Deep droplet digital nucleic acid detection method and application thereof

Abstract

The invention belongs to the technical field of digital microfluidics, and particularly relates to a deep droplet digital nucleic acid detection method and application thereof. The invention provides a deep droplet digital nucleic acid detection method. According to the method, the limitation of traditional DMF equipment is overcome, tens of thousands of non-uniform liquid drops are generated within several seconds through simple and stable setting, and the wide dynamic range customization of the size of the liquid drops is realized through control. In addition, by optimizing the components in the continuous-phase oil phase, the oil phase capable of responding to light can successfully fix the liquid drops in situ through ultraviolet light stimulation. Therefore, the serious problems of sealing, free liquid drop heating disturbance and the like of the digital micro-fluidic platform are greatly solved, and breakthrough progress is achieved. By taking the lambda DNA as a model, digital nucleic acid amplification reaction on the chip is realized, the number of positive and positive microdroplets is accurately calculated, and absolute quantification of the lambda DNA in a dynamic range of 0-10000 copies / mu L is realized.

Description

Technical Field

[0001] The invention belongs to the technical field of digital microfluidics, and in particular relates to a deep droplet digital nucleic acid detection method and application thereof. Background Art

[0002] Nucleic acid quantification plays an important role in clinical diagnosis, pathogen detection and genomic research. Real-time polymerase chain reaction (PCR) or isothermal amplification can be used for relative quantification by comparison with a standard curve of known concentrations. However, the dependence of different reactions on amplification efficiency can significantly affect the accuracy of the results. Droplet digital nucleic acid analysis (ddNAA) is a new generation of absolute quantitative analysis technology that can dilute samples and divide them into multiple compartments so that each compartment contains 1 or 0 DNA target templates, thereby achieving absolute quantification with higher precision. It gets rid of the dependence on standard curves and has higher sensitivity and accuracy. ddNAA technology is developed based on microtubes or 384-well microplates. These methods have problems such as limited number of partitions, limited degree of automation, and large amount of reagents required. To solve these problems, microfluidics (a technology for processing microfluidics) has been used for ddNAA, which can generate a large number of droplets and perform sample distribution. However, most of these platforms are channel-based microfluidics, which rely on microfabrication technology adapted from microelectronics, and the implementation of this technology relies on rapid prototyping of polydimethylsiloxane, glass etching or soft lithography in injection molding. Thousands to tens of thousands of uniform droplets can be generated on the chip in a short time.

[0003] "Digital" single-molecule measurements are attractive for quantification, but the dynamic range of such systems is usually limited because most droplets do not contain DNA / RNA. For a system with 10,000 droplets, there must be less than 10,000 copies of DNA for digital analysis. If the sample has more than 10,000 copies of DNA (which is common in virus or bacteria detection), all droplets will be positive, resulting in invalid conclusions. To solve this problem, Rustem et al. proposed a wide dynamic range droplet digital polymerase chain reaction (ddPCR). They designed and tested two microfluidic spin slide chips to perform multi-volume digital PCR experiments with a wide range and adjustable dynamic range. However, since its minimum droplet volume can only reach 0.2nL, its current detection concentration can only reach 2.2molecules / μL, which has certain limitations for the detection of samples such as high-concentration viruses. In addition, the number of droplets provided by this method for each volume sample partition is less than 20, which also leads to potential huge errors. Their complex chip design, cumbersome protocols, and manual operation requirements may also lead to uncertain experimental errors. To overcome these limitations, more droplets or multiple confirmations of quantification are needed at each volume scale.

[0004] Moreover, in traditional ddPCR, droplets are mainly stabilized by surface tension. During PCR thermal cycles, droplet fusion, fission, evaporation, and movement may occur due to drastic temperature changes. In particular, in digital microfluidic platforms, droplets are more susceptible to thermal disturbances due to chip sealing problems and relatively free droplet positions. On the other hand, counting fluorescent droplets using the "flow detection" method usually performs emulsification, thermal cycling, and readout as separate steps on different instruments. Although planar droplet arrays have been proposed for imaging readout, the free movement of droplets often makes it difficult, especially in the case of real-time monitoring. To address these limitations, Wu et al. developed a thermosetting oil that can be cured by heating after droplet generation. This will form physical boundaries between droplets, effectively reducing droplet aggregation and breakup. However, it requires a relatively long curing time, especially during the hot start phase of PCR thermal cycling, and ultra-small droplets are still prone to evaporation and fission in the early stages. In addition, thermosetting oils can gradually solidify at ambient temperature and must therefore be freshly prepared before use. Summary of the invention

[0005] The purpose of the first aspect of the present invention is to provide a deep droplet digital nucleic acid detection method.

