Construct for mediating male sterility of corn and application thereof

Abstract

The invention relates to the field of molecular crop breeding, in particular to a construction body mediating male sterility of maize and application of the construction body. The functional element expression cassettes are respectively a red fluorescent gene DsRed expression cassette, a male fertility restoring gene MS45 expression cassette, a tassel pollen lethal gene ZmAmylase expression cassette and a glufosinate-resistant herbicide gene PAT expression cassette. According to the obtained progeny plant seeds with the specific constructs, red maintainer line seeds can be directly observed by naked eyes under the condition of not using other equipment, and the seeds have herbicide glufosinate-ammonium resistance, so that the screening mode is greatly simplified, and a large amount of labor cost is saved; meanwhile, herbicide resistance is generated, and an important effect is achieved on field screening or weed killing.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular crop breeding, and in particular to a construct for mediating male sterility in corn and its application. Background Art

[0002] Corn plant ( Zeamays L. ) exhibits a unique situation, with male flowers on the tassel and female flowers on the ear on the same plant, which can reproduce through both self-pollination and cross-pollination. Natural pollination in corn occurs when wind blows pollen from the tassel to the silk that protrudes from the tip of the initial ear. In order to produce better traits in crops (such as disease and insect resistance, heat and drought tolerance, etc.), the combination of genetic material is usually achieved through corn hybridization. These processes rely on specific male parents to donate pollen to the female parents to produce the resulting hybrids.

[0003] Therefore, controlling plant fertility is of great significance for corn hybridization. In order to avoid pollen cross-pollination under natural open conditions, artificial emasculation is generally used to remove the top male tassel of the recipient parent. However, this emasculation method consumes a lot of manpower and material resources, increases seed production costs, and incomplete emasculation still poses the risk of pollen cross-pollination. The offspring of the sterile lines obtained by conventional breeding cannot continue to breed male sterile materials; sterile plants cannot be quickly distinguished from fertile plants, and the method of screening positive plants is relatively complicated. Summary of the invention

[0004] The present invention provides a construct for mediating male sterility of corn and its application in corn breeding. The obtained offspring plant seeds carrying a transgenic vector can be directly observed as red maintainer seeds with the naked eye without using other equipment, and have resistance to the herbicide glufosinate ammonium, which greatly simplifies the screening method and saves a lot of labor costs; at the same time, herbicide resistance is generated, which plays an important role in field screening or killing weeds.

[0005] One aspect of the present invention provides a construct for mediating male sterility in corn, using the following technical solution: A construct for mediating male sterility in corn comprises four functional element expression cassettes, wherein the functional element expression cassettes are: a. Red fluorescent gene DsRed expression cassette; b, male fertility restorer gene MS45 expression cassette; c. Expression cassette of the male tassel pollen lethal gene ZmAmylase; d. glufosinate-ammonium herbicide resistance gene PAT expression cassette; The above four functional element expression cassettes are connected in series, and the order of connection is red fluorescence gene DsRed expression cassette, male fertility restoration gene MS45 expression cassette, male spike pollen lethal gene ZmAmylase expression cassette, and glufosinate herbicide resistance gene PAT expression cassette.

[0006] In the above scheme, the inventors selected DsRed as the red fluorescent color gene, Ms45 as the male fertility restoration gene, ZmAmylase as the male spike pollen lethal gene, and PAT as the screening agent for tolerance to glufosinate herbicide. It was found during the experiment that when these four genes were constructed into the expression vector in the order of DsRed, MS45, ZmAmylase, and PAT, a specific effect could be unexpectedly presented, that is, the red maintainer seeds could be directly observed by the naked eye in the offspring plant seeds without the use of other equipment.

[0007] Preferably, the nucleotide sequence of the red fluorescent gene DsRed is shown in SEQ ID NO:1, the nucleotide sequence of the male fertility restorer gene MS45 is shown in SEQ ID NO:2, the nucleotide sequence of the male spike pollen lethal gene ZmAmylase is shown in SEQ ID NO:3, and the nucleotide sequence of the glufosinate herbicide resistance gene PAT is shown in SEQ ID NO:4.

