Primer group for detecting deafness susceptibility gene mutation site based on nucleic acid mass spectrometry and application

Abstract

The invention provides a primer group for detecting deafness susceptibility gene mutation sites based on nucleic acid mass spectrometry and application, and relates to a gene detection technology. The primer group is used for carrying out typing detection on related mutation sites of the following genes: GJB2, GJB3, SLC26A4, 12S rRNA (ribosomal Ribonucleic Acid), MYO7A, MYO15A, TMPRSS3, TMC1, LOXHD1, PAX3, EYA4, TJP2 and OTOF. The primer group of the SNP loci related to the deafness susceptibility gene is suitable for detection of deafness susceptibility gene mutation of Chinese population, covers thirteen genes, can more comprehensively and effectively perform screening, and effectively avoids missing screening and missing diagnosis of patients simultaneously carrying double or multiple mutations.

Description

Technical Field

[0001] The present invention relates to the field of gene detection technology, and in particular to a primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry and an application thereof. Background Art

[0002] Deafness, as a common sensory disorder, affects more than 430 million people worldwide, of which the proportion of deaf people in my country accounts for as high as 33.52% of the total disabled population. Genetic factors are one of the main factors leading to deafness, accounting for 60% of all deafness cases. Deafness can be divided into syndromic deafness and non-syndromic deafness based on clinical phenotype characteristics, the latter accounting for 70% of deafness cases.

[0003] In the field of molecular research on hereditary deafness, a variety of technologies have been developed, including gene chips, Sanger sequencing, next-generation sequencing, whole exome sequencing, high-resolution melting curve analysis, denaturing high-performance liquid chromatography, and matrix-assisted laser desorption ionization time-of-flight mass spectrometry (MADLI TOF MS). These technologies have advantages in identifying genetic variations and discovering new mutations, but they generally have problems such as long research cycles, high costs, and high technical requirements for operators and data analysts, which limits their application in large-scale studies.

[0004] Nevertheless, some technologies, such as high-resolution melting curve analysis and denaturing high-performance liquid chromatography, have further limited the widespread research on deafness genes due to their shortcomings such as long experimental time, low throughput and high cost per sample. In addition, although the products on the market that use matrix-assisted laser desorption ionization time-of-flight mass spectrometry-MassARRAY technology and multiplex PCR amplification technology can target specific mutation sites of deafness susceptibility genes, most of these products are limited to GJB2, GJB3, SLC26A4 and mtDNA12SrRNA genes, and have limited coverage.

[0005] 159 related loci for hereditary non-syndromic deafness have been located, and 102 deafness genes have been identified; 58 related loci for hereditary syndromic deafness have been located, and 49 deafness genes have been identified. However, most existing research technologies fail to fully cover these loci, and only focus on a few hotspot genes. This limits the comprehensive understanding of the causes of deafness and related research, especially when faced with deafness cases with complex genetic backgrounds. Therefore, existing technologies have obvious deficiencies in coverage, research speed, and cost-effectiveness.

[0006] In summary, the existing technologies have defects in the accuracy, research scope, cost and ease of operation of deafness gene correlation research. These defects limit the widespread application of deafness gene research technology, especially in large-scale research and in-depth exploration. Therefore, it is urgent to develop a new research method that can comprehensively cover the mutation sites of deafness genes and has the characteristics of being fast, accurate, low-cost and easy to operate to meet the needs of scientific research and correlation research. Summary of the invention

[0007] The purpose of the present invention is to provide a primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry and its application. The primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry is used for typing detection of thirteen genes, thereby realizing rapid and effective screening of samples to be tested using the MassARRAY system.

[0008] In order to achieve the above-mentioned purpose of the present invention, the following technical solutions are particularly adopted:

[0009] In a first aspect, the present invention provides a primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry, wherein the primer set is used for typing detection of relevant mutation sites of the following genes: GJB2, GJB3, SLC26A4, 12SrRNA, MYO7A, MYO15A, TMPRSS3, TMC1, LOXHD1, PAX3, EYA4, TJP2 and OTOF.

[0010] In an optional embodiment, the mutation sites targeted by the primer set include:

[0011] c.919-2A>G, c.2168A>G, c.281C>T, c.1229C>T, c.1174A>T, c.1707+5G>A , c.2027T>A, c.1226G>A, c.754T>C, c.1160C>T, c.235delC, c.109G>A, c. 299_300delAT, c.176_191del, c.283G>A, c.508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, m.1494C>T, m.1555A>G, c.589G >A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C, c.6466A>C , c.1975G>C, c.589G>A, c.2162C>T, c.1692dup, c.257C>G, c.427C>T, c.3 5delG, c.512_513insAACG, c.167delT, c.547G>A, c.9690+1G>A, c.7396-1G>A, c.4714C>T, c.811C>T, c.1273C>T, c.551T>C, c.3587A>G and c.995C>T.

[0012] In an optional embodiment, the mutation sites targeted by the primer set include: the primer set is divided into the following two groups, namely a first primer set and a second primer set;

[0013] The first primer set is used to detect c.919-2A>G, c.2168A>G, c.281C>T, c.1229C>T, c.1174A>T, c.1707+5G>A, c.2027T>A, c.1226G>A, c.754T>C, c.1160C>T, c.235delC, c.109G>A, c.299_300delAT, c.176_191del, c.28 primer sets for the 3G>A, c.508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, m.1494C>T, m.1555A>G, c.589G>A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C, and c.6466A>C mutation sites;

[0014] The second primer set is a primer set for detecting c.1975G>C, c.589G>A, c.2162C>T, c.1692dup, c.257C>G, c.427C>T, c.35delG, c.512_513insAACG, c.167delT, c.547G>A, c.9690+1G>A, c.7396-1G>A, c.4714C>T, c.811C>T, c.1273C>T, c.551T>C, c.3587A>G and c.995C>T mutation sites.

[0015] In an optional embodiment, the first primer set includes an independent site set, a first combination site set, a second combination site set, and a third combination site set;

[0016] The independent site set is a primer set for detecting c.281C>T, c.1707+5G>A, c.2027T>A, c.919-2A>G, c.754T>C, c.2168A>G, 508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, c.589G>A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C, and c.6466A>C mutation sites;

[0017] The first combined site set is a primer set for detecting c.1160C>T, c.1174A>T, c.1226G>A, and c.1229C>T mutation sites;

[0018] The second combined site set is a primer set for detecting c.299_300delAT, c.283G>A, c.235delC, c.176_191del, and c.109G>A;

[0019] The third combination site set is a primer set for detecting m.1494C>T and m.1555A>G mutation sites.

[0020] In an optional embodiment, the independent site set includes: 17 amplification primers corresponding to 17 sites c.281C>T, c.1707+5G>A, c.2027T>A, c.919-2A>G, c.754T>C, c.2168A>G, 508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, c.589G>A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C and c.6466A>C, a PCR upstream primer as shown in SEQ ID NO.117, and 17 amplification primers corresponding to the 17 sites as shown in SEQ ID PCR downstream primers shown as NO.37-54, and 17 extension primers shown as SEQ ID NO.79-96 corresponding to the 17 sites in sequence.

[0021] In an optional embodiment, the first combination site set includes: a PCR upstream primer as shown in SEQ ID NO.73 among the amplification primers corresponding to the four sites c.1160C>T, c.1174A>T, c.1226G>A and c.1229C>T, a PCR downstream primer as shown in SEQ ID NO.76 among the amplification primers corresponding to the four sites, and four extension primers as shown in SEQ ID NOs.115 to 118 corresponding to the four sites in sequence.

[0022] The second combination site set includes: a PCR upstream primer as shown in SEQ ID NO.74 among the amplification primers corresponding to the five sites c.299_300delAT, c.283G>A, c.235delC, c.176_191del and c.109G>A, a PCR downstream primer as shown in SEQ ID NO.77 among the amplification primers corresponding to the five sites, and five extension primers as shown in SEQ ID NOs.119 to 123 corresponding to the five sites in sequence.

[0023] The third combination site set includes: a PCR upstream primer as shown in SEQ ID NO.75 among the amplification primers corresponding to the two sites m.1494C>T and m.1555A>G, a PCR downstream primer as shown in SEQ ID NO.78 among the amplification primers corresponding to the two sites, and two extension primers as shown in SEQ ID NOs.124 to 125 corresponding to the two sites in sequence.