[0006] The second aspect of the present invention aims to provide a digital microfluidic detection system.

[0007] The purpose of the third aspect of the present invention is to provide applications of the method described in the first aspect of the present invention and the detection system described in the second aspect of the present invention.

[0008] In order to achieve the above-mentioned purpose of the present invention, the technical solution adopted by the present invention is:

[0009] The first aspect of the present invention provides a deep droplet digital nucleic acid detection method, comprising the following steps:

[0010] The mother liquid is dropped onto the bottom plate of the digital microfluidic chip, photocurable oil is added as the continuous oil phase, and electric pulses are applied to form tiny sub-droplets;

[0011] In situ photofixation;

[0012] reaction;

[0013] Detect the optical signal.

[0014] In some embodiments of the present invention, the digital microfluidic chip includes a bottom plate, a top plate, and a gasket; preferably, the bottom plate and the top plate have a conductive layer; preferably, the top plate is coated with a dielectric layer; preferably, the top plate and the bottom plate are coated with a hydrophobic layer.

[0015] In some embodiments of the present invention, the conductive layer includes at least one of metal chromium and indium tin oxide.

[0016] In some embodiments of the present invention, the dielectric layer includes at least one of SU8 and polytetrafluoroethylene (PTFE).

[0017] In some embodiments of the present invention, the hydrophobic layer includes at least one of Teflon, polyvinyl alcohol, and polymethyl methacrylate.

[0018] In some embodiments of the present invention, the photocurable oil phase comprises, by weight percentage, the following raw materials:

[0019] Photocurable group polymer 0.1% ~ 2.5%.

[0020] Photocurable group monomer 97% ~ 99%.

[0021] Photopolymerization initiator 0.2% to 2.0%.

[0022] The photocuring agent is selected from polymers containing photocuring groups and / or monomers containing photocuring groups;

[0023] The polymer of the photocurable group includes a polymer containing an acrylate functional group and / or a polymer containing a methacrylate functional group;

[0024] The monomers of the photocurable group include monomers containing acrylate functional groups and / or monomers containing methacrylate functional groups.

[0025] In some embodiments of the present invention, the input voltage of the electric pulse is 1 to 20 V; the frequency of the electric pulse is 10 to 1000 Hz.

[0026] In some embodiments of the present invention, the voltage and frequency mainly control the RMS effective voltage value. The relationship between RMS and the diameter of the sub-droplet can be summarized as follows:

[0027] When the RMS effective voltage value is 30–60 V, the diameter of the sub-droplet corresponds to 10–30 μm;

[0028] When the RMS effective voltage value is 60–110 V, the diameter of the sub-droplet corresponds to 5–10 μm;

[0029] When the RMS effective voltage value is 110-200 V, the diameter of the sub-droplet is 1-5 μm. In some embodiments of the present invention, the diameter of the sub-droplet is 1-50 μm.

[0030] In some embodiments of the present invention, the relationship between the number and diameter of the sub-droplets is as follows:

[0031] 1,000 to 100,000 droplets with a diameter of 1 to 10 μm can be formed;

[0032] 500-10,000 droplets with a diameter of 10-20 μm can be formed;

[0033] 50-1000 droplets with a diameter of 20-50 μm can be formed.

[0034] In some embodiments of the present invention, the in-situ photocuring comprises a step of ultraviolet irradiation.

[0035] In some embodiments of the present invention, the ultraviolet irradiation time is 30 to 120 seconds; the intensity of the ultraviolet light is 5 to 10 mW / cm 2 .

[0036] The second aspect of the present invention aims to provide a digital microfluidic detection system, comprising the following structure:

[0037] 1) Sample inlet and outlet system;

[0038] 2) Droplet generation system;

[0039] 3) Temperature control system;

[0040] 4) Data processing system;

[0041] 5) Result display system;

[0042] The digital microfluidic detection system uses the method described in the first aspect of the present invention to perform detection.

[0043] In some embodiments of the present invention, the droplet generation system includes a DMF chip on a chip holder, an electronic control system: a DC power supply, a signal source and a PCB board, a fluorescence microscope with control software, and customized software for DMF operation.

