crop in the world, but also a model plant for studying fruit development. It is also an important source of dietary fiber and nutrients for humans. Tomato fruit quality includes sensory quality, nutritional quality and flavor quality. Fruit color is an important horticultural trait of tomatoes and one of the most important attributes that affects consumers' perception of quality. The color of tomato fruit is determined by flavonoids in the peel and carotenoids in the flesh.

[0003] Flavonoids are a class of secondary metabolites widely distributed in plants. In plants, flavonoids are thought to have multiple functions, including protection against UV-B radiation, defense against pathogen attack, attraction of pollinating insects, and as signaling compounds to initiate symbiotic relationships. In addition, flavonoids are components of fruits and vegetables that are frequently consumed by humans and have beneficial effects on human health due to their antioxidant activity and protective effects on the cardiovascular system. Studies have shown a direct link between high flavonoid intake and a reduced risk of cardiovascular disease, cancer, and other age-related diseases.

[0004] The biosynthetic pathway of flavonoids starts from phenylalanine and is catalyzed by enzymes such as chalcone synthase (CHS), chalcone isomerase (CHI), flavonoid 3-hydroxylase (F3H), flavonoid 3'-hydroxylase (F3'H), dihydroflavonol 4-reductase (DFR), anthocyanidin synthase (ANS) and flavonol synthase (FLS). MYB, bHLH and WD40 transcription factors can regulate the biosynthetic pathway of flavonoids alone or in the form of MYB-bHLH-WD40 (MBW) ternary complex. Since flavonoid biosynthesis genes are mainly expressed in tomato peel and not in the flesh, flavonoids mainly come from tomato peel. Naringenin chalcone is one of the most abundant flavonoids in tomatoes and is also the determining substance of tomato peel color. Genetic studies have shown that the pink gene y encodes an R2R3-MYB transcription factor SlMYB12, which controls the accumulation of yellow naringenin chalcone in the tomato peel. The loss of SlMYB12 disrupts the accumulation of naringenin chalcone, resulting in a colorless peel and ultimately pink fruit.

[0005] SlBES1 (Solyc04g079980) is a bHLH transcription factor that activates or inhibits the expression of target genes by binding to E-box (CANNTG) and BRRE-box (CGTGC / TG) elements, regulating plant growth and development and environmental stress tolerance. Previous studies have shown that SlBES1 can promote tomato fruit softening. Its nucleotide sequence reference has been published in the paper doi:10.1016 / j.isci.2021.102926. SlBES1 (Solyc04g079980) in the Accession numbers.

[0006] The invention of CN116410986A "Genes involved in regulating tomato plant height, fruit shape and yield and their applications" informs that the double gene knockout of SlBZR1 and SlBES1 will cause the tomato plants to become dwarfed, the fruits to become smaller and longer in shape, and the fruit yield to decrease; the double gene knockout of SlBZR1 and SlBES1 will lead to reduced tomato plant height, reduced tomato fruit size, increased tomato length-width ratio, and reduced tomato yield.

[0007] It should be noted that there is no correlation between plant height, fruit size, aspect ratio, and yield and flavonoids.

[0008] Currently known flavonoid structural genes include: chalcone synthase gene (CHS), chalcone isomerase gene (CHI), flavonoid 3-hydroxylase gene (F3H), flavonoid 3'-hydroxylase gene (F3'H), dihydroflavonol 4-reductase gene (DFR), anthocyanidin synthase gene (ANS) and flavonol synthase gene (FLS). The flavonoid biosynthesis pathway is mainly regulated independently or jointly by R2R3-MYB, bHLH and WD40 transcription factors. Among them, the research on MYB transcription factors is the most comprehensive, such as MYB12. Summary of the invention

[0009] The technical problem to be solved by the present invention is to provide a new use of the SlBES1 gene---regulating the biosynthesis of flavonoids in tomato peel.

[0010] In order to solve the above technical problems, the present invention provides the use of SlBES1 gene in regulating the biosynthesis of flavonoids in tomato peel. The nucleotide sequence of SlBES1 gene is shown in SEQ ID No: 1.

[0011] As an improvement of the application of the present invention: the flavonoid is naringenin chalcone.

[0012] Description: In the present invention, the content of naringenin chalcone is used to characterize the content of flavonoids. In the tomato variety AilsaCraig (AC), the content of naringenin chalcone is as high as more than 90%.

[0013] As an improvement of the application of the present invention: SlBES1 negatively regulates the biosynthesis of flavonoids in tomato peel.

[0014] As a further improvement of the application of the present invention: SlBES1 gene knockout promotes the accumulation of flavonoids in tomato peel.

[0015] In the present invention: the protein encoded by gene S1BES1 has the amino acid sequence shown in SEQ ID NO:2.

[0016] The transgenic tomatoes obtained by the method of the present invention can improve the content of flavonoids in tomato peel. By measuring the content of flavonoids, it is found that the SlBES1 gene plays a negative regulatory role in the biosynthesis of flavonoids in tomato peel. By editing the tomato SlBES1 gene, tomato materials with higher flavonoid content are cultivated, which has good application prospects in improving the sensory and nutritional quality of tomatoes.

