Biosensing system for liver cancer digital intelligent nursing

Abstract

The invention relates to the technical field of biological medicine. The invention discloses a biosensing system for liver cancer digital intelligent nursing. The biosensing system aims to realize diagnosis or auxiliary diagnosis of the liver cancer by detecting miR-21 in exosome which is a key marker of the liver cancer. According to the biosensing system, high-sensitivity and high-specificity detection of miRNA-21 is achieved through the steps of cracking of exosome, primer exchange reaction amplification, in-vitro transcription, RNA aptamer generation, fluorescence signal detection and the like. According to the biosensing system, the whole detection process can be completed at room temperature, complicated temperature control equipment is not needed, and the requirement of instant detection is met. The biosensing system for liver cancer diagnosis has a wide application prospect and important clinical significance, and provides a new technical means for early diagnosis, treatment and nursing of liver cancer.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a biosensor system for digital and intelligent care of liver cancer. Background Art

[0002] Primary liver cancer, especially hepatocellular carcinoma (HCC, accounting for 75%-85%), is one of the major malignant tumors in the world. The 2022 Global Cancer Report pointed out that its incidence rate ranks sixth and its mortality rate ranks third. Chinese cases account for about half of the world's cases, facing severe challenges. There are about 100 million people at high risk of HCC in China, including patients with cirrhosis and chronic hepatitis. Due to the difficulty of early diagnosis and insufficient screening, most patients are already in the late stage when diagnosed, which affects the survival rate. The 5-year survival rate of HCC patients in my country is much lower than that of developed Asian countries. The "Healthy China 2030" plan emphasizes strengthening the screening and early detection of chronic diseases, especially the early diagnosis and treatment of cancer in high-incidence areas, with the goal of increasing the overall 5-year cancer survival rate by 15% by 2030. Therefore, it is urgent to strengthen the early screening, monitoring and care of people at high risk of HCC to reduce the incidence and mortality, improve the quality of life and reduce the social burden.

[0003] Through liquid biopsy technology, the use of biosensor systems to accurately monitor the content of key disease-related biomarkers (such as miRNA, circulating free DNA, proteins, etc.) has become an indispensable key means in the field of cancer monitoring and care. In order to further expand the coverage of liver cancer screening and reduce the economic burden on patients, it is urgent to develop a new type of efficient, convenient and low-cost biosensor system and apply it to the digital intelligent care of liver cancer to promote innovation and development in this field.

[0004] Existing biosensor systems mainly include two categories: 1. Point-of-care Testing (POCT) systems represented by colloidal gold test strips: This type of system is characterized by its convenience and ease of use, which can achieve rapid detection and reduce the technical threshold of detection operations. However, due to the lack of amplification steps for target signals, the system has limitations in detection sensitivity and accuracy, resulting in relatively low diagnostic efficacy. 2. Detection systems represented by real-time polymerase chain reaction (RT-PCR): As the "gold standard" in the field of clinical molecular diagnosis, this system is known for its excellent detection sensitivity and accuracy. However, it is worth noting that the operation of the RT-PCR system depends on a precise temperature control mechanism, and the entire detection process must be carried out in an experimental environment that strictly follows the "three-chamber separation" (i.e., the sample processing area, amplification area, and product analysis area are isolated from each other), which places high demands on operators, site configuration, and professional equipment, thereby limiting its widespread application in resource-poor areas. Therefore, there is an urgent need to develop a new biosensor system for liver cancer diagnosis, which needs to integrate the characteristics of high-speed response, high efficiency, high precision, instant detection and low cost, in order to improve the popularity and diagnostic accuracy of early diagnosis of liver cancer. Summary of the invention

[0005] In view of this, the present invention provides a biosensor system for digital intelligent nursing of liver cancer, which aims to diagnose or assist diagnosis of liver cancer by detecting microRNA-21 (miR-21) in exosomes, a key marker of liver cancer. The biosensor system achieves high sensitivity (minimum detection limit 2.2fM) and high specificity detection of miRNA-21 through steps such as exosome lysis, primer exchange reaction (Primer Exchange Reaction, PER) amplification, in vitro transcription and RNA aptamer generation, and fluorescence signal detection.