[0024] In an optional embodiment, the second primer set includes: PCR upstream primers as shown in SEQ ID NOs. 19 to 36 among the 18 amplification primers corresponding to the 18 sites c.1975G>C, c.589G>A, c.2162C>T, c.1692dup, c.257C>G, c.427C>T, c.35delG, c.512_513insAACG, c.167delT, c.547G>A, c.9690+1G>A, c.7396-1G>A, c.4714C>T, c.811C>T, c.1273C>T, c.551T>C, c.3587A>G and c.995C>T, and 18 amplification primers as shown in SEQ ID NOs. PCR downstream primers shown as NO.55-72, and 25 extension primers shown as SEQ ID NO.97-114 corresponding to the 18 sites in sequence.

[0025] In a second aspect, the present invention provides an application of a primer set as described in any of the aforementioned embodiments in the preparation of a product for detecting mutation sites of a deafness susceptibility gene based on nucleic acid mass spectrometry, wherein the product includes any one of a detection reagent, a kit, and a detection device.

[0026] The product includes the primer set as described in the above embodiment;

[0027] In an optional embodiment, the detection reagent is a reagent combination for detecting mutation sites;

[0028] In an optional embodiment, the product further comprises an amplification reaction system;

[0029] In an optional embodiment, the amplification reaction system comprises: DNA polymerase and PCR amplification buffer;

[0030] In an optional embodiment, the DNA polymerase is SuperTaqTM DNA Polymerase;

[0031] In an optional embodiment, the PCR amplification buffer includes Mg 2+ , dNTP solution, Tris-HCl solution and KCI solution;

[0032] In an optional embodiment, the initial concentration of the DNA polymerase is 0.05U to 0.06U, Mg 2+The molar concentration of the solution is 4.25mmol / L~5.75mmol / L, the molar concentration of the Tris-HCl solution is 5mmol / L~17.5mmol / L, the molar concentration of the dNTPs solution is 0.25mmol / L~3.75mmol / L, and the molar concentration of the KCl solution is 50mmol / L

[0033] ~70mmol / L;

[0034] In an optional embodiment, the initial concentration of the DNA polymerase is 0.05U, Mg 2+ The molar concentration of is 5.25mmol / L, the molar concentration of Tris-HCl solution is 15mmol / L, the molar concentration of dNTPs solution is 0.25mmol / L, and the molar concentration of KCl solution is 70mmol / L;

[0035] In an optional embodiment, the reaction procedure of the amplification reaction system is: 94°C pre-denaturation for 30s, {94°C denaturation for 5s, (52°C annealing for 5s, 80°C extension for 5s)×5 cycles}×40 cycles; 72°C extension for 3min; 4°C storage;

[0036] In an optional embodiment, the product further comprises a digestion reaction system;

[0037] In an optional embodiment, the digestion reaction system includes shrimp alkaline phosphatase and shrimp alkaline phosphate buffer.

[0038] In an optional embodiment, the final reaction concentration of the shrimp alkaline phosphatase is 0.25U to 0.26U, and the final reaction concentration of the shrimp alkaline phosphate buffer is 0.035 to 0.036 times the concentration;

[0039] In an optional embodiment, the procedure of the digestion reaction system is: reaction at 37° C. for 40 min and reaction at 85° C. for 5 min.

[0040] In an optional embodiment, the product further comprises an extension reaction system;

[0041] In an optional embodiment, the extension reaction system includes an extension enzyme, an extension stop solution and an extension buffer;

[0042] In an optional embodiment, the final reaction concentration of the elongation enzyme is 0.02 to 0.025 times, the final reaction concentration of the extension buffer is 0.1 to 0.15 times, and the final reaction concentration of the extension stop solution is 0.1 to 0.15 times;

[0043] In an optional embodiment, the reaction procedure of the extension reaction system is: 94°C pre-denaturation for 30s, {94°C denaturation for 5s, (52°C annealing for 5s, 80°C extension for 5s)×5 cycles}×40 cycles; 72°C extension for 3min; 4°C storage;

[0044] In an optional embodiment, the product further comprises a desalination system;

[0045] In an alternative embodiment, the desalination system includes a cleaning resin.

[0046] In an optional embodiment, the detection device includes at least one of a detection device and a detection consumable;

[0047] The detection device is based on the MassARRAY platform.

[0048] In a third aspect, the present invention provides a detection method for non-diagnostic purposes, comprising: using a primer set as described in any of the aforementioned embodiments to detect the nucleotide sequence of a SNP site in the genome.

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] The primer set for the SNP site related to the deafness susceptibility gene provided by the present invention is obtained by searching a large amount of literature and materials and screening based on the characteristics of each site itself. It can accurately type the mutation type samples and meet the requirements of mass spectrometry detection technology, thereby realizing the application of the MassARRAY system to quickly and effectively screen the samples to be tested.

[0051] The primer set for SNP sites related to deafness susceptibility genes provided by the present invention is suitable for the detection of deafness susceptibility gene mutations in the Chinese population, covering thirteen genes including GJB2, GJB3, SLC26A4, 12S rRNA, MYO7A, MYO15A, TMPRSS3, TMC1, LOXHD1, PAX3, EYA4, TJP2 and OTOF, and can perform screening more comprehensively and effectively, effectively avoiding missed screening and missed diagnosis of patients carrying double or multiple mutations at the same time.

[0052] The product provided by the present invention for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry can realize specific detection of mutations in sites related to deafness susceptibility genes. Compared with the detection methods currently on the market, the technology of the present invention is simple to operate and does not involve fluorescent labeling, gel electrophoresis, etc. The detection cost is extremely low, and it is operational and economical in clinical promotion. The data is fully automatically analyzed, and the results are intuitive without the intervention of bioinformatics, avoiding human errors. It has the advantages of short detection cycle, high throughput, high accuracy, and high sensitivity. At the same time, it can continuously design and add detection pathogenic sites according to needs, and can also select individual sites for detection according to needs, which is flexible.

[0053] The present invention overcomes the defect of the prior art that there are few SNP sites detected at one time, and is low-cost and suitable for wide promotion; the samples required by the present invention are highly adaptable, and both peripheral blood and dried blood spots can be well detected; the present invention is applicable to all Chinese people, and can help Chinese patients with suspected family history or sporadic suspected cases to carry out targeted screening of specific pathogenic sites, conduct correlation studies, and further targeted genetic counseling and early diagnosis, intervention and treatment. It plays an extremely important role. High-risk gene mutation carriers can take targeted prevention and treatment measures as early as possible, providing effective technical support for scientific prevention and treatment of deafness and early intervention. BRIEF DESCRIPTION OF THE DRAWINGS

[0054] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0055] Figure 1 Figure 1 A cluster diagram of the c.916G>A site before optimization provided in Example 5 of the present invention;

[0056] Figure 2 A cluster diagram of the optimized c.916G>A site provided in Example 5 of the present invention;

[0057] Figure 3 The peak diagram of the c.919-2A>G site before optimization provided in Example 5 of the present invention;

[0058] Figure 4 The peak diagram of the c.919-2A>G site after optimization provided in Example 5 of the present invention;

[0059] Figure 5 The mass spectrogram of the extended primers of 29 SNP sites of the first primer set in Example 5 of the present invention;

[0060] Figure 6 The mass spectrogram of the extended primers of 18 SNP sites of the second primer set in Example 5 of the present invention;

[0061] Figure 7 This is the peak diagram of the c.235delC site in Example 6 of the present invention;

[0062] Figure 8 This is the peak diagram of the c.1692dup site in Example 6 of the present invention;

[0063] Fig. 9 This is the peak diagram of the c.109G>A site in Example 6 of the present invention;

[0064] Fig.10 This is the peak diagram of the m.1555A>G site in Example 6 of the present invention;

[0065] Fig.11 This is the peak diagram of the c.235delC site using the original reagent of Agena Company in Example 6 of the present invention;

[0066] Fig.12 This is the peak diagram of the c.1692dup site of the original reagent of Agena Company used in Example 6 of the present invention;

[0067] Fig.13 This is the peak diagram of the c.109G>A site using the original reagent of Agena Company in Example 6 of the present invention;

[0068] Fig.14 This is the peak diagram of the original reagent m.1555A>G site using Agena Company in Example 6 of the present invention;

[0069] Fig.15 This is the peak diagram of the c.6466A>C site in Example 7 of the present invention;

[0070] Fig.16 This is a diagram showing the sequencing results of the c.6466A>C site in Example 7 of the present invention;

[0071] Fig.17 This is the peak diagram of the c.551T>C site in Example 7 of the present invention;

[0072] Fig.18 This is a diagram showing the sequencing results of the c.551T>C site in Example 7 of the present invention;

[0073] Fig.19 This is the peak diagram of the c.283G>A site in Example 7 of the present invention;

[0074] Fig. 20 This is a diagram showing the sequencing results of the c.283G>A site in Example 7 of the present invention;

[0075] Fig.21 This is the peak diagram of the c.1160C>T site in Example 7 of the present invention;

[0076] Fig. 22 This is a diagram of the sequencing results of the c.1160C>T site in Example 7 of the present invention. DETAILED DESCRIPTION

[0077] The embodiments of the present invention will be described in detail below in conjunction with the examples, but it will be appreciated by those skilled in the art that the following examples are only used to illustrate the present invention and should not be considered as limiting the scope of the present invention. If no specific conditions are specified in the examples, the conditions are carried out according to normal conditions or the conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0078] In an embodiment of the present application, a primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry is provided, and the primer set is used for typing detection of relevant mutation sites of the following genes: GJB2, GJB3, SLC26A4, 12SrRNA, MYO7A, MYO15A, TMPRSS3, TMC1, LOXHD1, PAX3, EYA4, TJP2 and OTOF.

