Tissue culture-dependent hevea brasiliensis root genetic transformation method

Abstract

The invention relates to a non-tissue-culture-dependent hevea brasiliensis root genetic transformation method. The hevea brasiliensis root genetic transformation method comprises the following steps: preparing agrobacterium rhizogenes infection liquid from agrobacterium rhizogenes liquid or activating agrobacterium rhizogenes to prepare agrobacterium rhizogenes lawn; agrobacterium rhizogenes infection liquid or agrobacterium rhizogenes lawn is adopted to carry out bacterium wrapping infection, soaking infection or injection infection on the rooted rubber seedlings, and co-culture is carried out after infection is completed to obtain positive transgenic root plants. According to the scheme provided by the invention, non-tissue-culture-dependent genetic transformation of the rubber tree can be realized.

Description

Technical Field

[0001] The present application relates to the technical field of plant genetic engineering, and in particular to a method for genetic transformation of rubber tree roots that is not dependent on tissue culture. Background Art

[0002] The rubber tree (Hevea brasiliensis) is a large tree of the genus Hevea in the Euphorbiaceae family. It originated in the Amazon Basin in South America. The natural rubber produced by the rubber tree is the main raw material for making rubber. Natural rubber has unique elasticity, ductility and thermal conductivity. It is an important industrial raw material and an important strategic material (Venkatachalam et al. 2006). The Brazilian rubber tree is a perennial cross-pollinating plant with a juvenile period of 5 to 6 years. It takes 30 to 50 years to cultivate a new variety by conventional breeding methods. This breeding model requires a lot of manpower, financial resources and land, is inefficient, and cannot effectively aggregate high-yield traits and other excellent traits. With the advancement of emerging technologies such as transgenics and gene editing, the rubber tree breeding strategy has been expanded and accelerated. Modern molecular breeding technology can achieve precise manipulation of the genome and accelerate variety renewal. In the 1990s, some scholars tried to study the genetic transformation of rubber trees mediated by Agrobacterium and initially established an Agrobacterium-mediated genetic transformation system, but all of them used Agrobacterium tumefaciens and strictly relied on tissue culture technology.

[0003] In the past 20 years, transgenic research has made great progress: the transformation technologies successfully applied include Agrobacterium-mediated method, protoplast transformation method and gene gun method. Among the many transformation methods, Agrobacterium-mediated method has become the main method of plant genetic transformation due to its clear mechanism, simple operation and low copy number. The Rol gene carried on the Ri plasmid of Agrobacterium rhizogenes can form a large number of hairy roots in the infected parts of the plant, and then regenerate the transformed plants from the hairy roots. Transgenic technology can shorten the breeding cycle of rubber trees, accelerate the cultivation of new varieties, and is also an important technical means for the identification of functional genes. At present, the means of obtaining transgenic plants almost all rely on tissue culture technology, which has problems such as high cost, long cycle, difficult operation and dependence on genotype.

[0004] Since the hybrid breeding cycle of rubber trees is long and multiple excellent traits cannot be effectively aggregated, researchers at home and abroad are establishing and optimizing the genetic transformation system of rubber trees. The traditional genetic transformation system mainly relies on tissue culture technology, but this method is costly and time-consuming, and the callus and somatic embryo induction process of rubber trees are strictly genotype-dependent, resulting in genetic transformation that can only be carried out in a few varieties. GT1, Tianren 31-45, 93-114, RRIM513 and other rubber tree varieties are difficult to induce somatic embryogenesis. Most of the hybrid offspring with them as parents are difficult to induce somatic embryogenesis. In addition, GT1 rubber tree is the rootstock of most cultivated rubber varieties in my country. So far, the somatic embryo regeneration and genetic transformation system of GT1 rubber tree has not been established.

[0005] Therefore, it is urgent to establish a genetic transformation method for GT1 rubber trees. Summary of the invention

[0006] In order to solve or partially solve the problems existing in the related art, the present application provides a rubber tree root genetic transformation method that is not dependent on tissue culture. The rubber tree root genetic transformation method can achieve genetic transformation of rubber trees that is independent of tissue culture.

[0007] The present application provides a tissue culture-independent genetic transformation method for rubber tree roots, which uses Agrobacterium rhizogenes K599 to infect root-derooted rubber seedlings to achieve tissue culture-independent genetic transformation of rubber tree roots.