[0006] The biosensor system of the present invention can complete the entire detection process at room temperature without the need for complex temperature control equipment, thus meeting the need for instant detection. In addition, by simplifying the operating steps and reducing equipment requirements, the biosensor system of the present invention has a lower cost, and the test results can be accurately collected through a portable ultraviolet lamp and a mobile phone system. By combining with a large database, the goal of digital intelligent care for liver cancer can be achieved, which is conducive to its promotion and use in primary medical institutions. The liver cancer diagnosis biosensor system of the present invention has broad application prospects and important clinical significance, and provides a new technical means for the early diagnosis, treatment and care of liver cancer.

[0007] The technical solution of the present invention is achieved in this way:

[0008] In a first aspect, the present invention provides a liver cancer diagnosis biosensor system, the biosensor system is constructed based on primer exchange reaction technology under room temperature conditions, and is used to detect liver cancer markers, wherein the liver cancer marker is miR-21 in exosomes;

[0009] The biosensor system includes: a primer exchange reaction system, an RNA aptamer in vitro transcription system and a fluorescence detection system;

[0010] The primer exchange reaction system comprises: a probe, a primer, a transcription template, dNTPs, Mg2+, an RNase inhibitor, a strand displacement DNA polymerase, a buffer and a miRNA sample;

[0011] The in vitro transcription system of the RNA aptamer comprises: NTPs, RNA polymerase, primer exchange reaction product and buffer;

[0012] The fluorescence detection system comprises: an in vitro transcription product of an RNA aptamer, a fluorescent probe, an enzyme marker, an ultraviolet lamp, and an image capturing device.

[0013] In some specific embodiments, the sequence of the probe is SEQ ID NO: 2, the sequence of the primer is SEQ ID NO: 3, and the sequence of the transcription template is SEQ ID NO: 4.

[0014] In some specific embodiments, the components in each 10 μL primer exchange reaction system include the following:

[0015]

[0016]

[0017] In some specific embodiments, the components of each 20 μL RNA aptamer in vitro transcription system include the following:

[0018] Volume (μL) concentration NTPs 1 2.5nM T7 RNA polymerase 0.4 50U / μL 1× T7 RNA polymerase buffer Make up to a total volume of 10 μL - Primer exchange reaction products Make up to a total volume of 20 μL -

[0019] In some specific embodiments, the primer exchange reaction system further includes a DNA sequence pre-bound to the target miR-21, and the DNA sequence is SEQ ID NO:5.

[0020] In a second aspect, the present invention provides an application of the liver cancer diagnosis biosensor system, wherein the application is non-disease diagnosis or treatment, and comprises the following steps:

[0021] S1. Lysis of exosomes to prepare miRNA samples;

[0022] S2. Prepare a primer exchange reaction system and incubate at room temperature;

[0023] S3. Prepare an in vitro transcription reaction system for RNA aptamers and perform the reaction at room temperature;

[0024] S4. Add fluorescent probes to the transcription products obtained in S3, place each sample under ultraviolet light, use an image capture device to photograph the samples and record the fluorescent signals to observe the changes in the fluorescent signals, then place the samples in an ELISA instrument to detect fluorescent signals of different absorption wavelengths, and compare them with a blank group to which no samples were added.

[0025] In some specific embodiments, step S1 specifically further includes: adding the exosome suspension to 20 μL of RIPA lysis buffer and reacting at 4° C. for 15-25 minutes to obtain a miRNA sample.

[0026] In some specific embodiments, in step S2, the components in the primer exchange reaction system include the following:

[0027]

[0028]

[0029] Prepare the primer exchange reaction system and incubate at room temperature for 40-60 minutes.

[0030] In some specific embodiments, in step S3, the components in the primer exchange reaction system include the following:

[0031] Volume (μL) concentration NTPs 1 2.5nM T7 RNA polymerase 0.4 50U / μL 1× T7 RNA polymerase buffer Make up to a total volume of 10 μL - Primer exchange reaction products Make up to a total volume of 20 μL -

[0032] An in vitro transcription reaction system of RNA aptamers was prepared, and then the reaction was allowed to proceed at room temperature for 90-150 minutes.

[0033] In some specific embodiments, step S4 specifically further includes:

[0034] Add 1 μL of 500 mM DFHBI to the transcript obtained in S3;

[0035] Each sample is placed under an ultraviolet lamp, and an image capture device is used to photograph the sample and record the fluorescence signal to observe the change of the fluorescence signal;

[0036] The excitation wavelength was set to 468 nm and the absorption wavelength was set to 504 nm on the microplate reader to detect the fluorescence signal, and compared with the blank group without adding the sample to detect miR-21.