[0008] Preferably, the red fluorescent gene DsRed expression cassette is composed of a barley aleurone-specific expression protein promoter (HvLPT2) operably linked to a red fluorescent protein DsRed gene, and operably linked to a potato proteinase inhibitor II gene terminator (tPinII).

[0009] Preferably, the male fertility restorer gene MS45 expression cassette is composed of an anther-specific expression promoter Ubi (pZm5126) derived from maize, operably linked to the male fertility protein MS45 maize fertility restorer gene (ZmMS45), and operably linked to a terminator (tZmMS45) derived from the maize fertility restorer gene.

[0010] Preferably, the tassel pollen lethal gene ZmAmylase expression cassette consists of a pea chromosome motif (MAR1) for enhanced expression, operably linked to a maize promoter (pZmPG47) derived from a maize polygalacturonase gene, operably linked to a maize brittle-1 gene transit peptide, operably linked to a maize tassel pollen lethal gene (ZmAmylase), and operably linked to a terminator (tIn2) derived from a rice genome sequence.

[0011] Preferably, the glufosinate herbicide-resistant gene PAT expression cassette consists of a maize ubiquitin gene promoter (pZmUbi1), operably linked to a glufosinate tolerance gene (PAT) encoding phosphinothricin acetyltransferase, and operably linked to a nopaline synthase transcription terminator (tNos).

[0012] Another aspect of the present invention provides the use of the above-mentioned construct for mediating corn male sterility to obtain corn male sterile lines and maintainer line materials.

[0013] The present invention also provides a method for controlling male sterility in corn, using the above construct.

[0014] A corn male sterile line or maintainer line material is obtained by adopting the above method.

[0015] The present invention also provides a method for screening maintainer seeds in offspring plants obtained based on the above method for controlling corn male sterility. Without using other equipment, red seeds are maintainer seeds through direct observation with the naked eye.

[0016] By implementing the above technical solution, the present invention has the following advantages over the prior art: The offspring plant seeds with the construct of the present invention obtained by the present invention can be directly observed as red maintainer seeds with the naked eye without the use of other equipment, and have resistance to the herbicide glufosinate ammonium, which greatly simplifies the screening method and saves a lot of labor costs; at the same time, herbicide resistance is generated, which plays an important role in field screening or killing weeds. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 A map of the construct provided by the present invention; Figure 2 This is the electrophoresis diagram for verifying the target gene of the transgenic corn plant of the present invention; Figure 3 This is the color expression of the corn ear obtained by the present invention.

[0018] Figure 4 This is the color performance of corn ears obtained by the comparative experiment of the present invention.

[0019] Figure 5 The tassel traits of the self-pollinated progeny of the maintainer line obtained by the present invention; Figure 6 This is the KI-I2 staining result of the maintainer transgenic corn pollen obtained by the present invention. DETAILED DESCRIPTION

[0020] The present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments. Unless otherwise specified, the reagents and equipment used in the present invention are conventional reagents and equipment in the art. Of course, the adoption of instruments and materials in the embodiment is not limited to the enumeration of this example, but is based on the technical problems that can be solved in the present invention and the corresponding technical effects are realized.

[0021] The experimental methods in the following examples without specifying specific conditions are usually carried out under conventional conditions or conditions recommended by the manufacturers. The reagents used are all commercially available or publicly available reagents unless otherwise specified.

[0022] In the present invention, various vectors known in the art can be used, such as commercially available vectors, including plasmids and the like.

[0023] Example 1: Construction, storage and detection of recombinant expression vector The red fluorescent gene DsRed with the nucleotide sequence shown in SEQ ID NO:1, the male fertility restorer gene MS45 with the nucleotide sequence shown in SEQ ID NO:2, the tassel pollen lethal gene ZmAmylase with the nucleotide sequence shown in SEQ ID NO:3, and the glufosinate-resistant herbicide gene PAT with the nucleotide sequence shown in SEQ ID NO:4 were synthesized by Nanjing GenScript Biotechnology Co., Ltd.

