Application of lentiviral vector overexpressing CYGB in repairing engineering materials

Abstract

The invention provides an application of a lentiviral vector overexpressing CYGB in repairing engineering materials. In particular to application of the lentiviral vector overexpressing CYGB in an engineering material for repairing tissue defects and application of adipose-derived stem cells containing the lentiviral vector overexpressing CYGB in the engineering material for repairing tissue defects. The lentiviral vector overexpressing CYGB is utilized to transfect the adipose-derived stem cells, the obtained adipose-derived stem cells containing the lentiviral vector overexpressing CYGB can promote adipose-derived stem cell proliferation and adipogenic differentiation, tissue engineering fat is formed, and the tissue engineering fat is used as an implant material to be filled to a tissue defect part to repair the tissue defect.

Description

Technical Field

[0001] The present invention belongs to the field of biomedicine technology, and in particular relates to the application of a lentiviral vector overexpressing CYGB in repair engineering materials. Background Art

[0002] Adipose tissue is the largest endocrine organ in the human body. It plays a core role in regulating energy balance and lipid homeostasis, and is involved in various physiological processes, such as protecting visceral organs, regulating metabolism and immunity. Therefore, adipose tissue has become an ideal material for soft tissue repair and reconstruction. At present, fat transplantation is widely used in the repair of postoperative or traumatic defects and scars, but there are still problems such as low graft survival rate, high technical requirements, uncontrollable complications, and poor long-term stability. The emergence of adipose tissue engineering is considered to be a new treatment strategy with great potential. It has strong plasticity in implant function and graft survival rate. How to form tissue-engineered fat similar to normal adipose tissue in vivo is a clinical problem to be overcome.

[0003] Adipose tissue engineering is mainly composed of seed cells, induction factors and scaffolds. Adipose-derived stem cells (ADSCs) are considered to be the best choice of seed cells in adipose tissue engineering due to their ability to preferentially differentiate into adipocytes. Their excellent self-proliferation activity and adipogenesis are essential for maintaining tissue homeostasis, promoting cell renewal and promoting self-repair.

[0004] The cytoglobin (CYGB) gene is a protective protein inherent in the human body and has no toxic side effects on the body. Cytoglobin was first discovered by Kawada et al. in rat HSC. Its expression in thioacetamide stress-induced fibrotic liver stellate cells (HSC) increased significantly, so it was initially named HSC activation-associated protein (STAP). Protein sequencing showed that it belongs to a new class of hexacoordinate globin super-family containing heme, which is one of the four globins in mammals. Further studies have found that STAP is not only present in HSC, but also widely present in various human organs and tissues as well as fibroblast-like cells in the kidney and pancreas, so it is uniformly called cytoglobin. Summary of the invention

[0005] The purpose of the present invention is to modify adipose stem cells using a lentiviral vector that overexpresses CYGB, promote the proliferation and adipogenic differentiation of adipose stem cells, form tissue-engineered fat, and use it as an implant material to repair tissue defects.

[0006] The present invention provides an application of a lentiviral vector overexpressing CYGB in an engineering material for repairing tissue defects.

[0007] In a specific embodiment, the tissue defect is a skin soft tissue defect.

[0008] In a specific embodiment, the lentiviral vector overexpressing CYGB is H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA, wherein pLVX is a lentiviral vector, CYGB is driven for expression by the CMV promoter, the EGFP-2A-PURO gene is driven for expression by the EF1a promoter, and has green fluorescence and puromycin resistance.

[0009] In a specific embodiment, the sequence of CYGB is shown as SEQ ID NO.1, and the sequence of the lentiviral vector overexpressing CYGB is shown as SEQ ID NO.2.

[0010] In a specific embodiment, the method for constructing the CYGB overexpressing lentiviral vector is as follows: human CYGB is connected to the pLVX-EF1a-EGFP-2A-PURO-CMV-MCS lentiviral vector by homologous recombination to construct a lentiviral vector overexpressing CYGB.

[0011] The present invention also provides a use of adipose stem cells containing an overexpressed CYGB lentiviral vector in engineering materials for repairing tissue defects.

[0012] In a specific embodiment, the lentiviral vector overexpressing CYGB is H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA, wherein pLVX is a lentiviral vector, CYGB is driven for expression by the CMV promoter, the EGFP-2A-PURO gene is driven for expression by the EF1a promoter, and has green fluorescence and puromycin resistance.

[0013] In a specific embodiment, the sequence of CYGB is shown as SEQ ID NO.1, and the sequence of the lentiviral vector overexpressing CYGB is shown as SEQ ID NO.2.