[0037] Terminology explanation:

[0038] Exosome extraction and lysis: Exosomes are extracted from biological samples (such as blood, urine or tissue) of liver cancer patients. Subsequently, the exosomes are lysed using an appropriate lysis method (such as chemical lysis, physical lysis or enzymatic lysis using RIPA lysis buffer) to release nucleic acid samples including miR-21, providing miRNA samples for subsequent amplification reactions.

[0039] PER (primer exchange reaction) probe: also known as a hairpin primer, it has a loop portion and a stem portion. In the primer exchange reaction, it usually serves as a template or basis for signal amplification. Its stem portion can hybridize with the target molecule (such as miR-21), while the loop portion contains a specific sequence for subsequent amplification or detection.

[0040] PER primers: Also known as input primers, they are the starting primers of PER. They are usually complementary to the specific sequence of the target molecule. At the beginning of the reaction, the input primers will hybridize with the target molecule to form a stable double-stranded structure. Subsequently, through a series of enzymatic reactions, such as strand displacement amplification, the input primers will guide the synthesis of new DNA or RNA chains, thereby achieving the amplification of the target molecule.

[0041] Extended primers: In a primer exchange reaction, new DNA or RNA chains are synthesized under the guidance of input primers or hairpin primers. These primers are continuously extended during the reaction to form long-chain molecules that are complementary to the target molecule. Extended primers not only participate in the amplification of the target molecule, but may also serve as templates for subsequent detection or analysis.

[0042] RNA aptamer: In the liver cancer diagnosis biosensor system of the present invention, RNA aptamer is used as a recognition element to detect key liver cancer markers through its specific binding with the target molecule miR-21. Once the aptamer binds to miR-21, this binding can be further converted into a detectable fluorescent signal, thereby achieving the diagnosis or auxiliary diagnosis of liver cancer. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0044] Figure 1 It is a schematic diagram of the principle of the liver cancer diagnosis biosensor system of the present invention;

[0045] Figure 2 The detection results of each group in the feasibility experiment of the biosensor system constructed by the present invention;

[0046] Figure 3 is the detection result in the sensitivity test of the biosensor system of the present invention;

[0047] Figure 4 is the detection result in the specificity test of the biosensor system of the present invention;

[0048] Figure 5 These are the test results of the application test of the biosensor system of the present invention. DETAILED DESCRIPTION

[0049] To make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme in the present invention will be clearly and completely described below. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments in the present invention, all other embodiments obtained by ordinary technicians in the field without creative work are within the scope of protection of the present invention. If the specific conditions are not specified in the embodiments, they are carried out according to the normal conditions or the conditions recommended by the manufacturer. If the manufacturer is not specified in the reagents or instruments used, they are all conventional products that can be purchased commercially.

[0050] The methods used in the following examples are all conventional methods unless otherwise specified. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

[0051] The methods for obtaining various biological materials described in the examples are only provided as an experimental method to achieve the specific disclosed purpose, and should not be construed as limiting the sources of the biological materials of the present invention. In fact, the sources of the biological materials used are extensive, and any biological material that can be obtained without violating laws and moral ethics can be replaced and used according to the instructions in the examples.

[0052] The terms "including" and "having" and any variations thereof of the present invention are intended to cover non-exclusive inclusions. For example, a process, method, apparatus, product or equipment comprising a series of steps is not limited to the listed steps or modules, but may optionally include steps that are not listed, or may optionally include other steps that are inherent to these processes, methods, products or equipment. The "plurality" mentioned in the present invention refers to two or more. "And / or" describes the association relationship of associated objects, indicating that three relationships may exist. For example, A and / or B may represent: A exists alone, A and B exist at the same time, and B exists alone. The character " / " generally indicates that the previously associated objects are in an "or" relationship.

[0053] The experimental instruments in the embodiment include the following:

[0054] Instrument Name Instrument Specifications Multi-function microplate reader Thermo Fisher Heating device Dongsheng Dragon Pipette Aika Centrifuge Ebende Clean bench Labco High Pressure Steam Sterilizer Micro Vortex mixer Thermo Fisher

[0055] The experimental reagents in the embodiment include the following:

[0056]

[0057]

[0058] Example 1 Construction of biosensor system

[0059] In this embodiment, the constructed biosensor system is based on PER (primer exchange reaction) amplification technology under room temperature conditions and is used to detect the target microRNA-21 (ie, miR-21).