[0024] 1.1 Vector construction The recombinant expression vector pMs (such as Figure 1The vector comprises four transgenic expression cassettes in series, wherein the first expression cassette is composed of a barley aleurone-specific expression protein promoter (HvLPT2), operably linked to a red fluorescent protein DsRed gene, and operably linked to a potato proteinase inhibitor II gene terminator (tPinII); the second expression cassette is composed of a maize anther-specific expression promoter Ubi (pZm5126), operably linked to a male fertility restorer protein MS45 maize fertility restorer gene (ZmMS45), and operably linked to a maize fertility restorer gene terminator (tZmMS45); the third expression cassette is composed of a promoter derived from maize for enhancing expression, and a promoter derived from maize for enhancing expression. The invention discloses a pea chromosome motif (MAR1), operably connected to a maize promoter (pZmPG47) derived from a maize polygalacturonase gene, operably connected to a maize brittle-1 gene transit peptide, operably connected to a maize tassel pollen lethal gene (cZmAmylase), and operably connected to a terminator (tIn2) derived from a rice genomic sequence; the fourth expression cassette is composed of a maize ubiquitin gene promoter (pZmUbi1), operably connected to a glufosinate tolerance gene (PAT) encoding phosphinothricin acetyltransferase, and operably connected to a transcription terminator (tNos) of nopaline synthase. The vector pMs is transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) by liquid nitrogen method, and the transformed cells are screened with phosphinothricin acetyltransferase (PAT) as a selection marker.

[0025] At the same time, according to the same construction method as above, a recombinant expression vector pMs-CK was constructed. The only difference between pMs-CK and pMs is that the order of the four tandem transgenic expression cassettes is different. The order of the recombinant expression vector pMs-CK is: male fertility restoration gene MS45 expression cassette, male tassel pollen lethal gene ZmAmylase expression cassette, red fluorescence gene DsRed, glufosinate herbicide resistance gene PAT. The vector pMs-CK was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) by liquid nitrogen method, and the transformed cells were screened with phosphinothricin acetyltransferase (PAT) as a selection marker.

[0026] 1.2 Plant transformation Conventional Agrobacterium infection method was used for transformation. The sterile homozygous male sterile maize embryos were co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA in the constructed recombinant expression vectors pMs and pMs-CK into the maize chromosome to produce transgenic maize events.

[0027] For Agrobacterium-mediated transformation of maize, briefly, immature embryos are separated from maize, and the embryos are contacted with an Agrobacterium suspension, wherein the Agrobacterium is capable of transferring the nucleic acid sequences of the DsRed, ZmMS45, ZmAmylase genes and the nucleic acid sequence of the PAT gene to at least one cell of one of the embryos (step 1: infection step). In this step, the embryos are specifically immersed in the Agrobacterium suspension (OD660=0.4-0.6, infection medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, grape sugar 68.5 g / L) and the like). Sugar 36g / L, acetosyringone (AS) 40mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1mg / L, pH 5.3) for inoculation. The immature embryos are co-cultured with Agrobacterium for a period of time (3 days) (step 2: co-cultivation step). Specifically, after the infection step, the immature embryos are inoculated in a solid medium (MS salt 4.3g / L, MS vitamins, casein 300mg / L, sucrose 20g / L, glucose 10g / L, acetosyringone (AS) 100mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1mg / L, agar 8g / L, pH 5.8). After this co-cultivation phase, there can be an optional "recovery" step. In the "recovery" step, at least one antibiotic known to inhibit the growth of Agrobacterium (such as cephalosporin) is present in the recovery medium (MS salts 4.3g / L, MS vitamins, casein 300mg / L, sucrose 30g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1mg / L, phytagel 3g / L, pH 5.8), and no selection agent for plant transformants is added (step 3: recovery step). Specifically, young embryos are grown in the presence of antibiotics but without the selection agent. The inoculated young embryos are then cultured on a solid medium containing a selective agent (N-(phosphonomethyl)glycine) to eliminate Agrobacterium and provide a recovery period for the infected cells. Next, the inoculated young embryos are cultured on a medium containing a selective agent (N-(phosphonomethyl)glycine) and the growing transformed callus is selected (step 4: selection step). Specifically, the young embryos are cultured on a screening solid medium with a selective agent (MS salts 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonomethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 5.8), resulting in the selective growth of transformed cells. Then, the callus is regenerated into plants (step 5: regeneration step). Specifically, the callus grown on a medium containing a selective agent is cultured on a solid medium (MS differentiation medium and MS rooting medium) to regenerate plants.