[0079] In this embodiment, a primer set is provided, the core feature of which is that these primer sets are specially designed for typing mutation site detection of a series of specific deafness-related genes. Specifically, these genes include GJB2, GJB3, SLC26A4, 12S rRNA, MYO7A, MYO15A, TMPRSS3, TMC1, LOXHD1, PAX3, EYA4, TJP2 and OTOF. These genes are closely related to the occurrence and development of deafness. Therefore, the detection of mutation sites of these genes is of great significance for the correlation study of deafness, as well as early diagnosis and prevention based on research data and combined with other diagnostic results.

[0080] The primer set provided in this embodiment can realize the comprehensive, high-throughput, high-accuracy and sensitive detection of mutation sites of deafness susceptibility genes, covering 13 genes related to deafness including GJB2, GJB3, SLC26A4, etc., covering multiple sites of syndromic deafness (SHL) and non-syndromic deafness (NSHL). Using nucleic acid mass spectrometry technology, the primer set can detect multiple mutation sites at the same time, significantly improves the detection efficiency and throughput, shortens the detection cycle, and reduces the detection cost of a single sample, making large-scale gene screening and wide application possible. In addition, the simplified experimental operation process reduces the dependence on professional and technical personnel, making the detection process more simple and quick. This primer set is not only of great value to clinicians for accurate genetic counseling and early intervention, but also improves the quality of life of patients, and provides researchers with a powerful tool for in-depth study of the genetic mechanism of deafness, and promotes the development of deafness-related research.

[0081] In some embodiments, the mutation sites targeted by the primer set include: c.919-2A>G, c.2168A>G, c.281C>T, c.1229C>T, c.1174A>T, c.1707+5G>A, c.2027T>A, c.1226G>A, c.754T>C, c.1160C>T, c.235delC, c.109G>A, c.299_300delAT, c.176_191del, c.283G>A, c.508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, m.1494C>T, m.15 55A>G, c.589G>A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C, c.6466A>C, c.1975G>C, c.589G>A, c.2162C>T, c.1692dup, c.257C>G, c.427C >T, c.35delG, c.512_513insAACG, c.167delT, c.547G>A, c.9690+1G>A, c.73 96-1G>A, c.4714C>T, c.811C>T, c.1273C>T, c.551T>C, c.3587A>G and c.995C>T.

[0082] Since MassARRAY detection is a reaction based on multiplex PCR amplification, the primer combination must avoid problems such as cross-amplification, preferential amplification and nonspecificity. Therefore, the primer design of this reaction system needs to be redesigned and optimized.

[0083] In this embodiment, the research and development is aimed at the relevant sites of the Chinese population. Through literature and database comparison and search, a detection panel covering 47 deafness pathogenic sites reported in the Chinese population is designed. By simultaneously detecting 47 sites, mutation sites can be screened out quickly and accurately, which can effectively avoid missed screening and underdiagnosis of patients carrying double or multiple mutations at the same time, and is of great significance for early diagnosis, intervention and treatment.

[0084] In addition, the panel can be continuously designed to add detection pathogenic sites when needed, and is open; there is no need for tedious experimental processes such as DNA hybridization, and the data is analyzed automatically to avoid human errors and minimize the impact of human operations on the accuracy of test results.

[0085] The present invention has the advantages of low cost, high accuracy, high sensitivity and high sample throughput, and is a new high-throughput and low-cost genotype detection method for detecting deafness mutation sites at one time.

[0086] In some embodiments, the mutation sites targeted by the primer set include: the primer set is divided into the following two groups, namely a first primer set and a second primer set;

[0087] Table 1. Correspondence between different primer sets and detected mutation sites

[0088]

[0089] It should be noted that the above grouping is proven through a large number of experiments. Taking into account factors such as the size of the extension primers, it is ensured that the primers in each group do not interfere with each other during detection.

[0090] In some embodiments, the first primer set includes an independent site set, a first combination site set, a second combination site set and a third combination site set; the independent site set is a primer set for detecting c.281C>T, c.1707+5G>A, c.2027T>A, c.919-2A>G, c.754T>C, c.2168A>G, 508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, c.589G>A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C and c.6466A>C mutation sites. The first combination site set is a primer set for detecting c.1160C>T, c.1174A>T, c.1226G>A and c.1229C>T mutation sites. The second combination site set is a primer set for detecting c.299_300delAT, c.283G>A, c.235delC, c.176_191del and c.109G>A. The third combination site set is a primer set for detecting m.1494C>T and m.1555A>G mutation sites.

[0091] In some embodiments, the set of independent sites comprises:

[0092] The PCR upstream primers shown in SEQ ID NO. 117 among the 17 amplification primers corresponding to the 17 sites c.281C>T, c.1707+5G>A, c.2027T>A, c.919-2A>G, c.754T>C, c.2168A>G, 508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, c.589G>A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C and c.6466A>C, and the 17 amplification primers corresponding to the 17 sites in sequence as shown in SEQ ID NO. PCR downstream primers shown as NO.37-54, and 17 extension primers shown as SEQ ID NO.79-96 corresponding to the 17 sites in sequence.

[0093] Table 1. Mutation sites and sequence numbers in the independent site set (upstream and downstream primers)

[0094]

[0095] Table 2. Mutation sites and sequence numbers in the independent site set (extension primers)

[0096] Mutation site SEQ ID NO. Mutation site SEQ ID NO. c.281C>T 79 c.538C>T 88 c.1707+5G>A 80 c.432delA 89 c.2027T>A 81 c.916G>A 90 c.919-2A>G 82 c.TMC589G>A 91 c.754T>C 83 c.6559-2A>G 92 c.2168A>G 84 c.2241_2242delAG 93 c.508_511dupAACG 85 c.4198G>A 94 c.9G>A 86 c.4459A>C 95 c.35insG 87 c.6466A>C 96

[0097] In some embodiments, the first set of combination sites comprises:

[0098] Among the amplification primers corresponding to the four sites c.1160C>T, c.1174A>T, c.1226G>A and c.1229C>T, a PCR upstream primer as shown in SEQ ID NO.73, among the amplification primers corresponding to the four sites, a PCR downstream primer as shown in SEQ ID NO.76, and four extension primers as shown in SEQ ID NOs.115 to 118 corresponding to the four sites in sequence;

[0099] The second combination site set includes:

[0100] Among the amplification primers corresponding to the five sites c.299_300delAT, c.283G>A, c.235delC, c.176_191del and c.109G>A, a PCR upstream primer as shown in SEQ ID NO.74, among the amplification primers corresponding to the five sites, a PCR downstream primer as shown in SEQ ID NO.77, and five extension primers as shown in SEQ ID NOs.119 to 123 corresponding to the five sites in sequence;

[0101] The third combination site set includes: a PCR upstream primer as shown in SEQ ID NO.75 among the amplification primers corresponding to the two sites m.1494C>T and m.1555A>G, a PCR downstream primer as shown in SEQ ID NO.78 among the amplification primers corresponding to the two sites, and two extension primers as shown in SEQ ID NOs.124 to 125 corresponding to the two sites in sequence.