[0060] 1. PER reaction:

[0061] In order to verify the feasibility of the biosensor system constructed by the present invention, three groups of parallel repetitions were designed in this embodiment.

[0062] In this example, artificially synthesized miR-21 (sequence see SEQ ID NO: 1) was used.

[0063] The PER reaction system was constructed as follows: it included a miR-21 molecule-specific stem-loop structure DNA probe (hereinafter referred to as the probe or PER probe, the sequence of which is shown in SEQ ID NO: 2), a primer (sequence of which is shown in SEQ ID NO: 3), and a transcription template (sequence of which is shown in SEQ ID NO: 4).

[0064]

[0065] The design principles of PER probes include the following:

[0066] (1) The probe molecule has a loop portion and a stem portion;

[0067] (2) 5' end modification: contains two sites of special base modifications, iso-dG (isoguanine) and iso-dC (isocytosine). These sites can prevent the extension of DNA polymerase under certain conditions and achieve reaction control.

[0068] (3) 3' end domain: a region designed to specifically bind to the protective chain, which is used to recognize and bind to the target miR-21, thereby unlocking the probe and exposing the primer binding site.

[0069] (4) Design of protective chain: The sequence of the protective chain is 5'-TCAACATCAGTCTGATAAGCTATCTCTTATT-InvdT-3', which is specifically complementary to the target RNA (miR-21). The 3' end of the protective chain is modified with InverteddT to ensure that the protective chain only plays an unlocking role in the reaction and does not participate in DNA synthesis. In this embodiment, the addition of the protective chain is completed in the reaction preparation stage, that is, before the mixture of the PER reaction system is added to the test tube, the protective chain has already bound to the target RNA (miR-21), that is, pre-bound.

[0070] like Figure 1 As shown in B(2) (part of the schematic diagram of the PER principle): at room temperature, a strand-displacing DNA polymerase (such as BstDNA polymerase) and dNTPs are added, the primer contacts the unlocked probe, and the 3' end of the primer pairs with a complementary sequence on the probe. Under the action of the strand-displacing DNA polymerase, the primer is extended from the 3' end of the primer, using the pairing domain at the 5' end of the probe as a template. Subsequently, the newly synthesized DNA chain can be further paired and synthesized with another unlocked probe to form a longer single-stranded DNA fragment. By continuously repeating this process, a single-stranded DNA fragment with multiple repetitive sequences can be synthesized, namely the PER reaction product (the extended output primer, i.e., Figure 1 Primer extended in B).

[0071] In some specific embodiments of the present invention, in the PER reaction system, when the transcription template is introduced, it can promote the primer to quickly and specifically rebind to the complementary sequence of the transcription template after the extension is completed. This mechanism significantly reduces the time required for the overall reaction. Then, in the second stage of the reaction process, the in vitro transcription process for the specific RNA aptamer can be seamlessly connected and started immediately without additional induction or waiting steps, thereby ensuring the continuity and efficiency of the entire transcription process.

[0072] The specific steps are as follows:

[0073] miR-21 was diluted to a concentration of 1 μM. The PER reaction system (10 μL) was as shown in Table 1. The reaction was carried out at room temperature for 50 min.

[0074] Table 1

[0075] Volume (μL) concentration Probe 1 500nM Primers 1 100nM Transcription template 1 1000nM dNTPs 0.4 2.5nM Magnesium sulfate solution 1 10mM RNase inhibitors 0.5 40 U / μL 1×BstDNA polymerase 0.4 80U / μL 1×BstDNA polymerase buffer Make up to a total volume of 9 μL - miR-21 Make up to a total volume of 10 μL 1μM

[0076] 2. In vitro transcription of RNA aptamers

[0077] like Figure 1 As shown in B(3) (Schematic diagram of in vitro transcription principle), the process of in vitro transcription includes the extended output primer binding to the transcription template chain to form a T7 promoter, which is recognized by the T7 RNA polymerase and initiates transcription, thereby producing a large number of RNA aptamers with a preset sequence. The reaction system (20 μL) of T7 RNA polymerase (i.e., in vitro transcription of RNA aptamers) is shown in Table 2. The reaction was carried out at room temperature for 120 min.