[0008] Optionally, the rootless rubber seedlings are infecting with Agrobacterium K599 infection solution or Agrobacterium K599 moss prepared with Agrobacterium K599 bacterial solution containing the target vector and then vacuumed, and the vacuumed rootless rubber seedlings are placed on agar for co-cultivation and then moved to a sand pool for cultivation.

[0009] Optional: Agrobacterium rhizogenes K599 bacterial culture OD 600 is 0.4-0.8; the vacuum time is 10-20min; the infection method is the wrapping method, immersion method or injection method.

[0010] Optional: Agrobacterium rhizogenes K599 bacterial culture OD 600 is 0.8; vacuum time is 15min; infection method is injection.

[0011] Optionally, removing the roots of the rubber seedlings is to cut off the roots of the rubber seedlings at the hypocotyl 1 cm away from the cotyledons of the rubber seedlings.

[0012] Optionally, the target vector refers to a pCAMBIA2301 vector containing a target gene; the target gene is a GUS gene, a RUBY gene or a JcFT gene.

[0013] Optionally, the Agrobacterium rhizogenes K599 infection fluid is prepared by the following method: after centrifuging the Agrobacterium rhizogenes K599 bacterial fluid, resuspending it in MS liquid culture medium, adding acetosyringone, calcium chloride, 6-BA and MES to prepare the Agrobacterium rhizogenes K599 infection fluid; the Agrobacterium rhizogenes K599 infection fluid is used for soaking or injection.

[0014] The Agrobacterium rhizogenes K599 bacterial lawn is prepared by the following method: the bacterial liquid of Agrobacterium rhizogenes K599 is evenly spread on a resistant plate for cultivation to obtain the Agrobacterium rhizogenes K599 bacterial lawn.

[0015] Optionally, the vacuum pressure is 0.04 MPa.

[0016] Optionally, the co-culture condition is co-cultivation in the dark for 3 days.

[0017] Optionally, the root-removed rubber seedling variety is GT1.

[0018] The technical solution provided by this application may have the following beneficial effects:

[0019] 1) The present application provides a method for constructing positive roots mediated by Agrobacterium rhizogenes under non-tissue culture conditions. Compared with conventional plant transgenic systems, the method described in the present application can bypass a series of complex operations such as tissue culture, and is simple, rapid, low-cost, easy to operate, and independent of genotype.

[0020] 2) Because the genetic transformation of GT1 rubber tree is very difficult, the somatic embryo regeneration and genetic transformation system that have not been established so far make there is no relevant report on the genetic transformation of GT1 rubber tree for reference at present. The application utilizes the plant transgenic technology mediated by Agrobacterium rhizogenes under the condition of non-tissue culture, and the instantaneous conversion rate is high, and the stable genetic transformation of rubber tree root can be realized, and the transgenic hairy root of rubber tree is obtained at 2-3 month, which has made a great contribution to the research on genetic transformation of rubber tree root.

[0021] 3) This application uses the rootless rubber seedlings of the GT1 variety as explants, and systematically studies factors such as the infection method, bacterial strain, and bacterial solution concentration, screens out conditions suitable for rhizogenes Agrobacterium to infect rubber trees, and obtains transgenic roots. This application preliminarily explores a genetic transformation method for rubber tree roots that does not rely on tissue culture, providing a theoretical basis and technical support for the genetic improvement of rubber trees.

[0022] It should be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the present application. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The above and other objects, features and advantages of the present application will become more apparent through a more detailed description of exemplary embodiments of the present application in conjunction with the accompanying drawings, wherein the same reference numerals generally represent the same components in the exemplary embodiments of the present application.

[0024] Figure 1 It is a schematic diagram of the process of Agrobacterium rhizogenes infecting rubber seedlings shown in the present application;

[0025] Figure 2 It is a schematic diagram of different levels of staining intensity shown in this application;

[0026] Figure 3 This is a schematic diagram of the instantaneous conversion intensity after infection under different infection conditions shown in this application; A. Bacterial liquid concentration OD 600 =0.4, soak and infect for 10 min; B. Bacterial solution concentration OD 600=0.6, soak and infect for 15 min; C. Bacterial concentration OD 600 =0.8 Soaking and infection for 20 minutes; D. Bacterial solution concentration OD 600 =0.4 infection for 15 min; E. Bacterial concentration OD 600 =0.6 infection for 20 min; F. Bacterial concentration OD 600 =0.8 infection for 10 min; G. Bacterial concentration OD 600 =0.4 infection for 20 min; H. bacterial solution concentration OD 600 =0.6 infection for 10 min; I. Bacterial concentration OD 600 =0.8 infection for 15 min; J. Uninfected materials were used as negative control;