[0102] Table 3. Mutation sites and sequence numbers in the first to third combined site sets (upstream and downstream primers)

[0103]

[0104] Table 4. Mutation sites and sequence numbers in the first to third combined site sets (extension primers)

[0105]

[0106] In some embodiments, the second primer set includes:

[0107] 18 amplification primers corresponding to the 18 sites c.1975G>C, c.589G>A, c.2162C>T, c.1692dup, c.257C>G, c.427C>T, c.35delG, c.512_513insAACG, c.167delT, c.547G>A, c.9690+1G>A, c.7396-1G>A, c.4714C>T, c.811C>T, c.1273C>T, c.551T>C, c.3587A>G and c.995C>T in sequence, a PCR upstream primer as shown in SEQ ID NOs. 19 to 36; 18 amplification primers corresponding to the 18 sites in sequence as shown in SEQ ID PCR downstream primers shown as NO.55-72; and 25 extension primers shown as SEQ ID NO.97-114 corresponding to the 18 sites in sequence.

[0108] Table 5. Mutation sites and sequence numbers in the second primer set (upstream and downstream primers)

[0109]

[0110] Table 6. Mutation sites and sequence numbers in the second primer set (extension primers)

[0111] Mutation site SEQ ID NO. Mutation site SEQ ID NO. c.1975G>C 97 c.547G>A 106 c.SLC589G>A 98 c.9690+1G>A 107 c.2162C>T 99 c.7396-1G>A 108 c.1692dup 100 c.4714C>T 109 c.257C>G 101 c.811C>T 110 c.427C>T 102 c.1273C>T 111 c.35delG 103 c.551T>C 112 c.512_513insAACG 104 c.3587A>G 113 c.167delT 105 c.995C>T 114

[0112] In an embodiment of the present application, a primer set as described in any one of the aforementioned embodiments is provided for use in preparing a product for detecting mutation sites of a deafness susceptibility gene based on nucleic acid mass spectrometry, wherein the product includes any one of a detection reagent, a kit, and a detection device.

[0113] It should be noted that the product for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry provided in the embodiments of this application can realize specific detection of mutations in sites related to deafness susceptibility genes. Compared with traditional detection methods, the technical operation provided in the embodiments of this application is simple, and does not involve fluorescent labeling, gel electrophoresis, etc.; the detection cost is extremely low, and it is operational and economical in basic research and clinical promotion; the data can be fully automatically analyzed, and the results are intuitive without the intervention of bioinformatics, avoiding human errors. It has the advantages of short detection cycle, high throughput, high accuracy, and high sensitivity; at the same time, it can continuously design and add detection pathogenic sites according to needs, and it can also select individual sites for detection according to needs, which is flexible.

[0114] The product may include the primer set as described in the above embodiment.

[0115] In some embodiments, the detection reagent is a reagent combination for detecting mutation sites.

[0116] In some embodiments, the product also includes an amplification reaction system.

[0117] As mentioned above, the amplification reaction system refers to the collection of all components used in the PCR (polymerase chain reaction) process, which work together to achieve the amplification of the target DNA fragment. For example, it may include: DNA polymerase: responsible for synthesizing new DNA chains, commonly used such as SuperTaq TM DNA Polymerase; PCR Amplification Buffer: Contains Mg 2+ , dNTP solution (a mixture of four deoxynucleotide triphosphates), Tris-HCl solution (used to maintain a suitable pH value) and KCI solution (providing the necessary ion environment); DNA template: the DNA fragment to be amplified; Primer: a short DNA fragment that is complementary to the target DNA sequence and is used to guide the synthesis activity of DNA polymerase.

[0118] In some embodiments, the amplification reaction system includes: DNA polymerase and PCR amplification buffer;

[0119] In some embodiments, the DNA polymerase is SuperTaq TM DNA Polymerase;

[0120] In some embodiments, the PCR amplification buffer includes Mg 2+, dNTP solution, Tris-HCl solution and KCI solution;

[0121] In some embodiments, the initial concentration of the DNA polymerase is 0.05U to 0.06U; for example, the initial concentration may be 0.050U, 0.055U, 0.060U, and the like.

[0122] Mg 2+ The molar concentration is 4.25mmol / L to 5.75mmol / L; for example, the molar concentration can be 4.25mmol / L, 4.50mmol / L, 5.00mmol / L, 5.50mmol / L, 5.75mmol / L, and the like.

[0123] The molar concentration of the Tris-HCl solution is 5 mmol / L to 17.5 mmol / L; for example, the molar concentration may be 5 mmol / L, 8 mmol / L, 10 mmol / L, 12 mmol / L, 15 mmol / L, 17.5 mmol / L, and the like.

[0124] The molar concentration of the dNTPs solution is 0.25 mmol / L to 3.75 mmol / L; for example, the molar concentration may be 0.25 mmol / L, 0.50 mmol / L, 1 mmol / L, 2 mmol / L, 3 mmol / L, 3.75 mmol / L, and the like.

[0125] The molar concentration of the KCl solution is 50 mmol / L to 70 mmol / L; for example, the molar concentration may be 50 mmol / L, 60 mmol / L, 70 mmol / L, and the like.

[0126] In some embodiments, the initial concentration of the DNA polymerase is 0.05 U, Mg 2+ The molar concentration of the solution was 5.25 mmol / L, the molar concentration of the Tris-HCl solution was 15 mmol / L, the molar concentration of the dNTPs solution was 0.25 mmol / L, and the molar concentration of the KCl solution was 70 mmol / L.

[0127] In an optional embodiment, the reaction procedure of the amplification reaction system is: (1) pre-denaturation at 94°C for 30s; (2) {94°C denaturation for 5s, (52°C annealing for 5s, 80°C extension for 5s) × 5 cycles} × 40 cycles; (3) extension at 72°C for 3min; and storage at 4°C.

[0128] In some embodiments, the product further comprises a digestion reaction system.

[0129] In some embodiments, the digestion reaction system includes shrimp alkaline phosphatase and shrimp alkaline phosphate buffer.

[0130] As mentioned above, the digestion reaction system is used to process the product after PCR amplification, and its main purpose is to remove excess dNTPs (deoxynucleotide triphosphates) to prepare for the subsequent single base extension reaction. For example, the system may include: Shrimp Alkaline Phosphatase (SAP): used to dephosphorylate dNTPs to prevent them from interfering with subsequent reactions; Shrimp Alkaline Phosphatase: provides a suitable buffer environment to ensure SAP enzyme activity.

[0131] In some embodiments, the final reaction concentration of the shrimp alkaline phosphatase is 0.25U to 0.26U; for example, the final reaction concentration may be 0.250U, 0.255U, 0.260U, and the like.

[0132] The final reaction concentration of the shrimp alkaline phosphate buffer is 0.035 to 0.036 times; for example, the final reaction concentration may be 0.0350, 0.0355, or 0.0360 times.

[0133] In an optional embodiment, the procedure of the digestion reaction system is: (1) reaction at 37°C for 40 minutes; (2) reaction at 85°C for 5 minutes.

[0134] In some embodiments, the product also includes an extension reaction system.

[0135] In some embodiments, the extension reaction system includes an extension enzyme, an extension stop solution, and an extension buffer.

[0136] As mentioned above, the extension reaction system involves a single base extension (SBE) step, which is a key step in nucleic acid mass spectrometry detection and is used to determine the base at a specific site. For example, the system may include: an extension enzyme: used to perform an extension reaction on a specific base; an extension stop solution: containing a component that can terminate the extension reaction; and an extension buffer: providing a suitable buffer environment to ensure the activity of the extension enzyme.

[0137] In some embodiments, the final reaction concentration of the elongase is 0.02 to 0.025 times the concentration; for example, the final reaction concentration can be 0.020, 0.022, 0.024, 0.025, etc. The final reaction concentration of the extension buffer is 0.1 to 0.15 times the concentration; for example, the final reaction concentration can be 0.10, 0.12, 0.14, 0.15 times the concentration, etc. The final reaction concentration of the extension stop solution is 0.1 to 0.15 times the concentration; for example, the final reaction concentration can be 0.10, 0.12, 0.14, 0.15 times the concentration, etc.

[0138] In an optional embodiment, the reaction procedure of the extension reaction system is: (1) pre-denaturation at 94°C for 30s; (2) {94°C denaturation for 5s, (52°C annealing for 5s, 80°C extension for 5s) × 5 cycles} × 40 cycles; (3) extension at 72°C for 3min; and storage at 4°C.

[0139] In some embodiments, the product further comprises a desalination system. In some embodiments, the desalination system comprises a cleaning resin. In some embodiments, the detection device comprises at least one of a detection device and a detection consumable. The detection device is based on a MassARRAY platform.