[0044] In some embodiments of the present invention, the temperature control system is at least one of a thermal cycler or a temperature control plate.

[0045] In some embodiments of the invention, the processing system comprises CellSens.

[0046] The third aspect of the present invention provides the use of the method described in the first aspect of the present invention and / or the system described in the second aspect of the present invention in nucleic acid detection.

[0047] The beneficial effects of the present invention are:

[0048] The present invention proposes a deep droplet digital Nucleic Acid Analysis (dddNAA). This method overcomes the limitations of traditional DMF equipment, namely, the number of independent droplets is limited by the number of electrodes, and the processing technology is complicated. Tens of thousands of non-uniform droplets are generated in a few seconds through a simple and robust setting. And the droplet size is customized with a wide dynamic range by adjusting and controlling the input parameters. In addition, by optimizing the components in the continuous phase oil phase, the oil phase that can respond to light is successfully fixed in place by ultraviolet light stimulation. This greatly solves the serious problems of digital microfluidic platforms due to sealing and thermal disturbance of free droplets, and has made breakthrough progress. Using λDNA as a model, a digital nucleic acid amplification reaction on the chip is realized, the number of positive droplets is accurately calculated, and the absolute quantification of λDNA in the dynamic range of 0-10000 copies / μL is achieved. The proposed DMF system shows great potential for rapid, reliable and quantitative analysis of nucleic acids, and has excellent accuracy. BRIEF DESCRIPTION OF THE DRAWINGS

[0049] The present invention will be further described below with reference to the accompanying drawings and embodiments, wherein:

[0050] Figure 1 Schematic diagram of the system setup for deep droplet digital nucleic acid amplification (dddNAA) through omnidirectional jetting on digital microfluidics; wherein: A) DMF chip design and control system; B) droplet jetting; C) dddNAA analysis.

[0051] Figure 2 This is a real-life picture of the DMF system; it consists of four parts: the DMF chip on the chip holder, the electronic control system: DC power supply, signal source and PCB board, the fluorescence microscope with control software, and customized software for DMF operation.

[0052] Figure 3 It is the statistical data of droplet ejection; among them: A) before droplet ejection: mother droplet; B) after droplet ejection: daughter droplet; C) droplet volume statistics; D) droplet sequence statistics.

[0053] Figure 4 The results of droplet size conditions; the distribution state of sub-droplet size under different input voltage 10, 8, 5, 3VIN and frequency 1000, 800, 500, 50Hz input parameters.

[0054] Figure 5 Optimization of the photocurable oil formula: thermal performance test. A, B, and C are photocurable oils with different compositions. The thermal properties of the three types of curable oils were tested after the droplets were fixed.

[0055] Figure 6 Results of droplet photocuring; A) Schematic diagram of the photocuring oil workflow; B) images of sub-droplets before UV fixation, before dddNAA reaction, and after dddNAA reaction in bright field and fluorescent CY5 reference channels (scale bar: 100 μm).

[0056] Figure 7 Results of digital loop-mediated isothermal nucleic acid amplification on the chip: fluorescence images after completion of 0, 1000, and 10,000 copies / μL λDNA dLAMP (scale bar: 100 μm).

[0057] Figure 8 Detection and quantification results of the DMF platform in digital nucleic acid amplification. DETAILED DESCRIPTION

[0058] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0059] Materials and instruments: SU8 photoresist was purchased from MicroChem (USA), Teflon-AF 1601S was purchased from DuPont (USA). Indium tin oxide (ITO) coated glass (<17 ohm / sq, 100*100*1.1 mm) was purchased from Guoluo Glass Co., Ltd. (China), and chrome coated glass (76*76*1.1 mm) was purchased from Changsha Shaoguang Material Technology Co., Ltd.

[0060] λDNA was purchased from Takara Bio Inc. (Japan). Evagreen was purchased from Biotium (USA). dNTPs were purchased from Applied Biosystems (UK). Bst 2.0 hot start DNA polymerase, MgSO4, and 10× Thermolpol buffer were purchased from New England Biolabs Inc. (China). All chemicals and reagents were used as received without further purification. Deionized water used in all experiments was purified using a Millipore system (18.0 MΩ cm, Milli-Q gradient system).