[0027] Figure 4 Schematic diagram of GUS-positive hairy roots identified in this application;

[0028] Figure 5 Schematic diagram of PCR identification of transgenic hairy roots shown in the present application; wherein the electrophoretic diagrams from top to bottom are: DNA electrophoretic diagram of regenerated hairy roots of rubber seedlings; electrophoretic diagram of PCR identification of internal reference gene (HbActin), kanamycin resistance gene (NptII) and GUS gene;

[0029] Figure 6 Schematic diagram of the injection method used in the present application to obtain the RUBY and JcFT gene-transformed rubber tree hairy roots and positive transgenic root plants; AB. Agrobacterium carrying 35S:RUBY infects rubber trees to grow red transgenic roots; C. Agrobacterium carrying SUC2:JcFT infects rubber trees to obtain positive transgenic root plants; D. PCR identification of the JcFT gene using rubber tree hairy root DNA as a template. DETAILED DESCRIPTION

[0030] The embodiments of the present application will be described in more detail below with reference to the accompanying drawings. Although the embodiments of the present application are shown in the accompanying drawings, it should be understood that the present application can be implemented in various forms and should not be limited by the embodiments described herein. On the contrary, these embodiments are provided to make the present application more thorough and complete, and to fully convey the scope of the present application to those skilled in the art.

[0031] Experimental Materials

[0032] Plant materials: Hevea brasiliensis GT1 seed seedlings were obtained from the greenhouse of Xishuangbanna Tropical Botanical Garden, Chinese Academy of Sciences (21°41'N / 101°25'E, 570 m above sea level).

[0033] Vector strains: The strains used in the experiment were Agrobacterium rhizogenes K599, C58C1, and Ar.1193 containing the target vector (pCAMBIA2301) and target genes (35S:GUS, 35S:RUBY, SUC2:JcFT). The strains and plasmids were preserved in the laboratory.

[0034] YEB medium: beef extract 5 g·L -1 , peptone 5 g·L -1 , yeast extract 1g·L -1 ,MgSO4·7H2O0.5g·L -1 , sucrose 5g·L -1 , dissolve in distilled water, adjust pH to 7.0, add 15 g·L agar powder to solid medium -1 .

[0035] Example 1

[0036] Explant preparation:

[0037] GT1 rubber tree seeds were collected from Mengla Farm. Full and undamaged seeds were selected and planted in sand pools. After covering with sand, they were sprayed with fungicide and watered twice a week. When the rubber seedlings grew to 10 cm, they were used for Agrobacterium infection. The larger the GT1 rubber seedlings, the more latex they contained, which was not conducive to infection.

[0038] Preparation of Agrobacterium rhizogenes K599, C58C1 or Ar.1193 bacterial solution:

[0039] Preparation of Agrobacterium rhizogenes K599, C58C1 or Ar.1193 bacterial solution: Take out Agrobacterium K599, C58C1 or Ar.1193 strains from a -80°C refrigerator, activate and culture at 28°C for 2 days, pick out a single clone and inoculate it into a YEB medium containing 100 mg / L kanamycin and spectinomycin, shake and culture at 28°C, 200 r·min-1 for 12 hours, aspirate 200 μL of the bacterial solution and add it into 50 mL of liquid culture medium containing antibiotics (100 mg / L kanamycin and spectinomycin), shake and culture at 28°C, 200 r·min-1 for 8-12 hours to prepare Agrobacterium rhizogenes K599, C58C1 or Ar.1193 bacterial solution, aspirate 0.5 mL of Agrobacterium rhizogenes K599 bacterial solution and measure the absorbance OD600 value of the bacterial solution;

[0040] Preparation of Agrobacterium rhizogenes infection solution and Agrobacterium rhizogenes lawn:

[0041] Preparation of infection medium of Agrobacterium rhizogenes K599, C58C1 or Ar.1193: Centrifuge the bacterial solution of Agrobacterium rhizogenes K599, C58C1 or Ar.1193 at 8000×g, resuspend it in 50mL MS liquid medium, and add 100μmol·L -1Acetosyringone, 100mmol·L -1 Calcium chloride, 5 mg·L -1 6-BA, 50mg·L -1 MES, the prepared Agrobacterium rhizogenes K599 infection solution, C58C1 infection solution or Ar.1193 infection solution is used for infection or injection.