[0140] As mentioned above, the detection device refers to a complete set of equipment and materials used to perform nucleic acid mass spectrometry detection, including: detection equipment: equipment based on the MassARRAY platform, which can perform mass spectrometry analysis of PCR products, determine the precise mass of DNA fragments, and thus identify specific genotypes; detection consumables: all disposable materials used in the detection process, such as PCR reaction tubes, extension reaction tubes, chip spotting consumables, etc.

[0141] In a third aspect, the present invention provides a detection method for non-diagnostic purposes, comprising: using a primer set as described in any of the aforementioned embodiments to detect the nucleotide sequence of a SNP site in the genome.

[0142] The above detection method is used for non-diagnostic purposes and is mainly aimed at correlation studies. This method uses a primer set to detect the nucleotide sequence of the SNP (single nucleotide polymorphism) site in the genome. It should be emphasized that the results obtained by this detection method are not intended to directly reflect the specific health status of the subjects, but are used as part of the research data to explore the correlation between gene variation and susceptibility to deafness.

[0143] In this embodiment, the detection method provides a new technical means to screen the mutation sites of deafness susceptibility genes through nucleic acid mass spectrometry technology, the purpose of which is scientific research and data collection rather than direct clinical diagnosis.

[0144] Therefore, the innovation of this detection method lies in its ability to provide accurate genotype data for genetic research related to deafness, which can be combined with clinical data for further auxiliary explanation and research. The application of this method will help to deepen the understanding of the genetic basis of deafness and promote the development of prevention and treatment strategies for deafness.

[0145] The primer sets, products, applications and detection methods provided in the embodiments of this application are aimed at the defects of narrow coverage of SNP sites in one-time detection in conventional technology, and are low-cost and suitable for wide promotion; the samples required for the technology provided by this application are highly adaptable, and both peripheral blood and dried blood spots can be well detected; the technology provided by this application is applicable to all Chinese people, and can help Chinese patients with suspected family history or sporadic suspected patients to carry out targeted screening of specific pathogenic sites, conduct correlation studies, and further carry out targeted genetic counseling and research for non-diagnostic purposes, and can be combined with other relevant indicators to provide quantitative data support for early diagnosis, intervention and treatment of subjects. High-risk gene mutation carriers can take targeted prevention and control measures as early as possible, and provide effective technical support for scientific prevention and control and early intervention of deafness.

[0146] Example 1: Screening of detection sites and design of primers

[0147] It should be noted that among the test kits for detecting deafness mutation sites on the market, the detection of deafness gene sites is mostly limited to GJB2, GJB3, SLC26A4 and mtDNA 12S rRNA genes.

[0148] However, currently 159 related loci for hereditary non-syndromic deafness have been located, and 102 non-syndromic deafness genes have been identified; 58 related loci for hereditary syndromic deafness have been located, and 49 syndromic deafness genes have been identified.

[0149] It can be seen from this that it is far from enough to limit the detection of deafness gene loci to the above four hotspot genes.

[0150] In this embodiment, by consulting the latest literature reports and relevant information such as human gene mutation and pathogenic gene mutation databases to date, 47 deafness pathogenic sites or pathogenicity-related sites reported in the Chinese population were summarized, as shown in Table 7. The mutation sites are more meaningful for detection in the Chinese population.

[0151] Table 7. Table of mutation sites of each gene

[0152]

[0153] The particularity of MassARRAY nucleic acid mass spectrometry detection is that it is necessary to first amplify the fragment containing the target SNP site through PCR reaction, then extend the base of the SNP site through extension primers, and determine the SNP site information through the molecular weight of its product. In this embodiment, multiple SNP site information can be detected, which requires that there should be no obvious interference between the PCR reaction and extension reaction of each SNP site.

[0154] Some mutation sites are located very close to each other and some sequences have very high homology. When a single tube reaction is performed, the amplification primers and extension primers will interfere with each other.

[0155] In order to achieve simultaneous detection, the gene sequences of the above 47 pathogenic sites were compared, and some sequences with similar mutation sites and high sequence homology were manually merged to obtain the following sequence.

[0156] The homology of the deafness gene mutation sites c.1160C>T, c.1174A>T, c.1226G>A and c.1229C>T was high, and their sequences were merged to obtain a merged sequence 1, as shown in SEQ ID NO.126, which is as follows:

[0157] TTAAATTGGACCACCACGCAGAGTAGGCATGGGAGTTTTCATTCTTAATGTACTTCCTGAAATACTCAGCGAAGGTCTTGCAAAGATTCAATTTGTAGGATCGTTGTCATCCAGTCTCTTCCTTAGGAATTCATTGYCTTTGGGATCAGCWACATCTTCTCAGGATTCTTCTCTTGTTTTGTGGCC ACCACTGCTCTTTCCCRCAYGGCCGTCCAGGAGAGCACTGGAGGAAAGACACAGGTAGGAACAACAGCCTTATGATATCCATCTCAGAGAACAAGTCGAGGAATGGCACAGAGGAAGGCTCGCACCGAGCTTAGCAGGACAATTTGCCTTTCAGACTTGTACTTCCTAATCTGATTCACCTCAGG.

[0158] Among them, R represents A or G; Y represents C or T; W represents A or T, the same below.

[0159] Furthermore, the homology of the deafness gene mutation sites c.299_300delAT, c.283G>A, c.235delC, c.176_191del and c.109G>A was high, and their sequences were merged to obtain the merged sequence 2, the specific sequence is as follows:

[0160] ACAAGGCCAGGCGTTGCACTTCACCAGCCGCTGCATGGAGAAGCCGTCGTACATGACATAGAAGACGTACATGAAGGCGGCTTCGAAGATGACCCGGAAGAAGATGCTGCTTGTGTAGGTCCACCACAGGGAGCCTTCGATGCGGACCTTCTGGGTTTTTGATCTCCTCGATGTCCTTAAATTCACTCTTTATCTCCCCCTTGATGAACTTCCTTCTTCTC[AT / -

[0161] ]GTCTCCGGTAGGCCAYGTGCATGGCCACTAGGAGCGCTGGCGTGGACACGAAGATC AGCTGCA[G / -

[0162] ]GGCCCATAGCCGGATGTGGGAGATGGGGAAGTAGTGATCGTAGC[ACACGTTTCTGC AGCC / -]TGGCTGCAGGGTGTTGCAGACAAAGTCGGCCTGCTCATCTCCCCACACCTCCTTTGCAGCCACAAYGAGGATCATAATGCGAAAAATGAAGAGGACGGTGAGCCAGATCTTTCCAATGCTGGTGGAGTGTTTGTTCACACCCCCCAGGATCGTCTGCAGCGTGCCCCAATCCATCTTCTACTCT.

[0163] Furthermore, the homology of the deafness gene mutation sites m.1494C>T and m.1555A>G was high, and their sequences were merged to obtain a merged sequence 3, as shown in SEQ ID No.127, which is as follows:

[0164] ACCCACGTAAAGACGTTAGGTCAAGGTGTAGCCCATGAGGTGGCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTTATGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTGAGAGTAGAGTGCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACYCT CCTCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATAGAGGAGRCAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACGAACCAGAGTGTAGCTTAACACAAAGCACCCAACTTACACTTAGGAGATTTCAACTTAACTTGACCGCTCTGAGCTAAACCTAGCCC.

[0165] The homology of other mutation sites was far away from that of other mutation sites, so separate sequences were retained for subsequent analysis.

[0166] Example 2

[0167] In this embodiment, the sample genomic DNA is used as a template, and a PCR amplification primer set as shown in SEQ ID No. 1 to 78, a DNA polymerase, and a PCR amplification buffer are provided to perform an amplification reaction to obtain a PCR product.

[0168] Experimental methods:

[0169] The final concentration of DNA polymerase was controlled to be 0.05U, the final concentration of template DNA was 5-50ng, and the final concentration of PCR amplification buffer was tested. 2+ , dNTP, Tris-HCl and KCI components in the reaction system at different final concentrations and analyzed:

[0170] (1) Prepare the following Mg 2+ Final concentration of reaction system: 1.75mmol / L, 2.25mmol / L, 3.75mmol / L and 4.25mmol / L, 4.75mmol / L, 5.25mmol / L, 5.75mmol / L.

[0171] (2) Prepare reaction systems with the following final dNTP concentrations: 0.1875 mmol / L, 0.25 mmol / L, 0.3125 mmol / L, 0.375 mmol / L, and 0.4375 mmol / L.

[0172] (3) Prepare the following reaction systems with final KCl concentrations: 30 mmol / L, 50 mmol / L, 70 mmol / L, and 90 mmol / L.