[0028] The resistant callus obtained by screening was transferred to MS differentiation medium (MS salt 4.3g / L, MS vitamin, casein 300mg / L, sucrose 30g / L, 6-benzyladenine 2mg / L, N-(phosphonomethyl)glycine 0.125mol / L, phytagel 3g / L, pH=5.8), and cultured at 25°C for differentiation. The differentiated seedlings were transferred to MS rooting medium (MS salt 2.15g / L, MS vitamin, casein 300mg / L, sucrose 30g / L, indole-3-acetic acid 1mg / L, agar 8g / L, pH=5.8), cultured at 25°C to about 10cm high, and moved to the greenhouse for culture until fruiting. In the greenhouse, culture was carried out at 28°C for 16 hours and then at 20°C for 8 hours every day.

[0029] 1.3 Detection of genetically modified plants About 100 mg of leaves from transgenic corn positive plants were taken as samples, and their genomic DNA was extracted using Qiagen's DNeasy Plant MaxiKit. The copy numbers of DsRed, ZmMs45, ZmAmylase and pat were detected by fluorescent quantitative PCR. At the same time, non-transgenic corn plants were used as controls and the detection and analysis were performed according to the above method. The experiment was repeated 3 times and the average value was taken.

[0030] The specific method is as follows: Step 1: Take 100 mg of leaves from transgenic corn plants and grind them into a homogenate using liquid nitrogen in a mortar. Take 3 replicates for each sample. Step 2: Use Qiagen's DNeasy Plant Mini Kit to extract genomic DNA from the above samples. For specific methods, refer to its product manual; Step 3, using NanoDrop 2000 (Thermo Scientific) to measure the genomic DNA concentration of the above samples; Step 4, adjusting the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μl; Step 5: Use Taqman probe fluorescence quantitative PCR method to identify the copy number of the sample, use the sample with known copy number as the standard, and use the sample of non-transgenic corn plant as the control, and repeat 3 times for each sample, and take the average value; the sequences of fluorescence quantitative PCR primers and probes are: The following primers were used to detect the DsRed gene sequence: Primer 1: TCAAGTCTATCTACATGGCCAAGAA as shown in SEQ ID NO: 5 in the sequence listing; Primer 2: GTGGGAGGTGATGTCCAGCTT as shown in SEQ ID NO: 6 in the sequence listing; Probe 1: CAGCTGCCCGGCTACTACTACGTGGA as shown in SEQ ID NO: 7 in the sequence listing.

[0031] The following primers were used to detect the ZmMS45 gene sequence: Primer 3: AAGTTGCTTTGCCATGGAGAA as shown in SEQ ID NO: 8 in the sequence listing; Primer 4: GGTACTGCACGATGCCATCA as shown in SEQ ID NO: 9 in the sequence listing; Probe 2: AACCTGCAGTGGCGG as shown in SEQ ID NO: 10 in the sequence listing.

[0032] The following primers were used to detect the ZmAmylase gene sequence: Primer 5: GAGTCCCCTGCATTTTCTACGA as shown in SEQ ID NO: 11 in the sequence listing; Primer 6: GCGTGGATATCTCCTGCTTCA as shown in SEQ ID NO: 12 in the sequence listing; Probe 3: ACATGTTCGACTGGAAC as shown in SEQ ID NO: 13 in the sequence listing.

[0033] The following primers were used to detect the PAT gene sequence: Primer 7: CCGCGGTTTGTGATATCGTT as shown in SEQ ID NO: 14 in the sequence listing; Primer 8: TCTTGCAACCTCTCTAGATCATCAA as shown in SEQ ID NO: 15 in the sequence listing; Probe 4: TAGGACAGAGCCACAAACACCACAAGAGTG as shown in SEQ ID NO: 16 in the sequence listing.

[0034] The PCR reaction system is: 2×TransStartR Green qPCR SuperMix (Transgen) 10μl, 10μM Forward primer 1μl, 10μM Reverse primer 1μl, Passive Reference Dye I (50X) 0.4μl, genomic DNA 2μl, water (ddH2O) 5.6μl.