[0014] In a specific embodiment, a method for preparing adipose stem cells containing a lentiviral vector overexpressing CYGB comprises the following steps:

[0015] Step (1), connecting human CYGB to the pLVX-EF1a-EGFP-2A-PURO-CMV-MCS lentiviral vector by homologous recombination to construct a lentiviral vector overexpressing CYGB;

[0016] Step (2), packaging the CYGB-overexpressing lentiviral vector using pSPAX2 and pMD2.G;

[0017] Step (3), using the packaged lentiviral vector overexpressing CYGB to transfect adipose stem cells to obtain adipose stem cells containing the lentiviral vector overexpressing CYGB.

[0018] In a specific embodiment, the MOI of lentiviral transfection in step (3) is 50.

[0019] The beneficial effects of the present invention include at least:

[0020] First, the present invention discovered for the first time that CYGB protein was significantly upregulated during the adipogenic differentiation of ADSCs. Thus, ADSCs modified by overexpression of CYGB gene have potential for application as seed cells for adipose tissue engineering.

[0021] 2. The present invention utilizes a lentiviral vector overexpressing CYGB to transfect adipose stem cells, and the obtained adipose stem cells containing the lentiviral vector overexpressing CYGB can promote adipose stem cell proliferation and adipogenic differentiation. Thus, on the one hand, the adipose stem cells containing the lentiviral vector overexpressing CYGB can form tissue engineering fat, which can be used as an implant material to fill the tissue defect site and repair the tissue defect. On the other hand, it can also provide a reference for optimizing the function of adipose tissue engineering seed cells. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 This is a comparison of the gene expression levels of PPAR-γ, CEBP-α, and CYGB in ADSCs during 0 to 5 days of adipogenic differentiation;

[0023] Figure 2 The corresponding band diagram of Western blot of PPAR-γ, CEBP-α, CYGB, and GAPDH protein expression in ADSCs at 0 to 14 days of adipogenic differentiation;

[0024] Figure 3 A map of the lentiviral vector overexpressing CYGB constructed in the present invention;

[0025] Figure 4 The fluorescence expression of cells under the microscope in the adipose-derived stem cell group transfected with lentivirus without CYGB and the adipose-derived stem cell group transfected with lentivirus overexpressing CYGB. Figure 4 The a in the figure shows the cell status under natural light after adipose stem cells were transfected with lentivirus without CYGB under a microscope. Figure 4 Figure b shows the cell status under natural light after adipose stem cells were transfected with lentivirus overexpressing CYGB. Figure 4Figure c shows the cell status under a microscope after adipose stem cells were transfected with lentivirus without CYGB under blue light (exciting green fluorescence). Figure 4 Figure d shows the cell status under blue light (exciting green fluorescence) after adipose stem cells were transfected with lentivirus overexpressing CYGB;

[0026] Figure 5 The Western blot corresponding band diagram of CYGB and GAPDH protein expression in the adipose stem cell group transfected with lentivirus without CYGB and the adipose stem cell group transfected with lentivirus overexpressing CYGB;

[0027] Figure 6 This is a comparison of the CCK-8 cell proliferation activity of the adipose stem cell group transfected with lentivirus without CYGB (CYGB-OE) and the adipose stem cell group transfected with lentivirus overexpressing CYGB (CYGB-NC);

[0028] Figure 7 This is a comparison of crystal violet staining images of the adipose-derived stem cell group transfected with an empty CYGB lentivirus and the adipose-derived stem cell group transfected with an overexpression of CYGB lentivirus on day 14. Figure 7 The image a in the figure is the crystal violet staining observation of the adipose stem cell group transfected with lentivirus without CYGB. Figure 7 b is the image observed by naked eye after crystal violet staining of the lentivirus-transfected adipose stem cell group overexpressing CYGB. Figure 7 The image in c is the crystal violet staining microscope image of the adipose stem cell group transfected with lentivirus without CYGB. Figure 7 d in the figure is a crystal violet-stained microscope image of the lentivirus-transfected adipose stem cell group overexpressing CYGB;

[0029] Figure 8 This is a comparison of the cell cycle fitting diagrams of adipose-derived stem cells transfected with lentivirus without CYGB and adipose-derived stem cells transfected with lentivirus overexpressing CYGB. Figure 8 (a) is the cell cycle fitting diagram of adipose stem cells transfected with lentivirus without CYGB. Figure 8 (b) is the cell cycle fitting diagram after adipose stem cells were transfected with lentivirus overexpressing CYGB;