[0078] Table 2

[0079] Volume (μL) concentration NTPs 1 2.5nM T7 RNA polymerase 0.4 50U / μL 1× T7 RNA polymerase buffer Make up to a total volume of 10 μL - The PER reaction product obtained in the previous step Make up to a total volume of 20 μL -

[0080] 3. Fluorescence detection: Add 1 μL of 500 mM DFHBI to the transcription product. Set the excitation wavelength to 468 nm and the absorption wavelength to 504 nm on the microplate reader. Detect the fluorescence signal and compare it with the blank group without adding the sample.

[0081] 4. Data analysis: The difference in fluorescence intensity between the fluorescence signal detected in this example and the blank group represents the amplification and post-transcription amount of miR-21. Figure 2 As shown in the figure, only when all experimental components (including primers, probes, transcription templates, BstDNA polymerase and miR-21 to be detected) are complete, can a significant fluorescence signal be generated, and its intensity is much higher than the background signal value. This result strongly proves that this method can perform semi-quantitative detection of miR-21 as designed. The fluorescence value detection data of each group of parallel repeats in the experiment are shown in Table 3:

[0082] Table 3

[0083] Grouping Parallel 1 Parallel 2 Parallel 3 Missing primers 1.48 2.06 1.86 Missing probe 2.38 2.33 2.15 Missing transcription template 1.28 1.28 1.35 Lack of BstDNA polymerase 2.03 2.25 2.25 Missing miR-21 12.58 13.51 13.39 Positive control group 414.40 387.00 409.80

[0084] Example 2 Sensitivity experiment (determination of detection limit)

[0085] In this example, artificially synthesized miR-21 was used to determine the detection limit, and each group in the experiment was repeated three times in parallel. The steps are as follows:

[0086] 1. Dilute miR-21 to different concentrations using DEPC-treated water. Prepare the PER reaction system as shown in Table 4. Incubate at room temperature for 50 min.

[0087] Table 4

[0088]

[0089]

[0090] 2. In vitro transcription of RNA aptamers

[0091] The T7 RNA polymerase (i.e., in vitro transcription of RNA aptamers) reaction system (20 μL) is as shown in Table 2 of Example 1. The reaction was carried out at room temperature for 120 min.

[0092] 3. Fluorescence detection

[0093] Add 1 μL of 500 mM DFHBI to the transcripts, place each sample under UV light, use a high-resolution smartphone camera or professional imaging equipment to photograph the sample and record the fluorescence signal to observe the change in the fluorescence signal. Place the sample in a microplate reader, set the excitation wavelength to 468 nm, the absorption wavelength range to 490-550 nm, and the step length to 1 nm, and detect the fluorescence signals at different absorption wavelengths.

[0094] 4. Data Analysis

[0095] Use prismGraphpad8.0 or other data analysis software to perform nonlinear fitting and linear fitting on the detected fluorescence signal to evaluate the detection performance and sensitivity of this method for miR-21. According to the fitting results, determine the regression equation to calculate the fluorescence signal intensity at different concentrations and evaluate the detection limit of this method. Observe and analyze the relationship between the fluorescence signal intensity and the miR-21 concentration. The fluorescence signal numerical detection data are as follows:

[0096]

[0097]

[0098] like Figure 3 As shown in the figure, as the concentration of miR-21 increases, the fluorescence intensity generated by this method increases accordingly and reaches a plateau at a miR-21 concentration of 50 nM. In the concentration range of 1 fM to 100 pM, the logarithm of the miR-21 concentration and the fluorescence intensity show a good linear relationship. The regression equation is F = 3.601C + 40.33 (R 2 =0.989), where C is the concentration of miR-21 and A is the fluorescence intensity. The detection limit of miR-21 is 2.2 fM. In addition, as the concentration of miR-21 increases, the corresponding color in the reaction solution under ultraviolet irradiation can also change from colorless fluorescence to green fluorescence.

[0099] Example 3 Specificity Experiment

[0100] In this example, different types of miRNA (including miR-let-7a, miR-let-7b, miR-141, miR-155 and miR-21) were subjected to a room temperature amplification detection experiment of miR-21 based on PER reaction using the method of the present invention, and each group in the experiment was repeated three times in parallel.