[0173] (4) Prepare the following reaction systems with final Tris-HCl concentrations: 5 mmol / L, 7.5 mmol / L, 10 mmol / L, 12.5 mmol / L, 15 mmol / L, and 17.5 mmol / L.

[0174] The PCR amplification buffer obtained by preparing the above components with different concentrations was used for PCR reaction to obtain PCR reaction products. The PCR reaction products were analyzed by agarose electrophoresis. The results of the electrophoresis analysis were as follows:

[0175] When Mg 2+ The final concentration of Mg in the reaction system can be detected in the range of 4.25.5 to 5.75 mmol / L. 2+ When the final concentration in the reaction system is 5.25mmol / L, the detection result is optimal.

[0176] Detection can be achieved when the final concentration of dNTPs in the reaction system is between 0.25 and 3.75 mmol / L, and the detection result is best when the final concentration of dNTPs in the reaction system is 0.25 mmol / L.

[0177] The detection can be achieved when the final concentration of KCI in the reaction system is between 50 and 70 mmol / L, and the detection result is best when the final concentration of KCI in the reaction system is 70 mmol / L.

[0178] The detection can be achieved when the final concentration of Tris-HCl in the reaction system is between 5 and 17.5 mmol / L, and the detection result is best when the final concentration of Tris-HCl in the reaction system is 15 mmol / L.

[0179] Based on the above results, the optimum concentrations of the components of the PCR amplification buffer in the amplification reaction system are confirmed as shown in Table 8. The amplification reaction system is further determined as shown in Table 9.

[0180] Table 8. Final concentration of each component of PCR buffer

[0181] Component name Final concentration of components Component name Final concentration of components <![CDATA[Mg 2+ ]]> 5.25mmol / L KCI 70mmol / L dNTPs 0.25mmol / L Tris-HCl 15mmol / L

[0182] Table 9. Amplification reaction system

[0183] Element Volume (μL) Element Volume (μL) <![CDATA[H 2 The]]> 2.8 DNA polymerase 0.2 10X PCR Amplification Buffer 0.5 DNA (20ng / μL) 1 PCR amplification primer set 0.5 / /

[0184] Comparative Example 1: A system for an amplification reaction in a detection method in the prior art is provided. The amplification reaction system is shown in Table 10 below.

[0185] Table 10. MassARRAY system original PCR amplification reaction system

[0186] Element Volume (μL) Element Volume (μL) <![CDATA[H 2 The]]> 2.3 Primer Mix 0.5 10x PCR Buffer 0.5 PCR Enzyme 0.2 <![CDATA[25mM MgCl 2 ]]> 0.4 DNA (20ng / μL) 1 25mM dNTP Mix 0.1 / /

[0187] Result analysis: According to the amplification reaction system in the detection process provided in Example 2 and Comparative Example 1, it can be seen that the amplification reaction system provided in Example 2 of the present invention is simpler, and the components required for the amplification reaction are prepared into a tube of 10x PCRBuffer, without the need to add additional components such as MgCl2 and dNTP, which is simpler and less prone to errors in actual operation.

[0188] Example 3: Investigation of the influence of the concentration of each component of the new amplification reaction system on the detection results

[0189] In this example, the final concentration of DNA polymerase in the PCR reaction system used was 0.05 U, the amplification primers were as shown in Example 2, the final concentration of template DNA was 5 to 50 ng, and the final concentration of PCR buffer was tested. 2+ , dNTP, Tris-HCl and KCI components in the reaction system.

[0190] Prepare the following Mg 2+ The final concentration of the reaction system: 1.875mmol / L, 2.5mmol / L, 3.125mmol / L and 3.75mmol / L. The results show that when Mg 2+ The final concentration of Mg in the reaction system can be detected in the range of 2.5 to 3.75 mmol / L. 2+ When the final concentration in the reaction system is 3.125mmol / L, the detection result is optimal.

[0191] Reaction systems with the following final dNTPs concentrations were prepared respectively: 0.1875mmol / L, 0.25mmol / L, 0.3125mmol / L, 0.375mmol / L and 0.4375mmol / L. The results showed that detection could be achieved when the final concentration of dNTPs in the reaction system was between 0.25 and 3.75mmol / L, among which the detection result was best when the final concentration of dNTPs in the reaction system was 0.25mmol / L.

[0192] The following reaction systems with final KCI concentrations were prepared respectively: 20mmol / L, 40mmol / L, 50mmol / L and 60mmol / L. The results showed that detection could be achieved when the final concentration of KCI in the reaction system was between 40 and 60mmol / L, and the best detection result was achieved when the final concentration of KCI in the reaction system was 50mmol / L.

[0193] The following reaction systems with final Tris-HCl concentrations were prepared respectively: 5mmol / L, 7.5mmol / L, 10mmol / L, 12.5mmol / L and 15mmol / L. The results showed that detection could be achieved when the final concentration of Tris-HCl in the reaction system was 5-12.5mmol / L, among which the detection result was best when the final concentration of Tris-HCl in the reaction system was 10mmol / L.

[0194] Finally, it was confirmed that the final concentrations of the components of the PCR buffer in the amplification reaction system were the same as those in Table 11; the amplification reaction system was the same as that in Table 12:

[0195] Table 11. Final concentration of each component of PCR buffer

[0196] Component name Final concentration of components Component name Final concentration of components <![CDATA[Mg 2+ ]]> 3.125mmol / L KCI 50mmol / L dNTPs 0.25mmol / L Tris-HCl 10mmol / L

[0197] Table 12. Amplification reaction system

[0198] Component name Final concentration of components Component name Final concentration of components 10*PCR Buffer Prepared as 10x buffer as shown in Table 7 DNA polymerase 0.05U Primer 0.5~1μM DNA (template) 5~50ng

[0199] Example 4: Investigation of the effect of annealing temperature on detection results in amplification reaction procedures

[0200] The procedure of the amplification reaction provided in this embodiment is shown in Table 13 below:

[0201] Table 13. Amplification reaction program

[0202]

[0203] According to the PCR amplification reaction program, the different annealing temperatures in step 2 of the reaction program were tested, and the following annealing temperatures were set respectively: 55° C., 56° C., 57° C. and 58° C.

[0204] The results showed that detection could be achieved when the annealing temperature was between 55 and 58° C., and the best detection result was achieved when the annealing temperature was 56° C. When the amplification reaction program was as shown in Table 13, the annealing temperature was 56° C., and the amplification time was 53 minutes and 23 seconds.

[0205] Comparative Example 2

[0206] The original Agena amplification reaction program was: 95°C for 2 min; 40 cycles: 95°C for 30 s, 56°C for 30 s, 70°C for 60 s; 72°C for 5 min; 4°C hold; the amplification time was 2 hours and 2 minutes.

[0207] Result analysis:

[0208] Through the PCR amplification reaction programs provided in Example 4 and Comparative Example 2, it can be found that the time for the amplification reaction program of Example 4 is 53 minutes and 23 seconds; while the amplification time in the prior art provided in Comparative Example 2 is 2 hours and 2 seconds. It can be seen that the reaction time of the amplification program of Example 4 is reduced by 69 minutes compared with the original amplification reaction program, the speed is greatly improved, the detection process is shortened, and it is conducive to wide application.

[0209] Example 5: Adjustment of primers in a primer set

[0210] It should be noted that the particularity of MassARRAY detection is that it is necessary to first amplify the fragment containing the target SNP site through PCR reaction, then extend the base of the SNP site through extension primers, and determine the SNP site information through the molecular weight of its product. In this embodiment, multiple SNP site information can be detected, which requires that there should be no obvious interference between the PCR reaction and extension reaction of each SNP site.

[0211] No call phenomenon occurred at c.916G>A site. After redesigning PCR primers (the upstream primer sequence before change was: ACGTTGGATGTAGTGACGTCATTTCGGGAG, and the downstream primer sequence was: ACGTTGGATGGGAGACCAGAACTCTCAATC), the samples were tested and it was found that the changed PCR primers had better test results. No no call occurred in the test of 36 samples. The specific cluster peak diagram before the primer change is shown in the figure below. Figure 1 As shown in the figure, the specific cluster peak diagram after changing the primers is as follows Figure 2 As shown in the figure, it can be seen that the clusters before the primers were changed were all nocalls, while the clusters after the changes were normal and all successfully reported the locus genotypes, which shows that the primers after the changes are better than the primers before the changes and meet the detection requirements of this project.