[0035] The 50× primer / probe mixture contained 45 μL of each primer at 1 mM concentration, 50 μL of probe at 100 μM concentration, and 860 μL of 1× TE buffer and was stored in an amber tube at 4°C.

[0036] The PCR reaction conditions were: Step Temperature Time 1 95℃ 5 minutes 2 95℃ 30 seconds 3 60℃ 1 minute Return to step 2 and repeat 40 times.

[0037] The data were analyzed using SDS2.3 software (Applied Biosystems) to obtain positive transgenic corn plants that had T-DNA (DsRed, ZmMS45, ZmAmylase, PAT) successfully inserted into the above-mentioned recombinant expression vector pMs, and positive single-copy transgenic corn plants were screened. The verification diagram is shown in Figure 2 , Figure 2 It shows that the target genes DsRed, ZmMS45, ZmAmylase, and PAT have been transferred into corn plants ( Figure 2 NC is a negative control, PC is a positive control, WT is a non-transgenic corn, and 1-15 is a transgenic corn). Similarly, positive transgenic corn plants were obtained in which the T-DNA (ZmMS45, ZmAmylase, DsRed, PAT) in the above-mentioned recombinant expression vector pMs-CK was successfully inserted.

[0038] Example 2: Creation of Stable Sterile Line and Maintainer Material The transgenic pMs plant (female parent) was crossed with the heterozygous ms45 mutant (male parent), and the offspring were self-pollinated to obtain the maintainer line material with the genotype of pMs / -, ms45 / ms45 and the sterile line material with the genotype of - / , ms45 / ms45. The self-pollinated offspring of the maintainer line were observed with the naked eye at the ripening stage. About 1 / 2 of the grains were red (containing the pMs transgene), and 1 / 2 of the grains were yellow, consistent with the grains of the non-transgenic control (WT) ear. After threshing, the number of red and yellow grains in each ear was counted and recorded. The ratio of red seeds to yellow seeds in each ear of the ramet was calculated, and its P value was calculated.

[0039] The fluorescence observation method is to place the seeds under green light, and the inspector wears glasses with red lenses to observe. The transgenic seeds containing pMs appear red, while non-transgenic seeds do not appear red. The observation, recording and statistical methods are the same as the naked eye observation method.

[0040] The DsRed gene in pMs corn is expressed using an endosperm-specific expression promoter, making the seeds appear distinctly red, which is significantly different from conventional seeds when observed with the naked eye. Figure 3 The seeds of pMs in the T2-T4 generations all had obvious color differences, and the ratio of red to yellow seeds was about 1:1. They were stably inherited between generations, and the segregation ratio of red and yellow seeds is shown in Table 1.

[0041] The color of the corn cobs transformed with pMs-CK is shown in the figure (three parallel experiments). The seeds are all yellow and cannot be distinguished by naked eye. Through fluorescence observation, it can be seen that the seeds of the maintenance line are red under green light.

[0042] Example 3: Identification of corn fertility restoration effect After the seeds of the self-pollinated progeny of the maintainer line with the genotype of pMs- / ms45 ms45 were harvested, the transgenic (red maintainer line) and non-transgenic (yellow, sterile line) seeds were distinguished by naked eye observation, sown in different areas, and their pollen shedding was investigated when the plants entered the flowering period. The results showed that the plants in the non-transgenic area had no male spikes that could shed pollen, and were male sterile plants; while the plants in the transgenic area could shed pollen normally, and the other agronomic traits between the maintainer line and the sterile line were consistent, and consistent with the control, thus confirming that the transgenic material can restore the fertility of the sterile line plants, such as Figure 3 .