[0101] The sequences of miR-21, miR-141, miR-155, miR-let-7a, and miR-let-7b are as follows:

[0102] Sequence (5'-3') SEQ ID NO miR-21 UAGCUUAUCAGACUGAUGUUGA 1 miR-141 UAACACUGUCUGGUAAAGAUGG 6 miR-155 UUAAUGCUAAUCGUGAUAGGGGUU 7 miR-let-7a UGAGGUAGUAGGUUGUAUAGUU 8 miR-let-7b UGAGGUAGUAGGUUGUGUGGUU 9

[0103] miR-let-7a, miR-let-7b, miR-141, miR-155 and miR-21 were diluted to a concentration of 1 μM. According to the reaction system and steps in Example 1 (only the corresponding miRNAs were different, and the others were the same), PER reaction, in vitro transcription of RNA aptamers and fluorescence detection were performed respectively. The detection data are as follows:

[0104]

[0105]

[0106] like Figure 4 As shown, the system provided by the present invention can specifically detect miR-21, while the fluorescence detection signal for other types of miRNA is not significant, thereby proving that the system has high specificity.

[0107] Example 4 Application of liver cancer diagnosis biosensor system

[0108] In this example, exosomes of normal human liver cells L-02 and liver cancer cells HepG2 were extracted respectively, and the room temperature amplification detection experiment of miR-21 in exosomes based on PER reaction was carried out using the method of the present invention. Each group in the experiment was repeated three times in parallel.

[0109] 1. Extraction of exosomes from L-O2 and HepG2 cells:

[0110] The exosomes in the L-O2 or HepG2 cell culture medium were extracted by ultracentrifugation. First, 20 mL of L-O2 or HepG2 cell culture medium without fetal bovine serum was centrifuged at 2000g for 10 minutes at 4°C to remove possible cells or apoptotic cells. Then the supernatant after centrifugation was centrifuged at 10000g for 30 minutes at 4°C to remove cell debris. Finally, the supernatant was centrifuged at 150000g for 70 minutes at 4°C, the supernatant was removed, the precipitate was dissolved with PBS, and then centrifuged at 150000g for 70 minutes at 4°C. After removing the supernatant, the exosome precipitate was dissolved in 200μL of PBS and stored at -70°C.

[0111] 2. Lysis of exosomes to prepare miRNA samples and PER reaction

[0112] Add 20 μL of RIPA lysis buffer to the exosome suspension obtained in step 1 and react at 4°C for 20 min to obtain miRNA samples. Then gradient dilute the miR-21 standard. Configure the PER reaction system as shown in Table 5. Incubate at room temperature for 50 min.

[0113] Table 5

[0114]

[0115]

[0116] 3. In vitro transcription of RNA aptamers

[0117] The T7 RNA polymerase (i.e., in vitro transcription of RNA aptamers) reaction system (20 μL) is as shown in Table 2 of Example 1. The reaction was carried out at room temperature for 120 min.

[0118] 3. Fluorescence detection

[0119] Add 1 μL of 500 mM DFHBI to the transcripts, place each sample under UV light, use a high-resolution smartphone camera or professional imaging equipment to photograph the sample and record the fluorescence signal to observe the change in the fluorescence signal. Place the sample in a microplate reader, set the excitation wavelength to 468 nm, the absorption wavelength range to 490-550 nm, and the step length to 1 nm, and detect the fluorescence signals at different absorption wavelengths.

[0120] 5. Obtain an absolute quantitative standard curve using the standard miR-21

[0121] After amplifying and transcribing miR-21 in L-O2 or HepG2 exosomes, the fluorescence signal detected by DFHBI was added, and the amount of miR-21 in the exosomes was calculated using the standard curve calculated by the standard. The specific steps are as follows:

[0122] 0.2 μL of 10 μM reverse transcription primer, 2 μL reverse transcriptase and miRNA sample or standard were mixed into a 20 μL system, and the reaction was carried out at 25°C for 5 minutes, 50°C for 15 minutes, and 85°C for 5 minutes to complete the reverse transcription step of miR-21. qPCR was used to quantify miR-21 in the sample. The qPCR reaction system was as follows: 2 μL of 2 μM primer-probe mixture, 10 μL qPCR reaction solution were taken, and 2 μL of the obtained reverse transcription product was added to prepare a 20 μL reaction system.

[0123] DEPC-treated water was used as a negative control sample and the reverse transcription product of the sample to be tested was subjected to PCR reaction at the same time. The reaction procedure was: (1) 95℃ for 10min; (2) 95℃ for 15s; (3) 60℃ for 60s; (4) 40 to 45 cycles. The standard miR-21 was used to obtain an absolute quantitative standard curve. The CT value detected by adding DFHBI after amplification and transcription of miR-21 in L-O2 or HepG2 exosomes was used to calculate the amount of miR-21 in exosomes.