[0061] Photocurable polyurethane acrylate (PUA, 6115J-80) and surfactant ISOLAN 17 were kindly donated by Eternal Materials Co., Ltd. and Evonik Industries AG, respectively. Isobornyl acrylate (IBOA) and 2-hydroxy-2-methylpropiophenone (HMPP) were purchased from Sigma-Aldrich Inc. The photofixed droplet array was fixed with a 365 nm UV light source (ABM, California, USA). Thermal cycling was performed on a Bioer Gene Touch thermal cycler. An upright fluorescence microscope (Olympus DP80, Japan) was used to observe and regulate the droplet ejection behavior and analyze the fluorescence images after on-chip digital nucleic acid amplification.

[0062] Example 1 DMF chip design and manufacture

[0063] This embodiment prepares a DMF chip:

[0064] The chip body is divided into two layers of glass plates, the upper plate is an ITO glass plate (25mm×50mm) coated with a layer of indium tin oxide (ITO) on the inner side, and the upper plate has two injection holes (cut through by a laser cutter) at 12mm from the short side and 5.6mm from the long side. The lower layer is a chrome glass plate (38mm×38mm) with a chrome-plated layer on the inner side, and the middle layer is a hollow rectangular PET polyester film (inner diameter: 16mm×28mm, outer diameter: 19mm×31mm) spacer separating the two plates. The inner side of the ITO layer of the upper plate is coated with 10μm SU8 photoresist as a dielectric layer, and Teflon AF is coated as a hydrophobic layer. The chrome-plated side of the lower plate is coated with Teflon AF as a hydrophobic layer.

[0065] The schematic diagram of the chip structure is shown in Figure 1 As shown in A.

[0066] Example 2 Setup of DMF system

[0067] The DMF system consists of four parts: DMF chip, droplet control element, imaging device and master control module. Among them, in this embodiment, the droplet control element is: 1) a printed circuit board (PCB), on which a field programmable gate array (FPGA) is arranged, so as to realize the function of opening / closing the physical relay on the PCB; the physical relay arranged on the PCB is controlled by a custom software (written in C#) channel FPGA; the amplifier arranged on the PCB realizes the signal amplification function; 2) signal generator: drives the generation of AC square wave signal, and uses a transformer to amplify the signal for omnidirectional droplet injection; 3) DC power supply. The imaging device is a fluorescence microscope, which is preset with fluorescence channel blocks such as GFP, CY5, CY3, and a DP80 color CCD image sensor camera system. Software (developed by Olympus) is used to record and process fluorescence signals; the master control module is an electronic computer that executes the DMF operation program to achieve the capture of droplet fluorescence signals on the chip. The actual setting image is as follows Figure 2 shown.

[0068] The sandwich DMF chip was fixed on a 3D printed chip holder and placed on the stage of a fluorescence microscope. The electrodes on the DMF chip were connected to the electronic PCB via jumpers for droplet actuation. The on / off of the drive signal was controlled by turning on / off the physical relays on the PCB. The physical relays were controlled by custom software (written in C#) through a preconfigured field programmable gate array (FPGA). A driving AC square wave signal was generated using a signal generator and amplified using an electromagnetic transformer for omnidirectional droplet ejection. The DMF device was monitored under bright field or fluorescence observation by a camera mounted on the microscope. CellSens software was used for droplet motion behavior monitoring, droplet size determination, and droplet fluorescence images.

[0069] In all experiments, the assembled DMF chip was placed in a 3D-printed device holder designed by AutoCAD. The DMF electronics control generates a stable 1000 Hz pulse output with a programmable amplitude of 30-280 Vrms for droplet ejection operation. A fluorescence microscope (Olympus DP80, Japan) was used to observe the droplet ejection behavior regulation and to capture the endpoint images after the on-chip digital nucleic acid amplification reaction. Software (developed by Olympus) was used for fluorescence signal recording and processing. The on-chip digital nucleic acid amplification program was controlled by temperature regulation of the Bioer Gene Touch thermal cycler. Fluorescence images were captured on the GFP fluorescence channel and processed by ImageJ.

[0070] Example 3 Droplet generation, photocuring and fluorescence detection

[0071] Omnidirectional droplet jetting technology is used for high-throughput multi-size droplet generation platform settings such as Figure 1 b). The mother liquid sample is loaded onto the lower plate of the chip by a 10 μL pipette, and then the upper plate of the chip loaded with the spacer layer is assembled with it. The photocurable oil (0.5wt% PUA, 98.5wt% IBOA, 1% HMPP) is injected into the middle interlayer chamber of the chip through the injection hole by a pipette. The droplet injection is controlled by a DMF control platform. The droplet injection behavior and the sub-droplet size adjustment are observed by input parameter adjustment and fluorescence microscopy (Olympus DP80, Japan). Then, ultraviolet irradiation (365nm, 9mW / cm 2 ) for 30 seconds to obtain a photofixed planar droplet array. The droplet fixation effect was verified by using a Bioer Gene Touch thermal cycler before and after the reaction.