[0212] The peak at the c.919-2A>G site was low. After redesigning the extension primer (the extension primer sequence before the change was: GACGATAATTGCTACTG), the test was performed according to the above steps. It was found that the extended primer test effect was better after the change, and the low peak phenomenon was improved. The peak diagram of the primer front site before optimization is as follows Figure 3 As shown, the site peak diagram after changing the primer optimization is as follows Figure 4As shown in the figure, it can be seen that the peak of the site was low before the primer was changed, while the clustering after the change was normal and the site genotype was successfully reported, which shows that the primer after the change is better than the primer before the change and meets the detection requirements of this project.

[0213] In summary, the optimal PCR amplification primers and single base extension (UEP) primers ( Figure 5-6 , the corresponding relationship between primers and numbers in the figure is shown in Table 14 and Table 15), and the specific primer sequences are shown in Table 1 to Table 5.

[0214] Table 14. Extension primers for 29 SNP sites in the first primer set

[0215]

[0216] Table 15. Extension primers for 18 SNP sites in the second primer set

[0217] NO. Primer No. NO. Primer No. NO. Primer No. 1 UEP.c.589G>A 7 UEP.c.35delG 13 UEP.c.427C>T 2 UEP.c.1273C>T 8 UEP.c.257C>G 14 UEP.c.995C>T 3 UEP.c.547G>A 9 UEP.c.167delT 15 UEP.c.1692dup 4 UEP.c.3587A>G 10 UEP.c.811C>T 16 UEP.c.9690+1G>A 5 UEP.c.1975G>C 11 UEP.c.551T>C 17 UEP.c.7396-1G>A 6 UEP.c.4714C>T 12 UEP.c.2162C>T 18 UEP.c.512_513insAACG

[0218] Embodiment 6:

[0219] In this example, the kit was used to detect 47 mutation sites of deafness.

[0220] Experimental methods:

[0221] (1) Multiplex PCR reaction: Amplification primers containing 47 mutation sites were prepared according to the above-mentioned amplification primer concentrations, and multiplex amplification reactions were performed according to the reaction system in Table 16.

[0222] The reaction procedure was as follows: 95°C for 2 min, 96°C for 15 s; 30 cycles: 94°C for 10 s, 56°C for 15 s, 70°C for 10 s; 60°C for 8 min; 4°C Hold; the ramps at 56°C and 70°C were 58% and 46%, respectively.

[0223] Table 16. PCR amplification reaction system

[0224] Element volume Element volume <![CDATA[H 2 The]]> 2.8μL DNA polymerase 0.2μL 10*PCR Buffer 0.5μL DNA 1μL PCR Primer 0.5μL Total volume 5μL

[0225] (2) Digestion reaction: Prepare the SAP mixture according to Table 17, and add it to the above PCR amplification product for shrimp alkaline phosphatase digestion to eliminate excess dNTP. The digestion reaction conditions are: 37°C for 40 min; 85°C for 5 min.

[0226] Table 17. SAP reaction system

[0227] Element volume Element volume <![CDATA[H 2 The]]> 1.53μL SAP Enzyme 0.30μL SAP Buffer 0.17μL Total volume 2μL

[0228] (3) Single base extension reaction: Add the extension reaction system (Table 18) to the digestion reaction product, wherein the extension primer mixture is mixed at the above concentration. The reaction procedure is as follows: 94°C 30s; {94°C 5s, (52°C 5s, 80°C 5s) × 5 cycles} × 40 cycles; 72°C 3min; 4°C hold.

[0229] Table 18. Extension reaction system

[0230] Element volume Element volume <![CDATA[H 2 The]]> 0.62μL Extend Primer Mix 0.94μL iPLEX Buffer 0.20μL iPLEX Enzyme 0.04μL iPLEX Termination mix 0.20μL Total volume 2.00μL

[0231] (4) Desalting: Add 41 μL of water to the extension product obtained in step (3) and centrifuge. Add 15 mg of clean resin: Gently invert the sample plate in midair and place it on the dimple plate with the resin, then invert the dimple plate and the sample plate together (the two plates cannot move horizontally during the process) to allow the resin to fall into the wells. Seal the plate with a membrane and rotate it on a rotator for 15 minutes to desalt; centrifuge at 3200 g for 5 minutes.

[0232] (5) The Nanodispenser was used to spot the product on the chip, and the Analyzer was used to scan the chip. Finally, the Typer4.0 software was used to analyze the mutation status of each target gene to observe whether there was a peak at the variant base in the mass spectrum peak.

[0233] (6) The results show that:

[0234] According to the above operation, the normal genotype and mutant genotype of the 47 mutation sites mentioned above were obtained. The results of individual sites are as follows Figure 7 to Figure 10 shown.

[0235] The above results were compared with the results of the original reagent test of Agena ( Figure 11 to Figure 14 ) were compared, and the test results of the two detection methods were completely consistent, which proved the reliability of the detection method of the present application.

[0236] The experimental results show that the amplification reaction system and procedure of the present invention can achieve the same effect as the original amplification reaction system procedure of Agena Company. The constructed kit can simultaneously detect 47 deafness mutation sites. The detection process is simple and efficient, and the results are readable.

[0237] Example 7: Verification of the reaction system

[0238] In this embodiment, after confirming the optimal reaction system, a series of verification experiments were conducted, including experimental verification of accuracy, repeatability and one-time experimental success rate.

[0239] Experimental methods:

[0240] (1) Accuracy experimental verification plan:

[0241] Verification method: At least one sample was selected from each of the above 47 sites for Sanger sequencing, and the Sanger sequencing results were compared with the nucleic acid mass spectrometry results.

[0242] Evaluation criteria: Since it is extremely difficult to collect clinical samples for individual mutation sites, mutant plasmids are prepared and compared and verified. Sanger sequencing and nucleic acid mass spectrometry results are compared, and the verification is passed if the consistency is greater than 95%.

[0243] Table 19. Verification results of accuracy (taking some sites as examples)

[0244] Mutation site Sanger sequencing results Nucleic acid mass spectrometry results Mutation site Sanger sequencing results Nucleic acid mass spectrometry results c.6466A>C AC AC c.283G>A CT CT c.551T>C AG AG c.1160C>T CT CT

[0245] Comparison of nucleic acid mass spectrometry results and Sanger results shows that the accuracy of the system verification experiment in this example is 100% ( Figure 15 to Figure 22 ).

[0246] (2) Repeatability test verification plan:

[0247] Verification method: Five mutant clinical samples were selected and each sample was tested twice.

[0248] Evaluation criteria: The consistency of the two test results is required to be 100%.

[0249] The specific verification process is as follows:

[0250] First, according to the operation steps provided in Example 6 of the present invention, PCR amplification, shrimp alkaline phosphatase consumption, single base extension, resin desalting and MassARRAY spot analysis were performed respectively, and then the results were analyzed.

[0251] Repeatability test results: The test results of each sample were consistent for 2 times, with a consistency of 100%.

[0252] (3) Personnel comparison and reagent comparison experimental verification plan:

[0253] Verification method and evaluation criteria: Two operators (A and B) use the same reagent to test the same sample, and compare the differences in results between the operators. If the consistency is greater than 95%, the verification is passed.

[0254] Three batches of primers [Batch A (abbreviated as A), Batch B (abbreviated as B), and Batch C (abbreviated as C)] were prepared. The same experimental operator used primer batches A, Batch B, and Batch C to test the same sample, and the results between the reagents were compared. If the consistency was greater than 95%, the verification was passed.

[0255] Table 20. Results of personnel comparison and reagent comparison

[0256]

[0257] Through comparison of test results between personnel and between reagents, it can be known that the batch precision, consistency of comparison between personnel and comparison between reagents of the system of the present invention are all 100%.

[0258] In summary, the primer set, detection method and application thereof for detecting pre-deafness mutation sites designed and optimized based on the MassARRAY nucleic acid mass spectrometry platform provided by the present invention can simultaneously detect 47 mutation sites, and can simultaneously conduct a comprehensive inspection and accurately type, thereby realizing rapid and effective detection of deafness mutation sites, and has the advantages of high throughput, high accuracy, high sensitivity, short detection cycle, and low detection cost. The present invention can effectively avoid the current situation in which only high fever point mutations are detected in the detection of deafness mutation sites, and a large number of patients with dual or multiple mutations are missed, thereby guiding the clinic to accurately type and avoiding missed diagnosis or misdiagnosis.

[0259] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein by equivalents. However, these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry, characterized in that: The primer set is used for typing detection of relevant mutation sites of the following genes: GJB2, GJB3, SLC26A4, 12S rRNA, MYO7A, MYO15A, TMPRSS3, TMC1, LOXHD1, PAX3, EYA4, TJP2 and OTOF.