[0030] Fig. 9 This is a comparison of the Nile red-stained microscope images of the adipose-derived stem cell group transfected with an empty CYGB lentivirus and the adipose-derived stem cell group transfected with an overexpression of CYGB on the 5th day. Fig. 9 (a) is a Nile red-stained microscope image of the adipose stem cell group transfected with lentivirus without CYGB on day 5. Fig. 9 (b) is a Nile red staining microscope image of the lentivirus-transfected adipose stem cell group overexpressing CYGB on day 5;

[0031] Fig.10 This is a comparison of the images of the fat stem cell group transfected with lentivirus without CYGB and the fat stem cell group transfected with lentivirus overexpressing CYGB on the 5th day under the microscope stained with Oil Red O. Fig.10 (a) is the Oil Red O staining microscope image of the adipose stem cell group transfected with lentivirus without CYGB on day 5. Fig.10 (b) Oil red O staining microscopy image of the adipose stem cell group transfected with lentivirus overexpressing CYGB on day 5. DETAILED DESCRIPTION

[0032] The present invention is described in detail below with reference to the accompanying drawings and embodiments, but the present invention can be implemented in many different ways as limited and covered by the claims.

[0033] The experimental methods without specific conditions in the examples are usually carried out under conventional conditions or conditions recommended by the manufacturers. The materials and reagents used in the following examples are all commercially available unless otherwise specified.

[0034] Example 1

[0035] CYGB is involved in the adipogenic differentiation of ADSCs

[0036] (1) RT-qPCR detection

[0037] Reagents: Adipogenic induction medium was purchased from Apexgene; Trizol, reverse transcription kit, and PCR kit were purchased from Vazyme; and primers were purchased from Shanghai Bioengineering.

[0038] Specific operation: 7.5×10 4 Adipose stem cells were seeded into 6-well plates, cultured in adipogenic induction medium for 2 days, cultured in medium containing 10 μg / ml insulin for 1 day, and cultured in alternating cycles until the 5th day. On days 1 to 5 of adipogenic induction, total RNA in one well was extracted using TRIzol reagent every day, reversed to cDNA using a reverse transcription kit, and amplified using a PCR kit and a fluorescent qPCR instrument (QuantStudio 3). The primer sequences used in the amplification are shown in Table 1.

[0039] Table 1 Amplification primers for RT-qPCR detection of PPAR-γ, CEBP-α, and CYGB gene expression

[0040] Primer name Primer number Primer sequences PPAR-γ-F SEQ ID NO.3 5'-GAACGGCAATCCTTGGTGTCTAC-3' PPAR-γ-R SEQ ID NO.4 5'-CACTTGGCTGGTTCTTACTACTGTC-3' CEBP-α-F SEQ ID NO.5 5'-GCGAGCCAGGACTAGGAGATTC-3' CEBP-α-R SEQ ID NO.6 5'-AGTAGGCATTGGAGCGGTGAG-3' CYGB-F SEQ ID NO.7 5'-TGGCCATCCTGGTGAGGTT-3' CYGB-R SEQ ID NO.8 5'-CAGGCGTGCTTCCGCAGCT-3'

[0041] Test results: The results of RT-qPCR detection of the relative expression of PPAR-γ, CEBP-α, and CYGB gene mRNA are detailed in Figure 1 As shown. Figure 1It can be seen that during the 0-5 days of adipogenic differentiation, as the mRNA of the key signals of adipogenic differentiation PPAR-γ and CEBP-α increased significantly, CYGB mRNA was significantly upregulated on the third and fifth days, indicating that CYGB is involved in the regulation of adipogenic differentiation.

[0042] (2) Western blot detection

[0043] Reagents: Polyacrylamide gel (SDS.PAGE) was purchased from ACE; BCA detection kit and protein ladder were purchased from Bioss; anti-PPAR-γ (WL01800) and anti-CEBP-α (WL01899) were purchased from Wanlei; CYGB (13317-1-AP) was purchased from proteintech; HRP Goat anti Rabbit IgG (HL) was purchased from AntGene; TBST, ECL chemiluminescent solution, and PVDF membrane were purchased from ECOTOP.