[0017] It should be noted that the SlBES1 (Solyc04g079980) gene belongs to the bHLH family of transcription factors, and the molecular mechanism of bHLH transcription factors regulating tomato flavonoids alone is still unclear. Therefore, ordinary technicians in this industry cannot know whether SlBES1 (Solyc04g079980) is associated with flavonoids. Therefore, the role of SlBES1 in regulating the biosynthesis of tomato flavonoids has not been reported so far. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] The specific implementation modes of the present invention are further described in detail below with reference to the accompanying drawings.

[0019] Figure 1 is the naringenin chalcone content in the peel of SlBES1 gene overexpression and gene-edited lines and wild-type tomatoes.

[0020] Figure 2 It is the expression level of flavonoid regulatory gene SlMYB12 in the peel of SlBES1 gene overexpression and gene-edited strains and wild-type tomato.

[0021] Figure 3 It is the expression levels of flavonoid structural genes SlCHS1, SlCHS2, and SlF3'H in the peel of SlBES1 gene overexpression and gene-edited strains and wild-type tomato. DETAILED DESCRIPTION

[0022] The present invention is further described below in conjunction with specific embodiments, but the protection scope of the present invention is not limited thereto:

[0023] 1. Obtaining the full-length sequence of the tomato SlBES1 gene:

[0024] Refer to SlBES1 (Solyc04g079980) in the Accession numbers in the published paper doi:10.1016 / j.isci.2021.102926.

[0025] The nucleotide sequence of the gene SlBES1 is shown in SEQ ID No: 1; the amino acid sequence of the protein encoded by the gene is shown in SEQ ID No: 2.

[0026] 2. Construction of tomato SlBES1 gene overexpression vector:

[0027] The construction of SlBES1 overexpression vector, using pGWB17 as the final vector, constructed the pGWB17-SlBES1 vector with CaMV35S recombinant overexpression promoter. Please refer to the published patent: CN111154771B "Application of Tomato SlBZR1L Gene").

[0028] The details are as follows: Use LR reaction to transfer the target fragment (i.e., the sequence described in SEQ ID No: 1) from the pQB-V3 initial vector to the pGWB17 final vector. II Enzyme mix (ThermoFisher) kit, refer to the instructions in the kit. After the reaction, the pGWB17-SlBES1 plasmid was transferred into the competent E. coli DH5α. The pGWB17 recombinant plasmid with the target fragment was screened by the coating method, and the colony PCR was used to screen and sequence the plasmid. The sequencing results were analyzed by DNAMAN software. Thus, the pGWB17-SlBES1 vector with the CaMV35S recombinant overexpression promoter was obtained.

[0029] 3. Construction of CRISPR / Cas9 vector for tomato SlBES1 gene knockout:

[0030] Refer to the second paragraph of METHOD DETAILS in the published paper doi:10.1016 / j.isci.2021.102926: Generation of the CRISPR / Cas9 mutant.

[0031] Specifically, the target sgRNA sequence for CRISPR / Cas9 editing was designed in the coding sequence of the SlBES1 gene (SEQ ID NO: 1) using online professional software (http: / / crispr.mit.edu / ): 5'-TAGTTGGTGATGAAAGAGGTGG-3'. The base C at 556 bp was deleted in the vector with successful gene editing, resulting in premature termination of the coding sequence.

[0032] The nucleotide sequence is shown in SEQ ID NO: 3; the amino acid sequence of the encoded protein is shown in SEQ ID NO: 4.

[0033] The Ailsa Craig (AC) variety was used as the wild-type tomato, denoted as WT.

[0034] The pGWB17-SlBES1 vector plasmid was transformed into Agrobacterium tumefaciens LBA4404 strain, and tomato cotyledons were infected. Tissue culture seedlings were obtained through callus induction, resistance induction differentiation and rooting culture, and positive transgenic plants were verified by PCR and RT-PCR. T2 generation seeds were sown on a kanamycin (50 mg / L) medium for germination, thereby obtaining SlBES1 transgenic material SlBES1-OE;

[0035] The CRISPR / Cas9 vector plasmid with tomato SlBES1 gene knockout was transformed into Agrobacterium LBA4404 strain, and tomato cotyledons were used as explants and co-cultured with the bacterial solution to obtain callus tissue. The callus tissue was subjected to differentiation medium and rooting medium to obtain transgenic positive seedlings. PCR and RT-PCR were used to verify the positive transgenic plants, thus obtaining the SlBES1 transgenic material bes1.

[0036] The wild-type and SlBES1 transgenic materials were planted in the same greenhouse at the Huajiachi Vegetable Base of Zhejiang University. The fruits reached the green ripe stage (MG) 35 days after the flowering period was marked. The top of the fruit turned red 3 days after the green ripe stage (B), and the red ripe stage (B+7) 7 days after the color breaking stage. The whole fruit peel samples were taken when the fruits of the SlBES1 gene overexpressing transgenic line SlBES1-OE and the gene-edited line bes1 and the wild-type tomato WT grew to the red ripe stage.