[0043] Example 4: Pollen killing effect detection The seeds of the maintenance line were self-pollinated to obtain red seeds of the T2-T4 generation, which were sown in the field and grown until the pollen shedding stage. The pollen vitality was detected by starch potassium iodide staining. The tassel flowers that had shed about 1 / 3 of the pollen were removed and bagged. The bags were removed the next morning, and three portions of transgenic corn pollen and non-transgenic control (WT) pollen were taken. The pollen was evenly sprinkled on the slide, covered with two drops of KI-I2 (iodine-potassium iodide) solution, and left to stand for two minutes. After obvious black pollen grains appeared, the pollen was placed under a microscope for observation. The number of black pollen and yellow pollen was counted in different regions and recorded. The number of the two types of pollen in each pollen was counted, their ratio was analyzed, and their P value was calculated, as shown in Table 2. The results showed that about 1 / 2 of the transgenic corn pollen was black (normal and vigorous non-transgenic pollen), and 1 / 2 was yellow (transgenic pollen, no vitality, starch was degraded by pollen-specific expression ZmAmylase, and could not be colored), which was in line with Mendel's law of inheritance. The pollen of the non-GM control corn is all black. Figure 6 .

[0044] Example 5: Pollen leakage rate detection When the transgenic plants in the field grow to the pollination stage, the maintainer transgenic material (Ms) is used as the male parent and the conventional background material is used as the female parent for artificial hybridization and pollination. The ear traits are investigated at the harvest stage. Theoretically, there is only one yellow grain in the ear of the offspring, which is a non-transgenic material. The pMs-CK material is now detected by fluorescence observation, and the pMs material is investigated by naked eye observation. If red seeds appear, it indicates pollen leakage. The results show that most of the grains of the T4 generation maintainer line appear yellow (transgenic seeds without pMs), see Table 3. At the same time, the number of transgenic grains of the pMs-CK control vector is detected. After threshing them separately, the number of red grains (under fluorescence) and the number of yellow grains in each ear are calculated and recorded. The ratio of red seeds to yellow seeds in each ear of the ramet is calculated, and its P value is calculated.

[0045] Table 3 Pollen leakage rate test results strain Red seeds Yellow seeds Leakage rate pMs 5 (visual observation) 781047 0.00064 pMs-CK 4 (Fluorescence observation) 546739 0.00073 Example 6: Glufosinate tolerance test This experiment selected the herbicide Glufosinate-ammonium for spraying. A randomized block design was used with 3 replicates. The plot area was 15m 2 (5m×3m), row spacing 60cm, plant spacing 25cm, conventional cultivation management, 1m wide isolation belt between plots. The transgenic corn was subjected to the following two treatments: 1) no spraying; 2) spraying with 1600 g ai / ha (4 times the recommended dose) of herbicide Safe-Tex at the V3 leaf stage, and then spraying with the same dose of Safe-Tex at the V8 stage. It should be noted that the conversion of different contents and formulations of glufosinate herbicides into the equivalent amount of glufosinate acid is applicable to the following conclusions. The phytotoxicity symptoms were investigated 1 week and 2 weeks after the application, and the yield of the plot was measured at harvest. The phytotoxicity symptom classification is shown in Table 4. The herbicide damage rate was used as an evaluation index to evaluate the herbicide tolerance of the transformation event. Specifically, the herbicide damage rate (%) = ∑ (number of plants damaged at the same level × number of levels) / (total number of plants × highest level); the herbicide damage rate refers to the glufosinate damage rate, which is determined based on the results of the phytotoxicity survey 2 weeks after glufosinate treatment. The corn yield of each plot is the total corn yield (weight) of the 3 middle rows of each plot. The yield difference between different treatments is measured in the form of yield percentage, yield percentage (%) = spraying yield / no spraying yield. The results of the herbicide tolerance of the maintenance line transgenic corn and the corn yield results are shown in Table 5.

[0046] Table 4 Grading standards for the degree of damage caused by glufosinate herbicide to corn Level of drug damage Symptom description Level 0 No pesticide damage, growth is consistent with the clear water control; Level 1 Slightly visible symptoms of drug damage, local color changes, and drug damage spots occupying less than 10% of the leaf area; Level 2 Slightly inhibit growth or chlorosis, with drug-damaged spots occupying less than 1 / 4 of the leaf area; Level 3 The growth and development are seriously affected, the leaves are deformed or the plants are dwarfed, or the spots caused by the pesticide occupy less than 1 / 2 of the leaf area. Level 4 Great impact on growth and development, severe leaf deformity or obvious dwarfing of plants or leaf spot 3 / 4 or less; Level 5 The drug damage is extremely serious, with plant death or drug-damaged spots occupying more than 3 / 4 of the leaf area. Table 5 Results of tolerance of transgenic maintainer maize to glufosinate herbicide and maize yield Project / Plant Maintain system T2 CK- Glufosinate damage rate (%) 0 0 Glufosinate damage rate (%) (guaranteed to reach 1600 g ai / ha, recommended concentration 400 g ai / ha) 0 100 Yield percentage (guaranteed to reach 1600 g ai / ha, recommended concentration 400 g ai / ha) 102 0 The results showed that in terms of herbicide (glufosinate) damage rate: 1) the damage rate of transgenic maintainer corn plants under the treatment of glufosinate herbicide (1600 g ai / ha) was basically 0, thus, the transgenic maintainer corn plants had good tolerance to glufosinate herbicide.