[0042] Preparation of Agrobacterium rhizogenes K599 bacterial lawn: 2 ml of K599, C58C1 or Ar.1193 bacterial liquid prepared by the above preparation method is evenly spread on a resistant plate and cultured at 28°C for 2 days to prepare Agrobacterium rhizogenes K599, C58C1 or Ar.1193 bacterial lawn.

[0043] Experimental procedures

[0044] 1) Detection of instantaneous conversion rate of different strains:

[0045] The roots of rubber seedlings were cut at the hypocotyl 1 cm away from the cotyledons and inoculated with Agrobacterium rhizogenes (OD 600 =0.6) K599, C58C1, Ar.1193 infection solution was soaked and infected with root-removed rubber seedlings. During the period, the seedlings were placed in a vacuum instrument to evacuate the vacuum, and the pressure of the vacuum was 0.04MPa. The infection was carried out for 20, 40, and 60 minutes respectively, so that the root-removing Agrobacterium infection solution was fully in contact with the hypocotyls of the root-removing rubber seedlings. After infection, the seedlings were cultured in 0.8% agar at 28°C in the dark for 3 days. 12 root-removing rubber seedlings were randomly selected to detect the instantaneous conversion rate of the incision by GUS. The remaining root-removing rubber seedlings were moved to a sand pool for culture. After 60 days of culture, the rooting of hairy roots and the positive root situation were counted, and then the rooted seedlings with positive roots were transplanted to flower soil for further phenotype analysis, and GUS staining was used to identify whether the rooted seedlings were blue.

[0046] GUS staining was used to detect the transient expression rate of the reporter gene. After the regenerated hairy roots were washed with sterile water, they were placed in the GUS staining solution and stained at 37°C for 6 hours, and then decolorized with 95% alcohol. The staining was counted and graded according to the staining intensity, and the transient expression efficiency was calculated [GUS transient expression rate (%) = number of explants containing blue dots / total number of stained explants × 100], and the optimal infection conditions were screened according to the GUS transient expression efficiency.

[0047] 2) Comparison of instantaneous conversion rate and stable conversion rate of different bacterial concentrations and infection methods

[0048] Adopt OD 600The root-deleted rubber seedlings were infected with Agrobacterium K599 bacterial moss prepared from Agrobacterium K599 bacterial liquid containing the target vector (pCAMBIA2301 vector containing 35S promoter and GUS gene) at OD 0.4, 0.6 and 0.8 (the solid bacterial moss was applied to the wound of the root-deleted rubber seedlings); 600 The root-removed rubber seedlings were respectively infected with the Agrobacterium rhizogenes K599 infection solution prepared from the Agrobacterium rhizogenes K599 bacterial solution containing the target vector (pCAMBIA2301 vector containing the 35S promoter and the GUS gene) by immersion infection (immersion is to place the root-removed rubber seedlings in a large bottle of Agrobacterium rhizogenes infection solution and immerse and shake continuously) or injection infection (injection is to suck the bacterial solution into a syringe, insert the needle into the tissue near the plant formation layer, and then inject the bacterial solution into it), and vacuumed for 10, 15 or 20 minutes respectively, and the vacuum pressure was 0.04MPa. After vacuuming, the seedlings were co-cultured in 0.8% agar at a constant temperature of 28°C and dark conditions for 3 days. After infection and co-culture for 3 days, 12 seedlings were randomly selected, and the infection site was cut off to compare the infection efficiency by GUS staining, and the transient expression efficiency of the incision was detected by GUS. Then the root-removed seedlings were moved to a sand pool for culture. Each experiment included 35 explants and was repeated 3 times. The rooting rate was counted after 30 days. After 60 days, 12 long-rooted rubber seedlings were randomly selected for observation, and the root tips were taken for GUS staining to count the positive rate of transgenic roots.

[0049] The rooted seedlings with positive roots were transplanted into flower soil for further phenotype analysis, and GUS staining was used to identify whether the rooted seedlings appeared blue.

[0050] GUS staining was used to detect the reporter gene stable transformation positive rate. The steps are as shown above.