[0124] The primer sequences are as follows:

[0125]

[0126] The fluorescence numerical detection results are as follows:

[0127]

[0128] 6. Results Analysis

[0129] like Figure 5 As shown, the accuracy of the semi-quantitative detection method of the biosensor system of the present invention is comparable to the currently widely recognized gold standard RT-qPCR method.

[0130] It can be seen that the biosensor system for liver cancer diagnosis constructed by the present invention, based on the PER amplification technology at room temperature, successfully achieves effective amplification and detection of miR-21 in exosomes, which can not only significantly improve the efficiency and sensitivity of miRNA detection and analysis, but also further reduce the technical threshold of detection. The present invention provides important and necessary information support for the early diagnosis of liver cancer, and is expected to provide a strong basis for the formulation of clinical diagnosis and treatment plans.

[0131] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A liver cancer diagnosis biosensor system, characterized in that: The biosensor system is constructed based on primer exchange reaction technology under room temperature conditions and is used to detect liver cancer markers, wherein the liver cancer marker is miR-21 in exosomes; The biosensor system includes: a primer exchange reaction system, an RNA aptamer in vitro transcription system and a fluorescence detection system; The primer exchange reaction system includes: a probe, a primer, a transcription template, dNTPs, Mg 2+ , RNase inhibitor, strand-displacing DNA polymerase, buffer, and miRNA sample; The in vitro transcription system of the RNA aptamer comprises: NTPs, RNA polymerase, primer exchange reaction product and buffer; The fluorescence detection system comprises: an in vitro transcription product of an RNA aptamer, a fluorescent probe, an enzyme marker, an ultraviolet lamp, and an image capturing device.

2. The liver cancer diagnosis biosensor system according to claim 1, characterized in that: The sequence of the probe is SEQ ID NO: 2, the sequence of the primer is SEQ ID NO: 3, and the sequence of the transcription template is SEQ ID NO:

4.

3. The liver cancer diagnosis biosensor system according to claim 1, characterized in that: The components of each 10 μL primer exchange reaction system include the following:

4. The liver cancer diagnosis biosensor system according to claim 1, characterized in that: The components of each 20 μL RNA aptamer in vitro transcription system include the following:

5. The liver cancer diagnosis biosensor system according to claim 1, characterized in that: The primer exchange reaction system also includes a DNA sequence pre-combined with the target miR-21, and the DNA sequence is SEQ ID NO:

5.

6. The use of the liver cancer diagnosis biosensor system according to any one of claims 1 to 5, characterized in that: The application is non-disease diagnosis or treatment, comprising the following steps: S1. Lysis of exosomes to prepare miRNA samples; S2. Prepare a primer exchange reaction system and incubate at room temperature; S3. Prepare an in vitro transcription reaction system of RNA aptamers and perform the reaction at room temperature; S4. Add fluorescent probes to the transcription products obtained in S3, place each sample under ultraviolet light, use an image capture device to photograph the samples and record the fluorescent signals to observe the changes in the fluorescent signals, then place the samples in an ELISA instrument to detect fluorescent signals of different absorption wavelengths, and compare them with a blank group to which no samples were added.

7. The use according to claim 6, characterized in that: Step S1 specifically includes: adding the exosome suspension to 20 μL of RIPA lysis solution and reacting at 4° C. for 15-25 minutes to obtain a miRNA sample.

8. The use according to claim 6, characterized in that: In step S2, the components in the primer exchange reaction system include the following: Prepare the primer exchange reaction system and incubate at room temperature for 40-60 minutes.

9. The use according to claim 6, characterized in that: In step S3, the components in the primer exchange reaction system include the following: An in vitro transcription reaction system of RNA aptamers was prepared, and then the reaction was allowed to proceed at room temperature for 90-150 minutes.

10. The use according to claim 6, characterized in that: Step S4 specifically also includes: Add 1 μL of 500 mM DFHBI to the transcript obtained in S3; Each sample is placed under an ultraviolet lamp, and an image capture device is used to photograph the sample and record the fluorescence signal to observe the change of the fluorescence signal; The excitation wavelength was set to 468 nm and the absorption wavelength was set to 504 nm on the microplate reader to detect the fluorescence signal, and compared with the blank group without adding the sample to detect miR-21.

Images