[0047] In terms of yield: there was no significant difference in the yield of transgenic maintainer corn plants under the two treatments of no spraying and spraying with 1600 g ai / ha glufosinate. After spraying glufosinate herbicide, the yield of transgenic maintainer corn plants did not decrease basically, which further demonstrated that transgenic maintainer corn plants have good tolerance to glufosinate herbicide.

Claims

1. A construct for mediating male sterility in maize, comprising four functional element expression cassettes, characterized in that: The functional element expression cassettes are: Red fluorescent gene DsRed expression cassette; Male fertility restorer gene MS45 expression cassette; Tassel pollen lethal gene ZmAmylase expression cassette; Glufosinate herbicide tolerance gene PAT expression cassette; Four functional element expression cassettes are connected in series, and the order of the connection is red fluorescence gene DsRed expression cassette, male fertility restoration gene MS45 expression cassette, male spike pollen lethal gene ZmAmylase expression cassette, and glufosinate herbicide resistance gene PAT expression cassette.

2. A construct for mediating maize male sterility according to claim 1, characterized in that: The nucleotide sequence of the red fluorescent gene DsRed is shown in SEQ ID NO: 1, the nucleotide sequence of the male fertility restorer gene MS45 is shown in SEQ ID NO: 2, the nucleotide sequence of the male spike pollen lethal gene ZmAmylase is shown in SEQ ID NO: 3, and the nucleotide sequence of the glufosinate herbicide resistance gene PAT is shown in SEQ ID NO:

4.

3. A construct for mediating maize male sterility according to claim 1, characterized in that: The red fluorescent gene DsRed expression box is composed of a barley aleurone layer specific expression protein promoter, which is operably connected to the red fluorescent protein DsRed gene and operably connected to a potato proteinase inhibitor II gene terminator.

4. A construct for mediating maize male sterility according to claim 1, characterized in that: The male fertility restorer gene MS45 expression cassette is composed of a promoter Ubi derived from maize anther-specific expression, which is operably connected to a male fertility protein MS45 maize fertility restorer gene, and is operably connected to a terminator derived from the maize fertility restorer gene.

5. A construct for mediating maize male sterility according to claim 1, characterized in that: The tassel pollen lethal gene ZmAmylase expression cassette comprises a pea chromosome motif for enhanced expression, operably connected to a corn promoter derived from a corn polygalacturonase gene, operably connected to a corn brittle-1 gene transit peptide, operably connected to the tassel pollen lethal gene ZmAmylase, and operably connected to a terminator derived from a rice genome sequence.

6. A construct for mediating maize male sterility according to claim 1, characterized in that: The glufosinate herbicide-resistant gene PAT expression cassette is composed of a corn ubiquitin gene promoter, which is operably connected to a glufosinate tolerance gene PAT encoding phosphinothricin acetyltransferase and is operably connected to a transcription terminator of nopaline synthase.

7. Use of a construct for mediating male sterility in maize according to any one of claims 1 to 6, characterized in that: Used to obtain corn male sterile lines and maintenance line materials.

8. A method for controlling male sterility in corn, characterized in that: Use the construct as claimed in any one of claims 1 to 6.

9. A maize male sterile line or maintainer material, characterized in that: Obtained by the method according to claim 8.

10. The method for identifying maize male sterile line or maintainer line material according to claim 9, characterized in that: Seeds that are red when observed with the naked eye are maintainer seeds.

Images