[0051] Identification of positive roots:

[0052] After 90 days of inoculation of explants with Agrobacterium rhizogenes K599 infection solution containing the target vector (pCAMBIA2301 vector containing 35S promoter and GUS gene), all materials produced a large number of hairy roots, and the genomic DNA of the hairy roots was extracted for PCR identification. The method steps are as follows: regenerated hairy roots were taken and genomic DNA was extracted using the CTAB method; wild-type rubber hairy roots were used as negative controls, and plasmids containing the GUS gene were used as positive controls for PCR amplification. The forward primer XT50 for identifying the GUS gene was GCTCCTACAAATGCCATCATTGCGATA, and the reverse primer XD446 was GCTTTGGACAT ACCATCCGT; the forward primer XD49 for the internal reference gene HbActin of rubber trees was AGTGTGATGTGGATATCAGG, and the reverse primer XD50 was GGGATGCAAGGATAGATC. PCR amplification system: 10 μL Taq PCR Master Mix, 1.0 μL DNA template, 0.5 μL primers XD626 and XD627, ddH2O to 20 μL. Amplification conditions are as follows: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 58°C annealing for 30 s, 72°C extension for 30 s, 35 cycles; 72°C extension for 8 min, PCR results were detected by 1% agarose gel electrophoresis.

[0053] Experimental results:

[0054] 1) Comparison of the instantaneous conversion rates of different strains. The experimental results are shown in Table 1.

[0055] Table 1 Comparison of instantaneous conversion rates of different strains

[0056]

[0057]

[0058] Note: Each group was repeated three times, with 35 seedlings in each repeat.

[0059] The wounds of rubber tree seedlings were infected with three kinds of Agrobacterium rhizogenes infection solutions (K599, C58C1, Ar.1193) containing the target vector (pCAMBIA2301 vector containing 35S promoter and GUS gene) respectively. After 60 days of cultivation, the rooting of hairy roots and the number of positive roots were counted ( Figure 1). The results showed that after infection with K599, C58C1 and Ar.1193 strains, Ar.1193 had the highest average root number (Table 1). Under all infection conditions, the transient expression efficiency of K599 strain was higher than that of C58C1 and Ar.1193 (Table 1). C58C1 had the highest average root number under the condition of 60 minutes of vacuuming, but the mortality rate was also high; only plants with positive roots could be detected under the condition of 40 minutes of vacuuming. Although the transient transformation rate of Ar.1193 was not high, the mortality rate after infection was the lowest, and the number of plants with positive roots detected was also the least among the three strains. With the increase of vacuuming time, the transient transformation rate and average root number of the three strains after infection also increased, but the mortality rate also increased, indicating that the vacuuming time was positively correlated with the transient transformation rate and root number. The results showed that the K599 strain had the highest transient transformation rate, reaching 94.45%, and the positive rate was also the highest, reaching 22.85%. Therefore, the K599 strain was suitable for genetic transformation of GT1 rubber seedlings.

[0060] 2) The instantaneous conversion rate and stable conversion rate of different bacterial concentrations and infection methods are shown in the following table.

[0061] The experimental results of instantaneous conversion rate of different bacterial concentrations and infection methods are shown in Table 2.

[0062] Table 2 Comparison of instantaneous transformation efficiency of bacterial solutions with different concentrations

[0063]

[0064]

[0065] Note: Each group of samples consists of 35 strains. The lowercase letters after the data indicate significant differences (P≤0.05). The values ​​after ± are the standard deviations of three repeated tests.

[0066] As shown in Table 2, the bacterial solution concentration OD 600 =0.6, the transient expression rate of the explants infected by immersion in bacterial solution was the highest, reaching 88.33% (Table 2); the transient transformation efficiency of infection by wrapping bacteria was independent of the concentration of the inoculated bacterial solution, and the transformation efficiency was between 83.33% and 91.67% (Table 2); the bacterial solution concentration OD 600 =0.8, the transient expression efficiency of injection infection was the highest, reaching 91.67% (Table 2), and the transient expression efficiency increased with the increase of bacterial concentration. In addition, we also analyzed the effects of different infection methods by comparing the GUS staining intensity. First, we defined the signal intensity level according to the staining intensity ( Figure 3 ), then calculate the total grade of dyeing material ( Figure 3, Table 2). The results showed that the total signal of the infection method was the strongest and was basically not affected by the concentration of the inoculated bacterial solution. The GUS intensity reached between 21.2 and 33.3 (Table 2). The bacterial solution immersion method and the injection infection method were both within the range of OD 600 When =0.8, the total GUS intensity is the strongest, reaching 27 and 34.04 respectively.