[0037] After the peel sample was ground with liquid nitrogen, about 1 g of powder was extracted with 3 ml of 50% methanol, ultrasonically extracted for 30 min (power supply voltage 220 V, working frequency 53 kHz, power consumption 350 W, temperature 4 ° C), centrifuged at 12000 rpm for 15 min, and the supernatant was taken. The filter residue obtained by centrifugation was extracted again once, and the supernatants obtained from the two times were combined and filtered with a 0.22 μm nylon membrane filter for HPLC analysis. Flavonoids were analyzed on a Shimadzu high-performance liquid chromatograph using a SPD-M20A diode array detector and a C18 column (5 μm particle size, 4.6 mm x 250 mm, Elite analytical instruments Co., Ltd., Dalian, China). The mobile phase was (A) water and (B) acetonitrile, and the gradient elution was: solution B 80%-80% (5min), solution B 80%-55% (15min), solution B 55%-55% (6min), solution B55%B to 0% (4min), solution B 0%-0% (5min), solution B 0%-80% (1min), solution B 80%-80% (9min). The flow rate was 1.0mL / min, the column temperature was 25℃, and the detection wavelength was 370nm. The content was calculated by external standard method using naringenin chalcone standard (Sigma, St Louis, MO, USA). The results are expressed in μg g -1 It is expressed in units of FW (fresh weight).

[0038] Naringenin chalcone content in tomato peels of SlBES1 gene overexpression and gene-edited lines compared with wild-type tomato Figure 1 The results obtained were as follows: the naringenin chalcone content of the SlBES1 gene overexpression strain was significantly lower than that of the wild type, while the naringenin chalcone content of the bes1 gene edited strain was significantly higher than that of the wild type. This indicates that SlBES1 gene knockout promotes the accumulation of flavonoids in tomato peel.

[0039] The whole fruit peels of WT, SlBES1-OE, and bes1 were sampled at the color breaking stage, RNA was extracted, reverse transcribed into cDNA, and real-time fluorescence quantitative PCR was used to detect gene expression.

[0040] The primers corresponding to the flavonoid regulatory gene SlMYB12 are F:AGCTTGTGATAGTGCCATGGAA, R:CTCGAGTCTTGGCCATTCGATA

[0041] The primers corresponding to the flavonoid structural gene SlCHS1 are F: GGCTTACATTCCACTTACTC, R: GAGAGTTCCAGTCAGATATACC

[0042] The primers corresponding to the flavonoid structural gene SlCHS2 are F:TTAGCTGAGAACAACAAGGG, R:CCAACCATACTATCCAAATGAG

[0043] The primers corresponding to the flavonoid structural gene SlF3'H are F:GCTTTAGATGACTTCCGCC, R:GTTCCTTCGATTCTCCAACTC

[0044] The primers corresponding to the internal reference gene Actin are F:CCTCAGCACATTCCAGCAG, R:CCACCAAACTTCTCCATCCC

[0045] Real-time fluorescence quantitative PCR was performed using the SYBR Green PCR Master Mix kit, with Actin as the internal reference gene. –ΔΔCT The relative expression of genes was calculated by real-time fluorescence quantitative PCR. The reaction system of real-time fluorescence quantitative PCR was 20 μL, including 10 μL of SYBRGreen Master Mix, 1 μL of upper and lower primers, and 9 μL of a mixture of template DNA and sterile ultrapure water. The reaction program was 95°C, 5 min; 95°C, 10 sec, 60°C, 30 sec, 40 cycles.

[0046] The results are as follows Figure 2 and Figure 3 described. Figure 2 The results showed that the expression level of the flavonoid regulatory gene SlMYB12 was significantly decreased in SlBES1-OE and significantly increased in bes1. Figure 3 The results showed that the expression levels of flavonoid structural genes SlCHS1, SlCHS2, and SlF3'H were significantly decreased in SlBES1-OE, but significantly increased in bes1. Figure 2 and Figure 3 The following conclusions can be drawn: SlBES1 can inhibit the accumulation of flavonoids by suppressing the expression of flavonoid regulatory genes and structural genes.

[0047] Description: SlMYB12 is a regulatory gene of the flavonoid pathway, and SlCHS1, SlCHS2, and SlF3'H are structural genes of the flavonoid pathway, which all play a positive regulatory role in the accumulation of flavonoids.

[0048] Finally, it should be noted that the above examples are only some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments, and there are many variations. All variations that can be directly derived or associated with the content disclosed by a person skilled in the art should be considered as the protection scope of the present invention.

Claims

1. Application of the SlBES1 gene in regulating the biosynthesis of flavonoids in tomato peel, characterized in that: The nucleotide sequence of the SlBES1 gene is shown in SEQ ID No:

1.

2. The use according to claim 1, characterized in that: The flavonoid is naringenin chalcone.

3. The use according to claim 1 or 2, characterized in that: SlBES1 negatively regulates the biosynthesis of flavonoids in tomato peel.

4. The use according to claim 3, characterized in that: SlBES1 gene knockout promotes the accumulation of flavonoids in tomato peel.

Images