[0072] The system of mother liquor of the present invention is as follows:

[0073] 25 μL LAMP mixture contained 6.1 μL deionized water, 2.5 μL 10× Thermolpol buffer, 6 mM MgSO4, 1.4 Mm dNTP, 5 μM Evagreen, 8 μM CoRA, 0.2 μM upstream external primer (F3) and downstream external primer (B3), 0.8 μM forward loop primer (LF) and backward loop primer (LB), 1.6 μM forward internal primer (FIP) and backward internal primer (BIP), 1 μL λ DNA template, and the final concentrations were 0, 1000, and 10,000 copies / μL.

[0074] Among them, CRoA is a hairpin structure fluorescence enhancer similar to a molecular beacon, consisting of a probe sequence (loop) and complementary 3' and 5' ends (stem), and a quencher is connected to the 3' end. The sequence is 5'-CCGCTGCGAAAAAAAAAAAAAAACGCAGCGG-BHQ2-3' (SEQ ID NO: 1).

[0075] The primers were purchased from Sangon Biotech (China) and their sequences are as follows:

[0076] F3: GAATGCCCGTTCTGCGAG (SEQ ID NO: 2).

[0077] B3: TTCAGTTCCTGTGCGTCG (SEQ ID NO: 3).

[0078] LF: GGCGGCAGAGTCATAAAGCA (SEQ ID NO: 4).

[0079] LB: GGCAGATCTCCAGCCAGGAACTA (SEQ ID NO: 5).

[0080] FIP: CAGCATCCCTTTTCGGCATACCAGGTGGCAAGGGTAATGAGG (SEQ ID NO: 6).

[0081] BIP: GGAGGGTTGAAGAACTGCGGCAGTCGATGGCGTTCGTACTC (SEQ ID NO: 7).

[0082] For on-chip LAMP, the mother droplet was dispersed into thousands of independent daughter droplet units in the droplet splashing control mode, and then the daughter droplets were incubated at 65°C for 60 minutes in the Bioer Gene Touch thermal cycler. The fluorescence signal was detected.

[0083] Effect Example 1 Analysis of the Omnidirectional Droplet Jetting Performance of DMF Chip

[0084] Dividing nucleic acid samples into a large number of ultra-small independent reaction unit chambers is the most important step in digital nucleic acid amplification. The applicant's previous patent (CN114160211A) reported that droplets were ejected from mother droplets on a DMF chip using a simple high-voltage drive signal and used for sample delivery for tumor drug screening. In this application, this technology is further developed to achieve omnidirectional droplet ejection ( Figure 3 ). The instantaneous ejection of nanoliter-level mother liquid droplets is achieved within 20 seconds of electric drive of the control system.

[0085] The omnidirectional spraying is specifically manifested in spraying droplets in all directions, so that the mother droplets are completely sprayed into small droplets, and the droplet size can be controlled based on electrical signals. The previous patent is a one-sided spraying, and the single spraying is limited, and there is no function of droplet size adjustment.

[0086] Figure 3 The statistical data analysis of the droplet ejection results was done in Figure 3 Figure 3A and Figure 3B are the bright field real images and fluorescence field CY3 fluorescence channel of the mother droplet and daughter droplet before and after droplet ejection, respectively. Figure 3 In C and D of 3, the volume and sequence statistics of the sub-droplets were performed, and the results showed that the number of sub-droplets can reach tens of thousands, and the size can reach the level of femtoliter. However, in terms of distribution, the size classification is relatively continuous and uncontrollable, so it is necessary to continue to study and develop customized droplet size control methods. Effect Example 2 Customized Droplet Size Control

[0087] This embodiment tests the effect of different input voltages and frequencies on the droplet size.

[0088] After the droplet is completely ejected, the input voltage and frequency are regulated ( Figure 4 ), achieving a more obvious and uniform partitioning of droplets of different sizes. Since the boundaries between each droplet unit are clearer and the size can be controlled within the range of 5-30μm, a certain distribution can be achieved, which is more conducive to subsequent on-chip nucleic acid amplification experiments and result analysis.