[0067] When the bacterial solution concentration OD600 = 0.8, the transient expression rate of the two infection methods, the infection with wrapped bacteria and the injection infection, was the highest, and the transient conversion rate reached 91.67%, which was significantly higher than the infection with soaked bacteria. The GUS staining intensity also reached 33 and 34 respectively, so the genetic transformation of rubber trees is recommended to use the infection with wrapped bacteria and the injection infection. The effect of vacuuming on transient expression is not obvious, but it has an effect on GUS intensity. The longer the vacuum time, the stronger the GUS intensity; indicating that vacuum can not effectively improve the efficiency of Agrobacterium infection but can improve the GUS signal intensity (Table 2).

[0068] The experimental results of stable conversion rate of different bacterial concentrations and infection methods are shown in Table 3.

[0069] Table 3 Stable transformation rate of different infection methods

[0070]

[0071]

[0072] Note: Each group was repeated three times, with 35 rubber seedlings in each repeat.

[0073] As shown in Table 3, with the increase of bacterial solution concentration, the average number of roots of rubber seedlings after infection with bacterial solution decreased slightly, from 2.98 to 2.55 roots, while the mortality rate increased from 11.43% to 18.09% (Table 3). The positive rate was low at all concentrations, and the transformation efficiency was not high. After infection with bacterial solution, the average number of roots of the flat moss prepared with different concentrations of bacterial solution did not change much, but the mortality rate increased, especially at the bacterial solution concentration OD 600 = 0.8, the mortality rate reached the highest level when vacuum was drawn for 10 minutes, reaching 34.28%. The positive rate after infection with bacteria was low, indicating that the infection with bacteria with bacteria was not the best solution for rubber (Table 3). The average number of roots in injection infection was the highest, but it was also accompanied by a higher mortality rate. For injection infection, at a bacterial concentration of OD 600 =0.8, positive roots were obtained under vacuum for 15 minutes, and the positive rate was as high as 35.2%, which was more conducive to the genetic transformation of rubber trees than the other two infection methods (Table 3). Increasing the concentration of bacterial solution and extending the vacuum time in the infection of wrapped fungi could not effectively increase the average number of roots. However, vacuuming for 15 minutes in the injection method had a higher number of roots and positive rate. The injection method and the bacterial solution concentration OD 0. 600=0.8, vacuum for 15 min, the most positive roots were obtained, and the positive root signal was the strongest ( Figure 4 ). Injection method: at bacterial concentration OD 600 When =0.8, the number of rooting seedlings is larger, but the mortality rate is also higher. It is still necessary to weigh the concentration of bacterial solution to balance the rooting efficiency and plant survival rate.

[0074] For the identification of positive roots, the explants were infected with the infection solution of Agrobacterium rhizogenes K599 containing the target vector (pCAMBIA2301 vector containing 35S promoter and GUS gene) and cultured for 90 days. The genomic DNA of the hairy roots was extracted for PCR identification. The experimental results showed that after 1% agarose gel electrophoresis, it was found that the reference gene could amplify bright bands in all samples except the negative control, and the band size was consistent with the expected 235bp, indicating that the DNA quality met the requirements. All NPTII genes could amplify bands, indicating that the primers were not specific, so this group of results was not used to calculate the transgenic positive rate. The results of the identification of the GUS gene showed that the hairy root DNA numbered 4, 6, 7, 9, 11, and 14 contained the GUS gene, indicating that the plants numbered 4, 6, 7, 9, 11, and 14 had positive transgenic roots ( Figure 5 ), the other plants did not contain positive transgenic roots, and the positive transformation rate reached 6 / 15=40%.

[0075] Example 2: Obtaining transgenic hairy roots transformed with reporter gene RUBY and functional gene JcFT

[0076] OD carrying 35S:RUBY and SUC2:JcFT 600 The root-deleted rubber seedlings were infected by injection with 0.8% Agrobacterium rhizogenes K599 infection solution (the infection solution was sucked into the syringe, inserted into the tissue near the rubber cross-section cambium through the needle, and then the infection solution was injected into the tissue), and then vacuumed at 0.04MPa for 15min. After vacuuming, they were co-cultured in 0.8% agar at 28℃ in the dark for 3d, and then transplanted to a sand pool for culture.