2. The primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry according to claim 1, characterized in that: The mutation sites targeted by the primer set include: c.919-2A>G, c.2168A>G, c.281C>T, c.1229C>T, c.1174A>T, c.1707+5G>A , c.2027T>A, c.1226G>A, c.754T>C, c.1160C>T, c.235delC, c.109G>A, c. 299_300delAT, c.176_191del, c.283G>A, c.508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, m.1494C>T, m.1555A>G, c.589G >A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C, c.6466A>C , c.1975G>C, c.589G>A, c.2162C>T, c.1692dup, c.257C>G, c.427C>T, c.3 5delG, c.512_513insAACG, c.167delT, c.547G>A, c.9690+1G>A, c.7396-1G>A, c.4714C>T, c.811C>T, c.1273C>T, c.551T>C, c.3587A>G and c.995C>T.

3. The primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry according to claim 1, characterized in that: The mutation sites targeted by the primer set include: the primer set is divided into the following two groups, namely, a first primer set and a second primer set; The first primer set is used to detect c.919-2A>G, c.2168A>G, c.281C>T, c.1229C>T, c.1174A>T, c.1707+5G>A, c.2027T>A, c.1226G>A, c.754T>C, c.1160C>T, c.235delC, c.109G>A, c.299_300delAT, c.176_191del, c.28 primer sets for the 3G>A, c.508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, m.1494C>T, m.1555A>G, c.589G>A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C, and c.6466A>C mutation sites; The second primer set is a primer set for detecting c.1975G>C, c.589G>A, c.2162C>T, c.1692dup, c.257C>G, c.427C>T, c.35delG, c.512_513insAACG, c.167delT, c.547G>A, c.9690+1G>A, c.7396-1G>A, c.4714C>T, c.811C>T, c.1273C>T, c.551T>C, c.3587A>G and c.995C>T mutation sites.

4. The primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry according to claim 3, characterized in that: The first primer set includes an independent site set, a first combination site set, a second combination site set, and a third combination site set; The independent site set is a primer set for detecting c.281C>T, c.1707+5G>A, c.2027T>A, c.919-2A>G, c.754T>C, c.2168A>G, 508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, c.589G>A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C, and c.6466A>C mutation sites; The first combined site set is a primer set for detecting c.1160C>T, c.1174A>T, c.1226G>A, and c.1229C>T mutation sites; The second combined site set is a primer set for detecting c.299_300delAT, c.283G>A, c.235delC, c.176_191del, and c.109G>A; The third combination site set is a primer set for detecting m.1494C>T and m.1555A>G mutation sites.

5. The primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry according to claim 4, characterized in that: The independent site set includes: 17 amplification primers corresponding to 17 sites c.281C>T, c.1707+5G>A, c.2027T>A, c.919-2A>G, c.754T>C, c.2168A>G, 508_511dupAACG, c.9G>A, c.35insG, c.538C>T, c.432delA, c.916G>A, c.589G>A, c.6559-2A>G, c.2241_2242delAG, c.4198G>A, c.4459A>C and c.6466A>C, a PCR upstream primer as shown in SEQ ID NO.117, and 17 amplification primers corresponding to the 17 sites as shown in SEQ ID PCR downstream primers shown as NO.37-54, and 17 extension primers shown as SEQ ID NO.79-96 corresponding to the 17 sites in sequence.

6. The primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry according to claim 4, characterized in that: The first combination site set includes: a PCR upstream primer as shown in SEQ ID NO.73 among the amplification primers corresponding to the four sites c.1160C>T, c.1174A>T, c.1226G>A and c.1229C>T, a PCR downstream primer as shown in SEQ ID NO.76 among the amplification primers corresponding to the four sites, and four extension primers as shown in SEQ ID NOs.115 to 118 corresponding to the four sites in sequence; The second combination site set includes: a PCR upstream primer as shown in SEQ ID NO.74 among the amplification primers corresponding to the five sites c.299_300delAT, c.283G>A, c.235delC, c.176_191del and c.109G>A, a PCR downstream primer as shown in SEQ ID NO.77 among the amplification primers corresponding to the five sites, and five extension primers as shown in SEQ ID NOs.119 to 123 corresponding to the five sites in sequence; The third combination site set includes: a PCR upstream primer as shown in SEQ ID NO.75 among the amplification primers corresponding to the two sites m.1494C>T and m.1555A>G, a PCR downstream primer as shown in SEQ ID NO.78 among the amplification primers corresponding to the two sites, and two extension primers as shown in SEQ ID NOs.124 to 125 corresponding to the two sites in sequence.

7. The primer set for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry according to claim 3, characterized in that: The second primer set includes: PCR upstream primers as shown in SEQ ID NOs. 19 to 36 among the 18 amplification primers corresponding to the 18 sites c.1975G>C, c.589G>A, c.2162C>T, c.1692dup, c.257C>G, c.427C>T, c.35delG, c.512_513insAACG, c.167delT, c.547G>A, c.9690+1G>A, c.7396-1G>A, c.4714C>T, c.811C>T, c.1273C>T, c.551T>C, c.3587A>G and c.995C>T, and 18 amplification primers as shown in SEQ ID NOs. PCR downstream primers shown as NO.55-72, and 25 extension primers shown as SEQ ID NO.97-114 corresponding to the 18 sites in sequence.

8. Use of the primer set according to any one of claims 1 to 7 in preparing a product for detecting mutation sites of deafness susceptibility genes based on nucleic acid mass spectrometry, characterized in that: The product includes any one of a detection reagent, a test kit, and a detection device; The product comprises a primer set as described in any one of claims 1 to 7; Preferably, the detection reagent is a reagent combination for detecting mutation sites; Preferably, the product also includes an amplification reaction system; Preferably, the amplification reaction system comprises: DNA polymerase and PCR amplification buffer; Preferably, the DNA polymerase is SuperTaqTM DNA Polymerase; Preferably, the PCR amplification buffer comprises Mg 2+ , dNTP solution, Tris-HCl solution and KCI solution; Preferably, the initial concentration of the DNA polymerase is 0.05U to 0.06U, Mg 2+ The molar concentration of is 4.25mmol / L~5.75mmol / L, the molar concentration of Tris-HCl solution is 5mmol / L~17.5mmol / L, the molar concentration of dNTPs solution is 0.25mmol / L~3.75mmol / L, and the molar concentration of KCl solution is 50mmol / L~70mmol / L; Preferably, the initial concentration of the DNA polymerase is 0.05 U, Mg 2+ The molar concentration of is 5.25mmol / L, the molar concentration of Tris-HCl solution is 15mmol / L, the molar concentration of dNTPs solution is 0.25mmol / L, and the molar concentration of KCl solution is 70mmol / L; Preferably, the reaction procedure of the amplification reaction system is: 94°C pre-denaturation for 30s, {94°C denaturation for 5s, (52°C annealing for 5s, 80°C extension for 5s) × 5 cycles} × 40 cycles; 72°C extension for 3min; 4°C storage; Preferably, the product further comprises a digestion reaction system; Preferably, the digestion reaction system comprises shrimp alkaline phosphatase and shrimp alkaline phosphate buffer; Preferably, the final reaction concentration of the shrimp alkaline phosphatase is 0.25U to 0.26U, and the final reaction concentration of the shrimp alkaline phosphate buffer is 0.035 to 0.036 times the concentration; Preferably, the digestion reaction system is performed as follows: 37°C for 40 min, 85°C for 5 min; Preferably, the product further comprises an extension reaction system; Preferably, the extension reaction system comprises an extension enzyme, an extension stop solution and an extension buffer; Preferably, the final reaction concentration of the elongation enzyme is 0.02 to 0.025 times, the final reaction concentration of the extension buffer is 0.1 to 0.15 times, and the final reaction concentration of the extension stop solution is 0.1 to 0.15 times; Preferably, the reaction procedure of the extension reaction system is: 94°C pre-denaturation for 30s, {94°C denaturation for 5s, (52°C annealing for 5s, 80°C extension for 5s) × 5 cycles} × 40 cycles; 72°C extension for 3min; 4°C storage; Preferably, the product also includes a desalination system; Preferably, the desalination system comprises a cleaning resin.

9. The use according to claim 8, characterized in that The detection device includes at least one of a detection device and a detection consumable; The detection device is based on the MassARRAY platform.

10. A detection method, used for non-diagnostic purposes, characterized in that: include: The primer set as described in any one of claims 1 to 7 is used to detect the nucleotide sequence of the SNP site in the genome.

Images