[0044] Specific operation: RIPA cell lysis buffer was used to extract total cell protein, and the protein concentration was determined using a BCA kit. 20 μg of protein was loaded, 12% polyacrylamide gel electrophoresis (SDS.PAGE), 400mAx0.5h wet transfer to PVDF membrane, blocking solution was used for 1h at room temperature, and primary antibody was added after elution with TBST and incubated overnight at 4℃. The membrane was washed 3 times with TBST, 5min each time, incubated with the corresponding secondary antibody at room temperature for 1h, and then washed 3 times, 5min each time. The antigen-antibody complex was displayed by enhanced chemiluminescence (ECL), exposed and scanned with darkroom X-ray film, and protein quantification was performed by gray value analysis of the target band, and the relative expression of the target protein was expressed by the gray value of the target band / the gray value of the internal reference band.

[0045] Test results: Western blot detection of PPAR-γ, CEBP-α, and CYGB gene protein expression levels is detailed in Figure 2 As shown. Figure 2 It can be seen that during the 0-14 days of adipogenic differentiation induction, with the increase of PPAR-γ and CEBP-α, the key proteins of adipogenic differentiation, CYGB mRNA was significantly upregulated on the fifth and seventh days, indicating that CYGB is involved in the adipogenic differentiation process.

[0046] Example 2

[0047] Construction of lentiviral vector overexpressing CYGB

[0048] The present invention utilizes homologous recombination to connect the human CYGB (NM_134268) sequence to the PLVX-EF1A-EGEP-2A-PURO-CMV-MCS lentiviral vector to construct a lentiviral vector overexpressing CYGB, and then uses the pSPAX2+pMD2.G system for lentiviral packaging, which carries puroline resistance and green fluorescence. The lentiviral vector overexpressing CYGB is H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA, and its map is shown in Figure 3 shown.

[0049] The sequence of the CYGB is shown in SEQ ID NO.1, and the sequence of the CYGB overexpressing lentiviral vector (H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA) is shown in SEQ ID NO.2.

[0050] In the present invention, pLVX in the lentiviral vector overexpressing CYGB is a lentiviral vector, CYGB is driven to express by the CMV promoter; the EGEP-2A-PURO gene is driven to express by the EF1a promoter, and has green fluorescence and puromycin resistance.

[0051] In the present invention, the linearized PLVX-EF1A-EGEP-2A-PURO-CMV-MCS vector is obtained by enzyme digestion.

[0052] The sequence of SEQ ID NO.1 is:

[0053] ATGGAGAAAGTGCCAGGCGAGATGGAGATCGAGCGCAGGGAGCGGAGCGAGGAGCTGTCCGAGGCGGAGAGGAAGGCGGTGCAGGCTATGTGGGCCCGGCTCTATGCCAACTGCGAGGACGTGGGGGTGGCCATCCTGGTGAGGTTCTTTGTGAACTTCCCCTCGGCCAAGCAGTACTTCAGCCAGTTCAAGCACATGGAGGATCCCCTGGAGATGGAGCGGAGCCCCCAGCTGCGGAAGCACGCCTGCCGAGTCATGGGGGCCCTCAACACTGTCGTGGAGAACCTGCATGACCCCGACAAGGTGTCCTCTGTGCTCGCCCTTGTGGGGAAAGCCCACGCCCTCAAGCACAAGGTGGAACCGGTGTACTTCAAGATCCTCTCTGGGGTCATTCTGGAGGTGGTCGCCGAGGAATTTGCCAGTGACTTCCCACCTGAGACGCAGAGAGCCTGGGCCAAGCTGCGTGGCCTCATCTACAGCCACGTGACCGCTGCCTACAAGGAAGTGGGCTGGGTGCAGCAGGTCCCCAACGCCACCACCCCACCGGCCACACTGCCCTCTTCGGGGCCGTAG

[0054] The sequence of SEQ ID NO.2 is:

[0055]

[0056] Example 3

[0057] Preparation of ADSCs cell lines overexpressing CYGB

[0058] 3.1 Infection method

[0059] After the lentiviral vector overexpressing CYGB was successfully constructed, the pSPAX2 and pMD2.G packaging systems were used for virus packaging, and then adipose stem cells were transfected to construct an ADSCs cell line overexpressing CYGB. The specific operation is as follows: On the first day: ADSCs were plated in groups, and the number of cells was expected to reach the ideal adhesion rate (about 50-60%) in the second day of the experiment; On the second day: the frozen virus solution was thawed on ice; the volume of virus solution required for each well was calculated, and it was diluted in the required volume of culture medium for the well to prepare the infection solution; a certain volume ratio of polybrene (final concentration: 2-10 μg / mL) was added to enhance the infection effect; the culture medium in the well was aspirated and the infection solution was added; Cultured overnight; On the third day: fresh culture medium was replaced and cultured in a 37°C, 5% CO2 incubator. The green fluorescence expression on the fourth and fifth days was observed under a fluorescence microscope, and photos were taken to determine the efficiency of lentiviral infection. When the cells expressing green fluorescence reached more than 80%, the cells were collected for relevant experimental detection.