[0077] After 90 days of cultivation, it was found that the plants infected with 35S:RUBY had grown red hairy roots ( Figure 6 A, B), showing that transgenic hairy roots expressing the RUBY reporter gene were obtained.

[0078] After 90 days of cultivation, the genomic DNA of the hairy roots produced by the infection of the K599 strain carrying SUC2:JcFT was extracted, and the JcFT gene was identified by PCR. The specific steps were as follows: the regenerated hairy roots were taken and the genomic DNA was extracted using the CTAB method; the wild-type rubber hairy roots were used as negative controls, and the plasmids containing the GUS and JcFT genes were used as positive controls for PCR amplification. The forward primer XD626 for identifying the JcFT gene was TCGTGTGATTGGGGATGTTTTA, and the reverse primer XD627 was TGGTGGATACACGGT CTGCCTT; the forward primer XT452 for the kanamycin resistance gene NptⅡ was GGCGATACCGTAAAGCACGAGGAA, and the reverse primer XT453 was CTATGACTGGGCACAACAGACAAT; the forward primer XD49 for the rubber tree internal reference gene HbActin was AGTGTGATTGGATATCAGG, and the reverse primer XD50 was GGGATGCAAGGATAGATC. PCR amplification system: 10μL Taq PCR Master Mix, 1.0μL DNA template, 0.5μL primers XD626 and XD627, ddH2O to 20μL. Amplification conditions are as follows: 94℃ pre-denaturation for 3min, 94℃ denaturation for 30s, 58℃ annealing for 30s, 72℃ extension for 30s, 35 cycles; 72℃ extension for 8min, PCR results were detected by 1% agarose gel electrophoresis. The experimental results are as follows: According to the 1% agarose gel electrophoresis, plants numbered 2, 4, 5, 6, 7, 8, and 10 were found to have positive transgenic roots ( Figure 6 D), the other plants did not contain positive transgenic roots, and the positive transformation rate was 7 / 11=63.7%.

[0079] Infection efficiency is a key factor in determining the success of genetic transformation. 600 =0.8, whether using the infection method or injection infection method, the instantaneous transformation rate reached 91.67%. This shows that Agrobacterium at high concentrations can more effectively contact and deliver foreign genes into plant cells, promoting the transfer of T-DNA. It is worth noting that at the bacterial solution OD 600 =0.8, the injection infection method and vacuum for 15 min not only had a high transformation rate, but also a strong signal intensity, suggesting that this infection strategy may be more suitable for genetic manipulations that require precise gene localization and efficient expression. However, the instantaneous transformation rate and the positive rate in this study were too different. The instantaneous transformation rate was as high as 91.67% (Table 2), but the hairy root transformation rate was only about 35.2% (Table 5), indicating that most transformed cells did not differentiate into hairy roots. The results of the transient transformation showed that the entire infected section had GUS signals ( Figure 1-2), but only the cambium had hairy roots; some positive roots may not show signals after staining; in addition, the positive rate of PCR identification was also higher than that of GUS staining, suggesting that Agrobacterium contamination may have caused the high positive rate of PCR identification.

[0080] This study found that the effect of vacuum on the instantaneous transformation rate was irregular, which may be due to the different effects of vacuum on cell permeability and the interaction between Agrobacterium and plant cells under different infection methods. The combination of injection infection plus vacuum for 15 minutes showed a higher transformation rate, which suggests that appropriate vacuum can promote transformation.

[0081] The following conclusions were drawn based on the research results: (1) The infection methods of both infection by wrapping and injection had different concentrations of bacterial solution OD 600 =0.8, the transient expression rate was the highest, reaching 91.67%, significantly higher than other conditions. Increasing the bacterial concentration helps to improve the transient transformation efficiency, especially for injection infection. (2) Bacterial concentration OD 600 =0.8, injection infection and vacuuming for 15 minutes, the positive rate of hairy roots was 35.2%, which is the combination with the highest positive rate; injection infection is more conducive to the genetic transformation of rubber trees than the other two infection methods. The three rhizogenes Agrobacterium K599, C58C1, and Ar.1193 can successfully infect rubber tree seedlings, among which K599 has the highest instantaneous transformation rate of 94.45%. (3) After the explants were infected with K599 bacterial solution carrying 35S:GUS for 90 days, 15 explants were randomly selected to extract hairy root DNA for PCR amplification. PCR detection showed that 6 of the 15 hairy roots were identified to have the GUS gene, and the positive transformation rate reached 40%. (4) The transgenic rubber tree hairy roots with the transformation reporter gene RUBY and the functional gene JcFT were obtained by injection mediated by rhizogenes.