[0089] At present, the droplet size can be controlled by adjusting the input voltage and frequency. Voltage and frequency mainly control the RMS effective voltage value. The relationship between RMS and sub-droplet diameter can be summarized as shown in Table 1.

[0090] Table 1 Relationship between RMS and sub-droplet diameter

[0091] RMS(v) Droplet diameter(μm) 30-60v 10-30μm 60-110v 5-10μm 110-200v 1-5μm

[0092] Effect Example 3 Droplet In-situ Photofixation Test

[0093] According to the analysis and calculation of the results after droplet ejection, the present application has achieved independent partitioning of sub-droplets and the volume can reach the femtoliter level. To achieve nucleic acid amplification in a droplet unit of this level, two major difficulties need to be solved: sub-droplet evaporation and droplet movement. The present application optimizes and improves the photocurable oil based on the previous patent report (CN111635487B) to adapt to this working system.

[0094] The original patent for photocurable oil (CN111635487B) is a PDMS chip based on a pipeline microfluidic system. This embodiment tests the effect of the photocurable oil based on a digital microfluidic chip structure. The formula ratios of different photocurable oils are designed with reference to Table 2. The test is performed with reference to the experimental scheme of Example 3. The results are as follows: Figure 5 shown.

[0095] Table 2 Different formulations of light curing oil

[0096]

[0097]

[0098] The photocurable oil in formula A in Table 2 is the proportion of photocurable oil components used in the relevant published article (Anal.Chem.2020,92,12,8530–8535). Due to the relatively high photopolymerizable group polymer, namely polyurethane acrylate PUA, cannot withstand high temperature thermal cycles (65°C-95°C) in the structure after photocuring, the continuous phase undergoes a structurally inhomogeneous phase change, and the droplets undergo significant collapse, thermal evaporation, etc. Therefore, the proportion of photopolymerizable group polymer components in the photocurable reagent used in digital microfluidic chips is extremely important. In this phase invention patent, the photocurable group polymer component must be strictly controlled at 0.1% to 2.5%. The final optimization is as follows, in weight percentage:

[0099] Polyurethane acrylate PUA0.5%

[0100] Isobornyl acrylate IBOA 98.5%

[0101] 2-Hydroxy-2-methylpropiophenone HMPP 1%

[0102] Adjust the proportion of photocurable group polymer reagent in the formula: 1. Make it suitable for droplet injection technology. Photocurable oil can be used as a continuous phase to complete the droplet injection step and achieve stable generation of sub-droplets; 2. Make it match the continuous phase on the digital microfluidic chip to achieve stable phase conversion under ultraviolet light irradiation, and realize in-situ fixation of droplets from liquid phase to solid phase.

[0103] In situ ultraviolet irradiation (wavelength: 365 nm, intensity: 8 mW / cm 2 , time: 30s) to quickly and stably fix the droplets in place, thereby effectively preventing the free movement, aggregation and breakage of the droplets during the thermal cycling of nucleic acid amplification. Figure 6 Figure A in the figure is a schematic diagram of the entire light-curing oil workflow. Figure 6Figure B is the result of the photocuring oil work investigation. The free droplet distribution before UV fixation, the state of the droplets before the nucleic acid amplification thermal cycle after UV fixation, and the state of the droplets after the nucleic acid amplification thermal cycle were photographed using a fluorescence microscope. From the bright field and fluorescence field photos of the sub-droplets, it can be seen that the state of the droplets has not changed after UV fixation, and there is no deformation, damage, fusion, etc., and after the nucleic acid amplification reaction thermal cycle, it can also be verified that the droplets are completely fixed without any position movement or morphological changes. The state of the droplets after the thermal cycle further confirms that this design can be used for nucleic acid amplification applications on the chip. Through this design application, the proposed digital nucleic acid amplification technology is expected to be more robust.

[0104] Effect Example 4

[0105] In order to evaluate the performance of the proposed DMF platform in digital nucleic acid amplification, this application used λDNA as the template system, and prepared λDNA dilutions with concentrations of 1000 copies / μL and 10000 copies / μL as method validation, and the NTC group was used as a no-template concentration reference.