[0060] In this embodiment, the MOI value of the infection experiment is set to 50, and the volume of the virus solution used is V (μL) = N×MOI / T, where N is the number of cells and T is the virus titer (TU / ml).

[0061] 3.2 Infection efficiency identification results

[0062] The cell fluorescence expression under the microscope of the lentivirus-transfected adipose-derived stem cell group without CYGB and the lentivirus-transfected adipose-derived stem cell group overexpressing CYGB is shown in detail. Figure 4 As shown, Figure 4 The a in the figure shows the cell status under natural light after adipose stem cells were transfected with lentivirus without CYGB under a microscope. Figure 4 Figure b shows the cell status under natural light after adipose stem cells were transfected with lentivirus overexpressing CYGB. Figure 4 Figure c shows the cell status under a microscope after adipose stem cells were transfected with lentivirus without CYGB under blue light (exciting green fluorescence). Figure 4 Figure d shows the cell status under blue light (exciting green fluorescence) after lentivirus overexpressing CYGB transfected adipose stem cells. Figure 4 It can be seen that after adipose stem cells were transfected with the constructed CYGB-overexpressing lentivirus, green fluorescence was expressed in the cells, indicating that the lentivirus could be taken up by the cells.

[0063] 3.3 Verification of high expression of CYGB in ADSCs by Western blot

[0064] The Western blot method is described in detail in the Western blot detection method in Example 1 above, which will not be described again here.

[0065] Western blot analysis was performed on the CYGB expression in the ADSCs transfected with empty CYGB lentivirus (empty lentivirus) and the negative control group (overexpressing CYGB) transfected with CYGB overexpressing lentivirus. The results showed that compared with the empty lentivirus transfection group, ADSCs overexpressed CYGB after transfection with lentivirus overexpressing CYGB. Figure 5 shown.

[0066] Example 4

[0067] Evaluation of proliferation activity of ADSCs cell lines overexpressing CYGB

[0068] After constructing the ADSCs cell line overexpressing CYGB, CCK-8, flow cytometry PI staining, and flow cell cycle PI staining were used to evaluate the cell proliferation ability. The results are detailed in Figure 6 to Figure 8 shown.

[0069] (1) CCK-8 assay

[0070] Methods: 2×103 adipose-derived stem cells were inoculated into a 96-well plate and cultured for 1 to 3 days, with the medium changed every 2 days. During the test, 10 μl of CCK-8 reagent was added to each well of the original culture medium, mixed, and placed in a 37°C constant temperature incubator for 30 minutes. The OD value was read at 450 nm using an enzyme-linked immunosorbent assay.

[0071] Test results: See the test results for details. Figure 6 As shown, Figure 6 CYGB-OE corresponds to the group of adipose stem cells transfected with lentivirus without CYGB, and CYGB-NC corresponds to the group of adipose stem cells transfected with lentivirus overexpressing CYGB. Figure 6 It can be seen that after transfection with the lentiviral vector overexpressing CYGB, the proliferation activity of the ADSCs cell line overexpressing CYGB was increased on days 1, 2, and 3.

[0072] (2) Crystal violet staining test

[0073] Method: 2×10 3 ADSCs were seeded into 6-well plates and cultured for 14 days, with the culture medium replaced every 3 days. 4% paraformaldehyde was used for 20 minutes. After washing, 1 ml of crystal violet staining solution was added to each well for staining for 15-20 minutes and observed under a microscope.

[0074] Test results: See the test results for details. Figure 7 As shown, from Figure 7 It can be seen that the clone formation ability of ADSCs cell lines overexpressing CYGB is enhanced.

[0075] (3) Flow cytometry PI staining detection

[0076] Methods: Adipose stem cells were digested with trypsin, and the cells were collected by centrifugation at 1000 rpm for 5 minutes. The fixed cells were resuspended in 75% alcohol and incubated at 4°C overnight. The alcohol was removed by centrifugation at 1000 rpm for 5 minutes. 200 μl PBS, 10 μl RNase A, and 200 μl propidium iodide (PI) solution were added and incubated at 37°C for 30 minutes. After thorough mixing, the cells were passed through a 200-mesh cell sieve and transferred to a 5 ml flow cytometer for flow cytometry detection.