[0082] In summary, this study successfully established a tissue culture-independent Agrobacterium rhizogenes-mediated genetic transformation method for rubber tree hairy roots using GT1 rubber seedlings as materials. The effects of different strains, different infection methods, bacterial solution concentrations, and vacuum time on the genetic transformation efficiency of rubber trees were systematically explored, and rubber tree hairy roots with transformation reporter genes and functional genes were obtained. Using this transformation method, transgenic hairy roots of rubber trees can be obtained in 2 months. In the later stage, combined with gene editing, RNAi and other technologies, morphogenetic gene-assisted strategies, it is possible to simply and quickly carry out research on the gene function of rubber trees.

[0083] The embodiments of the present application have been described above, and the above description is exemplary, not exhaustive, and is not limited to the disclosed embodiments. Many modifications and changes will be apparent to those of ordinary skill in the art without departing from the scope and spirit of the described embodiments. The selection of terms used herein is intended to best explain the principles of the embodiments, practical applications, or improvements to the technology in the market, or to enable other persons of ordinary skill in the art to understand the embodiments disclosed herein.

Claims

1. A method for genetic transformation of rubber tree roots that is independent of tissue culture, characterized in that: The rootless rubber seedlings were infected with Agrobacterium rhizogenes K599 to achieve tissue culture-independent genetic transformation of rubber tree roots.

2. The rubber tree root genetic transformation method according to claim 1, wherein The root-removed rubber seedlings are infecting the Agrobacterium rhizogenes K599 infection solution or the Agrobacterium rhizogenes K599 bacterial moss prepared with the Agrobacterium rhizogenes K599 bacterial solution containing the target vector, and then vacuuming is performed. The root-removed rubber seedlings after vacuuming are placed in agar for co-cultivation, and then moved to a sand pool for cultivation.

3. The rubber tree root genetic transformation method according to claim 2, wherein The OD of Agrobacterium rhizogenes K599 bacterial solution 600 is 0.4-0.8; the vacuum time is 10-20min; the infection method is the wrapping method, immersion method or injection method.

4. The rubber tree root genetic transformation method according to claim 3, wherein The OD of Agrobacterium rhizogenes K599 bacterial solution 600 is 0.8; the vacuum time is 15 minutes; and the infection method is injection.

5. The rubber tree root genetic transformation method according to claim 1 or 2, characterized in that, The root removal of the rubber seedlings is performed by cutting off the roots of the rubber seedlings at the hypocotyl 1 cm away from the cotyledons of the rubber seedlings.

6. The rubber tree root genetic transformation method according to claim 2, wherein The target vector refers to the pCAMBIA2301 vector containing the target gene; the target gene is the GUS gene, the RUBY gene or the JcFT gene.

7. The rubber tree root genetic transformation method according to claim 2, wherein The Agrobacterium rhizogenes K599 infection solution is prepared by the following method: the Agrobacterium rhizogenes K599 bacterial solution is centrifuged and then resuspended in MS liquid culture medium, and acetosyringone, calcium chloride, 6-BA and MES are added to prepare the Agrobacterium rhizogenes K599 infection solution; the Agrobacterium rhizogenes K599 infection solution is used for soaking or injection. The Agrobacterium rhizogenes K599 bacterial lawn is prepared by the following method: the Agrobacterium rhizogenes K599 bacterial liquid is evenly spread on a resistance plate to culture to obtain the Agrobacterium rhizogenes K599 bacterial lawn.

8. The rubber tree root genetic transformation method according to claim 2, wherein The vacuum pressure is 0.04 MPa.

9. The rubber tree root genetic transformation method according to claim 2, wherein The co-culture condition is co-culture in the dark for 3 days.

10. The method for genetic transformation of rubber tree roots according to claim 2, wherein The variety of the root-removed rubber seedlings is GT1.

Images