[0106] The LAMP mixture contained 1×Thermolpol buffer, 6 mM MgSO4, 1.4 μM dNTP, 4×Evagreen, 8 μM CoRA, 0.2 μM upstream external primer (F3) and downstream external primer (B3), 0.8 μM forward loop primer (LF) and backward loop primer (LB), 1.6 μM forward internal primer (FIP) and backward internal primer (BIP), λ DNA template, and the final template concentration was 0, 1000, and 10,000 copies / μL (reference Example 3).

[0107] The copy number of λDNA was measured using a dsDNA BR fluorescence detector (Invitrogen). Then, 0.1 μL of LAMP mixture was distributed on the chip using droplet injection technology to form tens of thousands of independent reaction partitions. In the droplet injection step, 1 kHz, 10 V IN The input electrical signal completely breaks up the mother droplet and sprays it into tens of thousands of small droplets. The droplet size can be adjusted by inputting electrical signal parameters of 500Hz, 3V IN To adjust the size of the sub-droplets, ~10,000 reaction zones are formed.

[0108] Then, the droplets were fixed in situ by UV curing (wavelength: 365nm, intensity: 8mW / cm 2 , time: 30s). Then the chip was placed in a thermal cycler, the reaction substrate temperature was stabilized at 65°C, and the reaction time was one hour. After the thermal cycle amplification program was completed, a fluorescent image was taken to measure the number and size information of the positive spots.

[0109] like Figure 7 As shown in Figure 2, the increase in λDNA concentration corresponds to an increase in the number of positive (fluorescent) spots. For samples with a concentration range of 0, 1000, and 10000 copies / μL, three reaction areas were randomly selected for each group ( Figure 7 The fluorescence images were analyzed using imageJ. The left RAW group was an overexposed group, showing all the background information of the droplets. The right was an image-processed group. After the background of the NTC group was completely subtracted through contrast and brightness processing, the final result was obtained, showing the positive point information of the real reaction. Based on this, Poisson statistics were used to calculate the corresponding DNA copy numbers to be 0, 800.5 copies / μL, and 35713.0 copies / μL, respectively. The quantitative results of the statistical analysis are shown in the figure below. Figure 8 As shown, the expected target concentration of 0-10000 copies / μL was linearly related to the test concentration on the chip (R2=0.99493).

Claims

1. A method for nucleic acid detection, characterized in that: The mother liquid is dropped onto the bottom plate of the digital microfluidic chip, a photocurable oil continuous phase is added, and an electric pulse is applied to form tiny sub-droplets; In situ photofixation; reaction; Detect the optical signal.

2. The method according to claim 1, characterized in that: The digital microfluidic chip includes a bottom plate, a top plate, and a gasket; Preferably, the bottom plate and the top plate have a conductive layer; Preferably, the top plate has a dielectric layer; Preferably, the top plate and the bottom plate are coated with a hydrophobic layer; Preferably, the bottom plate has no electrode pattern.

3. The method according to claim 2, characterized in that: The photocurable oil, in terms of weight percentage, comprises the following raw materials: Photocurable group polymer 0.1% to 2.5%; Photocurable group monomer 97% to 99%; Photopolymerization initiator 0.2% to 2.0%; The photocuring agent is selected from polymers containing photocuring groups and / or monomers containing photocuring groups; The polymer of the photocurable group includes a polymer containing an acrylate functional group and / or a polymer containing a methacrylate functional group; The monomers of the photocurable group include monomers containing acrylate functional groups and / or monomers containing methacrylate functional groups.

4. The method according to claim 3, characterized in that: The volume ratio of the mother liquid droplets to the photocurable oil is 1:(10-10000).

5. The method according to claim 1, characterized in that: The input voltage of the electric pulse is 1 to 20V; The frequency of the electric pulse is 10 to 1100 Hz.

6. The method according to claim 1, characterized in that: The diameter of the sub-droplets is 1 to 50 μm.

7. The method according to claim 1, characterized in that: The in-situ light curing includes the step of ultraviolet irradiation.

8. The method according to claim 7, characterized in that: The ultraviolet irradiation time is 30 to 120 seconds; the intensity of the ultraviolet irradiation is 5 to 10 mW / cm 2 .

9. A digital microfluidic detection system, characterized in that: Includes the following modules: 1) Sample inlet and outlet system; 2) Droplet generation system; 3) Temperature control system; 4) Data processing system; 5) Result display system; The digital microfluidic detection system uses the method described in any one of claims 1 to 8 for detection.

10. Use of the method according to any one of claims 1 to 8 and / or the system according to claim 9 in nucleic acid detection.

Images