[0077] Test results: See the test results for details. Figure 8 As shown, from Figure 8 It can be seen that flow cell cycle PI staining showed that the number of cells in the S phase (proliferation phase) increased after overexpression of CYGB.

[0078] Example 5

[0079] Evaluation of adipogenic differentiation level of ADSCs cell lines overexpressing CYGB

[0080] After constructing the ADSCs cell line overexpressing CYGB, Oil Red O staining and Nile Red staining were used to evaluate the adipogenic differentiation level of the cells.

[0081] (1) Nile red staining test

[0082] Methods: Adherent cells were cleaned and fixed with 4% paraformaldehyde for 20 minutes. Nile red staining solution (Solarbio, China) was added and stained for 10 minutes. Lipid droplet staining and nuclear staining were observed under a fluorescence microscope (excitation wavelength 543nm, emission wavelength 598nm).

[0083] Test results: see Fig. 9 ,from Fig. 9 It can be seen that the adipogenic differentiation level of ADSCs cell lines overexpressing CYGB is increased.

[0084] (2) Oil Red O staining test

[0085] Method: 7.5×10 4 Adipose stem cells were seeded into 6-well plates, cultured in adipogenic induction medium for 2 days, cultured in medium containing 10 μg / ml insulin for 1 day, and cultured in alternating cycles until the 5th day, and stained with Oil Red O staining kit.

[0086] Test results: See the test results for details. Fig.10 ,from Fig.10 It can be seen that the level of lipid droplet formation in ADSCs cell lines overexpressing CYGB is increased.

[0087] The above content is a further detailed description of the present invention in combination with specific preferred embodiments, and it cannot be determined that the specific implementation of the present invention is limited to these descriptions. For ordinary technicians in the technical field to which the present invention belongs, several simple deductions and substitutions can be made without departing from the concept of the present invention, which should be regarded as belonging to the protection scope of the present invention.

Claims

1. Application of a lentiviral vector overexpressing CYGB in engineering materials for repairing tissue defects.

2. The use according to claim 1, characterized in that: The tissue defect is a skin soft tissue defect.

3. The use according to claim 1, characterized in that: The lentiviral vector for overexpressing CYGB is H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA, wherein pLVX is a lentiviral vector, CYGB is driven to express by the CMV promoter, and the EGFP-2A-PURO gene is driven to express by the EF1a promoter, and has green fluorescence and puromycin resistance.

4. The use according to claim 3, characterized in that: The sequence of the CYGB is shown in SEQ ID NO.1, and the sequence of the lentiviral vector overexpressing CYGB is shown in SEQ ID NO.

2.

5. The use according to any one of claims 1 to 4, characterized in that: The method for constructing the CYGB-overexpressing lentiviral vector is specifically as follows: human CYGB is connected to the pLVX-EF1a-EGFP-2A-PURO-CMV-MCS lentiviral vector by homologous recombination to construct a CYGB-overexpressing lentiviral vector.

6. Use of adipose-derived stem cells containing a lentiviral vector overexpressing CYGB in engineering materials for repairing tissue defects.

7. The use according to claim 6, characterized in that: The lentiviral vector for overexpressing CYGB is H-pLVX-EF1a-EGFP-2A-PURO-CMV-CYGB-HA, wherein pLVX is a lentiviral vector, CYGB is driven to express by the CMV promoter, and the EGFP-2A-PURO gene is driven to express by the EF1a promoter, and has green fluorescence and puromycin resistance.

8. The use according to claim 7, characterized in that: The sequence of the CYGB is shown in SEQ ID NO.1, and the sequence of the lentiviral vector overexpressing CYGB is shown in SEQ ID NO.

2.

9. The use according to claim 6, characterized in that: A method for preparing adipose stem cells containing a lentiviral vector overexpressing CYGB comprises the following steps: Step (1), connecting human CYGB to the pLVX-EF1a-EGFP-2A-PURO-CMV-MCS lentiviral vector by homologous recombination to construct a lentiviral vector overexpressing CYGB; Step (2), packaging the CYGB-overexpressing lentiviral vector using pSPAX2 and pMD2.G; Step (3), using the packaged lentiviral vector overexpressing CYGB to transfect adipose stem cells to obtain adipose stem cells containing the lentiviral vector overexpressing CYGB.

10. The use according to claim 9, characterized in that: In the step (3), the MOI of lentiviral transfection is 50.

Images